{ "report_data_sources": { "FastQC": { "all_sections": { "CAFS1_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/CAFS1_R2_fastqc.zip", "CAFS2_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/CAFS2_R2_fastqc.zip", "CAMS1_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/CAMS1_R2_fastqc.zip", "CAMS2_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/CAMS2_R2_fastqc.zip", "CCFS1_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/CCFS1_R2_fastqc.zip", "CCFS2_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/CCFS2_R2_fastqc.zip", "CCMS1_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/CCMS1_R2_fastqc.zip", "CCMS2_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/CCMS2_R2_fastqc.zip", "CPFS1_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/CPFS1_R2_fastqc.zip", "CPFS2_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/CPFS2_R2_fastqc.zip", "CPMS1_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/CPMS1_R2_fastqc.zip", "CPMS2_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/CPMS2_R2_fastqc.zip", "CVFS1_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/CVFS1_R2_fastqc.zip", "CVFS2_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/CVFS2_R2_fastqc.zip", "CVMS1_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/CVMS1_R2_fastqc.zip", "CVMS2_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/CVMS2_R2_fastqc.zip", "DAFS1_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/DAFS1_R2_fastqc.zip", "DAFS2_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/DAFS2_R2_fastqc.zip", "DAMS1_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/DAMS1_R2_fastqc.zip", "DAMS2_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/DAMS2_R2_fastqc.zip", "DCFS1_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/DCFS1_R2_fastqc.zip", "DCFS2_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/DCFS2_R2_fastqc.zip", "DCMS1_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/DCMS1_R2_fastqc.zip", "DCMS2_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/DCMS2_R2_fastqc.zip", "DPFS1_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/DPFS1_R2_fastqc.zip", "DPFS2_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/DPFS2_R2_fastqc.zip", "DPMS1_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/DPMS1_R2_fastqc.zip", "DPMS2_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/DPMS2_R2_fastqc.zip", "DVFS1_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/DVFS1_R2_fastqc.zip", "DVFS2_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/DVFS2_R2_fastqc.zip", "DVMS1_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/DVMS1_R2_fastqc.zip", "DVMS2_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/DVMS2_R2_fastqc.zip", "IAFS1_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/IAFS1_R2_fastqc.zip", "IAFS2_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/IAFS2_R2_fastqc.zip", "IAMS1_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/IAMS1_R2_fastqc.zip", "IAMS2_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/IAMS2_R2_fastqc.zip", "ICFS1_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/ICFS1_R2_fastqc.zip", "ICFS2_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/ICFS2_R2_fastqc.zip", "ICMS1_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/ICMS1_R2_fastqc.zip", "ICMS2_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/ICMS2_R2_fastqc.zip", "IPFS1_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/IPFS1_R2_fastqc.zip", "IPFS2_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/IPFS2_R2_fastqc.zip", "IPMS1_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/IPMS1_R2_fastqc.zip", "IPMS2_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/IPMS2_R2_fastqc.zip", "IVFS1_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/IVFS1_R2_fastqc.zip", "IVFS2_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/IVFS2_R2_fastqc.zip", "IVMS1_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/IVMS1_R2_fastqc.zip", "IVMS2_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/IVMS2_R2_fastqc.zip", "JAFS1_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/JAFS1_R2_fastqc.zip", "JAFS2_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/JAFS2_R2_fastqc.zip", "JAMS1_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/JAMS1_R2_fastqc.zip", "JAMS2_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/JAMS2_R2_fastqc.zip", "JCFS1_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/JCFS1_R2_fastqc.zip", "JCFS2_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/JCFS2_R2_fastqc.zip", "JCMS1_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/JCMS1_R2_fastqc.zip", "JCMS2_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/JCMS2_R2_fastqc.zip", "JPFS1_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/JPFS1_R2_fastqc.zip", "JPFS2_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/JPFS2_R2_fastqc.zip", "JPMS1_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/JPMS1_R2_fastqc.zip", "JPMS2_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/JPMS2_R2_fastqc.zip", "JVFS1_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/JVFS1_R2_fastqc.zip", "JVFS2_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/JVFS2_R2_fastqc.zip", "JVMS1_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/JVMS1_R2_fastqc.zip", "JVMS2_R2": "/data/MicrobiomaFrangos/output/fastqc/pre/JVMS2_R2_fastqc.zip" } } }, "report_general_stats_data": [ { "CAFS1_R2": { "total_sequences": 163941.0, "percent_gc": 53.0, "avg_sequence_length": 300.98170683355596, "median_sequence_length": 301, "percent_duplicates": 93.9935708578086, "percent_fails": 36.36363636363637 }, "CAFS2_R2": { "total_sequences": 151444.0, "percent_gc": 53.0, "avg_sequence_length": 300.49557592245316, "median_sequence_length": 300, "percent_duplicates": 93.83468476796703, "percent_fails": 36.36363636363637 }, "CAMS1_R2": { "total_sequences": 146978.0, "percent_gc": 53.0, "avg_sequence_length": 300.98525629686077, "median_sequence_length": 301, "percent_duplicates": 93.07651485256297, "percent_fails": 36.36363636363637 }, "CAMS2_R2": { "total_sequences": 167274.0, "percent_gc": 53.0, "avg_sequence_length": 300.9840022956347, "median_sequence_length": 301, "percent_duplicates": 93.5453208508196, "percent_fails": 36.36363636363637 }, "CCFS1_R2": { "total_sequences": 216687.0, "percent_gc": 52.0, "avg_sequence_length": 300.9598614591554, "median_sequence_length": 301, "percent_duplicates": 91.4041912989704, "percent_fails": 36.36363636363637 }, "CCFS2_R2": { "total_sequences": 202999.0, "percent_gc": 52.0, "avg_sequence_length": 300.9239651426854, "median_sequence_length": 301, "percent_duplicates": 91.08369991970403, "percent_fails": 36.36363636363637 }, "CCMS1_R2": { "total_sequences": 209990.0, "percent_gc": 53.0, "avg_sequence_length": 300.9792656793181, "median_sequence_length": 301, "percent_duplicates": 91.62817277013191, "percent_fails": 36.36363636363637 }, "CCMS2_R2": { "total_sequences": 196923.0, "percent_gc": 53.0, "avg_sequence_length": 300.9711867074948, "median_sequence_length": 301, "percent_duplicates": 91.58605140080132, "percent_fails": 36.36363636363637 }, "CPFS1_R2": { "total_sequences": 149702.0, "percent_gc": 54.0, "avg_sequence_length": 300.9125796582544, "median_sequence_length": 301, "percent_duplicates": 92.6099851705388, "percent_fails": 36.36363636363637 }, "CPFS2_R2": { "total_sequences": 179192.0, "percent_gc": 53.0, "avg_sequence_length": 300.9520709629894, "median_sequence_length": 301, "percent_duplicates": 89.05866333318451, "percent_fails": 36.36363636363637 }, "CPMS1_R2": { "total_sequences": 225944.0, "percent_gc": 53.0, "avg_sequence_length": 300.9581843288602, "median_sequence_length": 301, "percent_duplicates": 91.90595899868994, "percent_fails": 36.36363636363637 }, "CPMS2_R2": { "total_sequences": 204777.0, "percent_gc": 52.0, "avg_sequence_length": 300.9623224287884, "median_sequence_length": 301, "percent_duplicates": 89.58183780405025, "percent_fails": 36.36363636363637 }, "CVFS1_R2": { "total_sequences": 219402.0, "percent_gc": 52.0, "avg_sequence_length": 300.9537538399832, "median_sequence_length": 301, "percent_duplicates": 91.72386760375932, "percent_fails": 36.36363636363637 }, "CVFS2_R2": { "total_sequences": 206738.0, "percent_gc": 52.0, "avg_sequence_length": 300.9737493832774, "median_sequence_length": 301, "percent_duplicates": 91.60386576246263, "percent_fails": 36.36363636363637 }, "CVMS1_R2": { "total_sequences": 183364.0, "percent_gc": 52.0, "avg_sequence_length": 300.96820804519973, "median_sequence_length": 301, "percent_duplicates": 91.62921838528828, "percent_fails": 36.36363636363637 }, "CVMS2_R2": { "total_sequences": 228355.0, "percent_gc": 52.0, "avg_sequence_length": 300.9711808368549, "median_sequence_length": 301, "percent_duplicates": 91.82807470823937, "percent_fails": 36.36363636363637 }, "DAFS1_R2": { "total_sequences": 89919.0, "percent_gc": 54.0, "avg_sequence_length": 300.86612395600486, "median_sequence_length": 301, "percent_duplicates": 92.35089358200158, "percent_fails": 36.36363636363637 }, "DAFS2_R2": { "total_sequences": 37520.0, "percent_gc": 54.0, "avg_sequence_length": 300.7293043710021, "median_sequence_length": 301, "percent_duplicates": 88.77665245202559, "percent_fails": 36.36363636363637 }, "DAMS1_R2": { "total_sequences": 63626.0, "percent_gc": 52.0, "avg_sequence_length": 300.8482067079496, "median_sequence_length": 301, "percent_duplicates": 93.18046081790463, "percent_fails": 36.36363636363637 }, "DAMS2_R2": { "total_sequences": 80819.0, "percent_gc": 52.0, "avg_sequence_length": 300.828301513258, "median_sequence_length": 301, "percent_duplicates": 94.5173783392519, "percent_fails": 36.36363636363637 }, "DCFS1_R2": { "total_sequences": 122736.0, "percent_gc": 52.0, "avg_sequence_length": 300.4593884434885, "median_sequence_length": 301, "percent_duplicates": 93.1682635901447, "percent_fails": 36.36363636363637 }, "DCFS2_R2": { "total_sequences": 71285.0, "percent_gc": 52.0, "avg_sequence_length": 299.3549624745739, "median_sequence_length": 301, "percent_duplicates": 91.24500245493442, "percent_fails": 36.36363636363637 }, "DCMS1_R2": { "total_sequences": 241679.0, "percent_gc": 52.0, "avg_sequence_length": 300.76969658100205, "median_sequence_length": 301, "percent_duplicates": 93.96430802841786, "percent_fails": 36.36363636363637 }, "DCMS2_R2": { "total_sequences": 94201.0, "percent_gc": 52.0, "avg_sequence_length": 299.3178575598985, "median_sequence_length": 301, "percent_duplicates": 91.52662922898908, "percent_fails": 36.36363636363637 }, "DPFS1_R2": { "total_sequences": 141958.0, "percent_gc": 53.0, "avg_sequence_length": 300.73026881190214, "median_sequence_length": 301, "percent_duplicates": 93.65234787754125, "percent_fails": 36.36363636363637 }, "DPFS2_R2": { "total_sequences": 132107.0, "percent_gc": 53.0, "avg_sequence_length": 299.78814521562066, "median_sequence_length": 301, "percent_duplicates": 92.59236830750831, "percent_fails": 36.36363636363637 }, "DPMS1_R2": { "total_sequences": 82003.0, "percent_gc": 52.0, "avg_sequence_length": 300.5195968440179, "median_sequence_length": 301, "percent_duplicates": 89.9747570210846, "percent_fails": 36.36363636363637 }, "DPMS2_R2": { "total_sequences": 86790.0, "percent_gc": 52.0, "avg_sequence_length": 300.61627491646504, "median_sequence_length": 301, "percent_duplicates": 89.88132273303376, "percent_fails": 36.36363636363637 }, "DVFS1_R2": { "total_sequences": 71960.0, "percent_gc": 52.0, "avg_sequence_length": 300.74170372429126, "median_sequence_length": 301, "percent_duplicates": 90.00138966092274, "percent_fails": 36.36363636363637 }, "DVFS2_R2": { "total_sequences": 101484.0, "percent_gc": 52.0, "avg_sequence_length": 300.18769953884356, "median_sequence_length": 301, "percent_duplicates": 91.34050687793149, "percent_fails": 36.36363636363637 }, "DVMS1_R2": { "total_sequences": 165859.0, "percent_gc": 52.0, "avg_sequence_length": 300.62909157778597, "median_sequence_length": 301, "percent_duplicates": 89.90286930465034, "percent_fails": 36.36363636363637 }, "DVMS2_R2": { "total_sequences": 161059.0, "percent_gc": 52.0, "avg_sequence_length": 300.62397630681926, "median_sequence_length": 301, "percent_duplicates": 90.97101062343613, "percent_fails": 36.36363636363637 }, "IAFS1_R2": { "total_sequences": 164482.0, "percent_gc": 54.0, "avg_sequence_length": 300.98554857066426, "median_sequence_length": 301, "percent_duplicates": 96.24214199730062, "percent_fails": 36.36363636363637 }, "IAFS2_R2": { "total_sequences": 127785.0, "percent_gc": 55.0, "avg_sequence_length": 300.98801893806, "median_sequence_length": 301, "percent_duplicates": 96.22256133348985, "percent_fails": 36.36363636363637 }, "IAMS1_R2": { "total_sequences": 151730.0, "percent_gc": 54.0, "avg_sequence_length": 300.9804521188954, "median_sequence_length": 301, "percent_duplicates": 95.84525143346734, "percent_fails": 36.36363636363637 }, "IAMS2_R2": { "total_sequences": 151673.0, "percent_gc": 54.0, "avg_sequence_length": 300.97673943285884, "median_sequence_length": 301, "percent_duplicates": 94.52770104105542, "percent_fails": 36.36363636363637 }, "ICFS1_R2": { "total_sequences": 139909.0, "percent_gc": 52.0, "avg_sequence_length": 300.8209479018505, "median_sequence_length": 301, "percent_duplicates": 90.88193039761559, "percent_fails": 36.36363636363637 }, "ICFS2_R2": { "total_sequences": 172816.0, "percent_gc": 53.0, "avg_sequence_length": 300.86309138042776, "median_sequence_length": 301, "percent_duplicates": 89.67283121933154, "percent_fails": 36.36363636363637 }, "ICMS1_R2": { "total_sequences": 194877.0, "percent_gc": 53.0, "avg_sequence_length": 300.96351288248485, "median_sequence_length": 301, "percent_duplicates": 93.69037905961196, "percent_fails": 36.36363636363637 }, "ICMS2_R2": { "total_sequences": 125665.0, "percent_gc": 52.0, "avg_sequence_length": 300.95717582461305, "median_sequence_length": 301, "percent_duplicates": 92.32164882823379, "percent_fails": 36.36363636363637 }, "IPFS1_R2": { "total_sequences": 160962.0, "percent_gc": 53.0, "avg_sequence_length": 300.93989885811555, "median_sequence_length": 301, "percent_duplicates": 93.96068637318125, "percent_fails": 36.36363636363637 }, "IPFS2_R2": { "total_sequences": 224428.0, "percent_gc": 53.0, "avg_sequence_length": 300.9674349902864, "median_sequence_length": 301, "percent_duplicates": 91.55943108703013, "percent_fails": 36.36363636363637 }, "IPMS1_R2": { "total_sequences": 345759.0, "percent_gc": 52.0, "avg_sequence_length": 300.95055515546954, "median_sequence_length": 301, "percent_duplicates": 94.06638728131445, "percent_fails": 36.36363636363637 }, "IPMS2_R2": { "total_sequences": 244089.0, "percent_gc": 52.0, "avg_sequence_length": 300.96319375309827, "median_sequence_length": 301, "percent_duplicates": 92.60392725604186, "percent_fails": 36.36363636363637 }, "IVFS1_R2": { "total_sequences": 228943.0, "percent_gc": 52.0, "avg_sequence_length": 300.97923063819377, "median_sequence_length": 301, "percent_duplicates": 94.83059102047234, "percent_fails": 36.36363636363637 }, "IVFS2_R2": { "total_sequences": 127420.0, "percent_gc": 52.0, "avg_sequence_length": 300.87874352534925, "median_sequence_length": 301, "percent_duplicates": 94.78888714487522, "percent_fails": 36.36363636363637 }, "IVMS1_R2": { "total_sequences": 156119.0, "percent_gc": 51.0, "avg_sequence_length": 300.8512128568592, "median_sequence_length": 301, "percent_duplicates": 91.31303685009512, "percent_fails": 36.36363636363637 }, "IVMS2_R2": { "total_sequences": 109737.0, "percent_gc": 52.0, "avg_sequence_length": 300.9746029142404, "median_sequence_length": 301, "percent_duplicates": 93.07708430155736, "percent_fails": 36.36363636363637 }, "JAFS1_R2": { "total_sequences": 132370.0, "percent_gc": 54.0, "avg_sequence_length": 300.96649542947796, "median_sequence_length": 301, "percent_duplicates": 94.74503286243106, "percent_fails": 36.36363636363637 }, "JAFS2_R2": { "total_sequences": 84149.0, "percent_gc": 54.0, "avg_sequence_length": 300.9575752534195, "median_sequence_length": 301, "percent_duplicates": 94.15085146585224, "percent_fails": 36.36363636363637 }, "JAMS1_R2": { "total_sequences": 163443.0, "percent_gc": 52.0, "avg_sequence_length": 300.97737437516446, "median_sequence_length": 301, "percent_duplicates": 96.70037872530484, "percent_fails": 36.36363636363637 }, "JAMS2_R2": { "total_sequences": 147745.0, "percent_gc": 52.0, "avg_sequence_length": 300.9609936038445, "median_sequence_length": 301, "percent_duplicates": 95.45162272834952, "percent_fails": 36.36363636363637 }, "JCFS1_R2": { "total_sequences": 188244.0, "percent_gc": 52.0, "avg_sequence_length": 300.93379337455644, "median_sequence_length": 301, "percent_duplicates": 95.41233717940545, "percent_fails": 36.36363636363637 }, "JCFS2_R2": { "total_sequences": 152204.0, "percent_gc": 52.0, "avg_sequence_length": 300.9293809623926, "median_sequence_length": 301, "percent_duplicates": 95.12824892906889, "percent_fails": 36.36363636363637 }, "JCMS1_R2": { "total_sequences": 161387.0, "percent_gc": 52.0, "avg_sequence_length": 300.9415101588108, "median_sequence_length": 301, "percent_duplicates": 93.7504259946588, "percent_fails": 36.36363636363637 }, "JCMS2_R2": { "total_sequences": 127452.0, "percent_gc": 52.0, "avg_sequence_length": 300.9179808869221, "median_sequence_length": 301, "percent_duplicates": 92.79807300003138, "percent_fails": 36.36363636363637 }, "JPFS1_R2": { "total_sequences": 233623.0, "percent_gc": 52.0, "avg_sequence_length": 300.9850314395415, "median_sequence_length": 301, "percent_duplicates": 96.0684521643845, "percent_fails": 36.36363636363637 }, "JPFS2_R2": { "total_sequences": 201772.0, "percent_gc": 52.0, "avg_sequence_length": 300.9781188668398, "median_sequence_length": 301, "percent_duplicates": 95.84431933072973, "percent_fails": 36.36363636363637 }, "JPMS1_R2": { "total_sequences": 211303.0, "percent_gc": 52.0, "avg_sequence_length": 300.9699057751191, "median_sequence_length": 301, "percent_duplicates": 94.25564237138138, "percent_fails": 36.36363636363637 }, "JPMS2_R2": { "total_sequences": 134191.0, "percent_gc": 52.0, "avg_sequence_length": 300.93845712454635, "median_sequence_length": 301, "percent_duplicates": 93.8103151478117, "percent_fails": 36.36363636363637 }, "JVFS1_R2": { "total_sequences": 109795.0, "percent_gc": 52.0, "avg_sequence_length": 300.8708547748076, "median_sequence_length": 301, "percent_duplicates": 94.14089894803953, "percent_fails": 36.36363636363637 }, "JVFS2_R2": { "total_sequences": 150055.0, "percent_gc": 52.0, "avg_sequence_length": 300.97566225717236, "median_sequence_length": 301, "percent_duplicates": 91.83366099096997, "percent_fails": 36.36363636363637 }, "JVMS1_R2": { "total_sequences": 347311.0, "percent_gc": 52.0, "avg_sequence_length": 300.9159931588691, "median_sequence_length": 301, "percent_duplicates": 94.71827843057088, "percent_fails": 36.36363636363637 }, "JVMS2_R2": { "total_sequences": 117324.0, "percent_gc": 52.0, "avg_sequence_length": 300.9365901264873, "median_sequence_length": 301, "percent_duplicates": 90.76489038900822, "percent_fails": 36.36363636363637 } } ], "report_general_stats_headers": [ { "percent_duplicates": { "title": "Dups", "description": "% duplicate reads", "max": 100, "min": 0, "suffix": "%", "scale": "RdYlGn-rev", "namespace": "FastQC", "rid": "fastqc-percent_duplicates", "placement": 1000 }, "percent_gc": { "title": "GC", "description": "Average % GC content", "max": 100, "min": 0, "suffix": "%", "scale": "PuRd", "format": "{:,.1f}", "namespace": "FastQC", "rid": "fastqc-percent_gc", "placement": 1000 }, "avg_sequence_length": { "title": "Avg len", "description": "Average read length", "min": 0, "suffix": " bp", "scale": "RdYlGn", "format": "{:,.0f}", "hidden": true, "namespace": "FastQC", "rid": "fastqc-avg_sequence_length", "placement": 1000 }, "median_sequence_length": { "title": "Median len", "description": "Median read length", "min": 0, "suffix": " bp", "scale": "RdYlGn", "format": "{:,.0f}", "hidden": true, "namespace": "FastQC", "rid": "fastqc-median_sequence_length", "placement": 1000 }, "percent_fails": { "title": "Failed", "description": "Percentage of modules failed in FastQC report (includes those not plotted here)", "max": 100, "min": 0, "suffix": "%", "scale": "Reds", "format": "{:,.0f}", "hidden": true, "namespace": "FastQC", "rid": "fastqc-percent_fails", "placement": 1000 }, "total_sequences": { "title": "Seqs", "description": "Total sequences (millions)", "min": 0, "scale": "Blues", "suffix": "M", "modify": null, "namespace": "FastQC", "rid": "fastqc-total_sequences", "placement": 1000 } } ], "report_multiqc_command": "/usr/local/bioinfo/anaconda3/bin/multiqc --title Pre-processing reads (R2) --file-list /data/MicrobiomaFrangos/output/fastqc/pre/R2.txt -o /data/MicrobiomaFrangos/output/fastqc/pre", "report_plot_data": { "fastqc_sequence_counts_plot": { "id": "fastqc_sequence_counts_plot", "anchor": "fastqc_sequence_counts_plot", "plot_type": "bar_graph", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 800, "hoverlabel": { "namelength": -1, "bgcolor": "rgba(255, 255, 255, 0.8)", "font": { "color": "black" } }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "white", "plot_bgcolor": "white", "showlegend": true, "title": { "font": { "size": 20 }, "text": "FastQC: Sequence Counts", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)", "showgrid": false, "categoryorder": "trace", "type": "category" }, "barmode": "relative", "bargroupgap": 0, "bargap": 0.2, "legend": { "tracegroupgap": 0, "traceorder": "normal" }, "hovermode": "y unified" }, "datasets": [ { "plot_id": "fastqc_sequence_counts_plot", "label": "1", "uid": "fastqc_sequence_counts_plot", "dconfig": { "title": "FastQC: Sequence Counts
64 samples" }, "layout": { "title": { "text": "FastQC: Sequence Counts
64 samples" }, "xaxis": { "title": { "text": "Number of reads" }, "hoverformat": ",.2f", "ticksuffix": "", "autorangeoptions": { "minallowed": 0, "maxallowed": 347311.0 } }, "yaxis": { "title": null, "hoverformat": null, "ticksuffix": "" }, "showlegend": true }, "trace_params": { "hovertemplate": "%{meta}: %{x}", "orientation": "h", "marker": { "line": { "width": 0 } }, "textposition": "inside", "insidetextanchor": "start" }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "n_samples": 64, "cats": [ { "name": "Unique Reads", "color": "124,181,236", "data": [ 10835.0, 18344.0, 12254.0, 6433.0, 8306.0, 12138.0, 8385.0, 9185.0, 9180.0, 10086.0, 7415.0, 8636.0, 6720.0, 5393.0, 4922.0, 6957.0, 7597.0, 13562.0, 6640.0, 11835.0, 18053.0, 20516.0, 18944.0, 9721.0, 9649.0, 12296.0, 17847.0, 12757.0, 8300.0, 6304.0, 4827.0, 6181.0, 14542.0, 16747.0, 8788.0, 7195.0, 8782.0, 8221.0, 9786.0, 9011.0, 7982.0, 14587.0, 6241.0, 8385.0, 4431.0, 4339.0, 4211.0, 6879.0, 18661.0, 15349.0, 17358.0, 18158.0, 21334.0, 18288.0, 19607.0, 11063.0, 16569.0, 17580.0, 18100.0, 18626.0, 10798.0, 10176.0, 9337.0, 9847.0 ], "data_pct": [ 9.235109610991783, 5.281721569429129, 8.166339009030024, 5.859101051960472, 6.189684852188298, 5.744357628618619, 4.155680669270265, 3.9315478356155, 7.202711609076358, 6.249574005341199, 4.8717510709311185, 4.587662820594547, 4.548377271650479, 3.299621274695154, 5.849148534147762, 5.255722595754325, 6.92291569844264, 8.68696314990488, 5.211112855124784, 5.169408979527655, 7.396072743958146, 5.933612718685558, 8.441014490170568, 6.039313626818752, 7.678351171766204, 6.30962094038804, 10.327168780668456, 9.118069602384407, 5.472298958944571, 4.154748566532657, 3.777438666510154, 3.757858002699384, 9.028989376563867, 10.097130695349664, 8.659493122068504, 9.998610339077265, 10.118677266966241, 10.025242978915404, 7.407631692491693, 6.347652122458755, 8.473370771010924, 6.03569197158214, 8.754997545065581, 6.831736409855299, 5.482621660748092, 6.819539182095371, 11.223347547974413, 7.650218530010343, 8.171925291760635, 8.37078161471172, 8.396134237537366, 8.27613239624069, 10.41816219594974, 8.09404100131006, 10.94189472744319, 7.390014829461196, 8.41394859919867, 8.371827229868089, 8.916300080295962, 8.595808701029597, 6.455276970718701, 6.923485147437032, 6.165315232032962, 6.006429142191398 ] }, { "name": "Duplicate Reads", "color": "67,67,72", "data": [ 106489.0, 328967.0, 137801.0, 103362.0, 125885.0, 199165.0, 193387.0, 224438.0, 118272.0, 151301.0, 144789.0, 179608.0, 141025.0, 158050.0, 79227.0, 125413.0, 102140.0, 142557.0, 120780.0, 217108.0, 226036.0, 325243.0, 205484.0, 151241.0, 116016.0, 182581.0, 154969.0, 127152.0, 143373.0, 145426.0, 122958.0, 158301.0, 146517.0, 149112.0, 92696.0, 64765.0, 78008.0, 73782.0, 122321.0, 132947.0, 86219.0, 227092.0, 65044.0, 114351.0, 76388.0, 59287.0, 33309.0, 83040.0, 209694.0, 168015.0, 189380.0, 201244.0, 183443.0, 207656.0, 159585.0, 138639.0, 180354.0, 192410.0, 184899.0, 198061.0, 156476.0, 136802.0, 142107.0, 154094.0 ], "data_pct": [ 90.76489038900822, 94.71827843057086, 91.83366099096997, 94.14089894803953, 93.81031514781169, 94.25564237138137, 95.84431933072973, 96.0684521643845, 92.79728839092364, 93.7504259946588, 95.12824892906889, 95.41233717940545, 95.45162272834952, 96.70037872530484, 94.15085146585224, 94.74427740424568, 93.07708430155735, 91.31303685009512, 94.78888714487522, 94.83059102047234, 92.60392725604186, 94.06638728131445, 91.55898550982944, 93.96068637318125, 92.32164882823379, 93.69037905961196, 89.67283121933154, 90.88193039761559, 94.52770104105542, 95.84525143346734, 96.22256133348984, 96.2421419973006, 90.97101062343613, 89.90286930465034, 91.34050687793149, 90.00138966092274, 89.88132273303377, 89.9747570210846, 92.59236830750831, 93.65234787754125, 91.52662922898908, 93.96430802841786, 91.24500245493442, 93.16826359014469, 94.5173783392519, 93.18046081790463, 88.77665245202559, 92.34978146998965, 91.82807470823936, 91.62921838528828, 91.60386576246263, 91.72386760375932, 89.58183780405025, 91.90595899868994, 89.05810527255682, 92.6099851705388, 91.58605140080132, 91.62817277013191, 91.08369991970405, 91.4041912989704, 93.5447230292813, 93.07651485256297, 93.83468476796703, 93.9935708578086 ] } ], "samples": [ "JVMS2_R2", "JVMS1_R2", "JVFS2_R2", "JVFS1_R2", "JPMS2_R2", "JPMS1_R2", "JPFS2_R2", "JPFS1_R2", "JCMS2_R2", "JCMS1_R2", "JCFS2_R2", "JCFS1_R2", "JAMS2_R2", "JAMS1_R2", "JAFS2_R2", "JAFS1_R2", "IVMS2_R2", "IVMS1_R2", "IVFS2_R2", "IVFS1_R2", "IPMS2_R2", "IPMS1_R2", "IPFS2_R2", "IPFS1_R2", "ICMS2_R2", "ICMS1_R2", "ICFS2_R2", "ICFS1_R2", "IAMS2_R2", "IAMS1_R2", "IAFS2_R2", "IAFS1_R2", "DVMS2_R2", "DVMS1_R2", "DVFS2_R2", "DVFS1_R2", "DPMS2_R2", "DPMS1_R2", "DPFS2_R2", "DPFS1_R2", "DCMS2_R2", "DCMS1_R2", "DCFS2_R2", "DCFS1_R2", "DAMS2_R2", "DAMS1_R2", "DAFS2_R2", "DAFS1_R2", "CVMS2_R2", "CVMS1_R2", "CVFS2_R2", "CVFS1_R2", "CPMS2_R2", "CPMS1_R2", "CPFS2_R2", "CPFS1_R2", "CCMS2_R2", "CCMS1_R2", "CCFS2_R2", "CCFS1_R2", "CAMS2_R2", "CAMS1_R2", "CAFS2_R2", "CAFS1_R2" ] } ], "pconfig": { "id": "fastqc_sequence_counts_plot", "title": "FastQC: Sequence Counts", "anchor": null, "table_title": null, "height": null, "width": null, "square": false, "logswitch": false, "logswitch_active": false, "logswitch_label": "Log10", "cpswitch": true, "cpswitch_c_active": true, "cpswitch_counts_label": "Number of reads", "cpswitch_percent_label": "Percentages", "xLog": null, "yLog": null, "xlog": false, "ylog": false, "data_labels": [], "xTitle": null, "yTitle": null, "xlab": null, "ylab": "Number of reads", "xsuffix": null, "ysuffix": null, "tt_suffix": null, "xLabFormat": null, "yLabFormat": null, "xLabelFormat": null, "yLabelFormat": null, "xlab_format": null, "ylab_format": null, "tt_label": null, "xDecimals": null, "yDecimals": null, "decimalPlaces": null, "x_decimals": null, "y_decimals": null, "tt_decimals": null, "xmin": null, "xmax": null, "ymin": null, "ymax": null, "xFloor": null, "xCeiling": null, "yFloor": null, "yCeiling": null, "x_clipmin": null, "x_clipmax": null, "y_clipmin": null, "y_clipmax": null, "save_data_file": true, "showlegend": null, "xMinRange": null, "yMinRange": null, "x_minrange": null, "y_minrange": null, "xPlotBands": null, "yPlotBands": null, "xPlotLines": null, "yPlotLines": null, "x_bands": null, "y_bands": null, "x_lines": null, "y_lines": null, "stacking": "relative", "hide_zero_cats": true, "sort_samples": true, "use_legend": true, "suffix": null, "lab_format": null }, "add_log_tab": false, "add_pct_tab": true, "l_active": false, "p_active": false, "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "xaxis" ], "square": false, "flat": false, "defer_render": false }, "fastqc_per_base_sequence_quality_plot": { "id": "fastqc_per_base_sequence_quality_plot", "anchor": "fastqc_per_base_sequence_quality_plot", "plot_type": "xy_line", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 500, "hoverlabel": { "namelength": -1 }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "white", "plot_bgcolor": "white", "showlegend": false, "title": { "font": { "size": 20 }, "text": "FastQC: Mean Quality Scores", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "shapes": [ { "fillcolor": "#c3e6c3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 28, "y1": 100 }, { "fillcolor": "#e6dcc3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 20, "y1": 28 }, { "fillcolor": "#e6c3c3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 0, "y1": 20 }, { "fillcolor": "#c3e6c3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 28, "y1": 100 }, { "fillcolor": "#e6dcc3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 20, "y1": 28 }, { "fillcolor": "#e6c3c3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 0, "y1": 20 } ], "hoverdistance": -1 }, "datasets": [ { "plot_id": "fastqc_per_base_sequence_quality_plot", "label": "1", "uid": "fastqc_per_base_sequence_quality_plot", "dconfig": { "title": "FastQC: Mean Quality Scores
64 samples" }, "layout": { "title": { "text": "FastQC: Mean Quality Scores
64 samples" }, "xaxis": { "hoverformat": ",.0f", "ticksuffix": " bp", "title": { "text": "Position (bp)" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": null } }, "yaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "Phred Score" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": null }, "range": [ 0, 41.386679752275874 ] } }, "trace_params": { "hovertemplate": "%{text}
Base %{x}: %{y:.2f}", "mode": "lines", "line": { "width": 2 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "n_samples": 64, "lines": [ { "name": "CAFS1_R2", "pairs": [ [ 1, 38.54052372499863 ], [ 2, 39.03916652942217 ], [ 3, 39.02467351059222 ], [ 4, 39.24863212985159 ], [ 5, 38.732568424006196 ], [ 6, 38.70616868263583 ], [ 7, 38.74391396904984 ], [ 8, 38.90511830475598 ], [ 9, 39.30677499832257 ], [ 10, 39.09001409043498 ], [ 15, 39.03768794871326 ], [ 20, 39.109518668301405 ], [ 25, 39.191787289329696 ], [ 30, 39.051048852941 ], [ 35, 39.286030193184985 ], [ 40, 39.172555813102356 ], [ 45, 38.80333292668049 ], [ 50, 39.176811028425035 ], [ 55, 38.946556057094064 ], [ 60, 38.98901549347322 ], [ 65, 38.96525558131024 ], [ 70, 38.90206172990118 ], [ 75, 39.17461998292059 ], [ 80, 38.734863974624865 ], [ 85, 39.05660607539344 ], [ 90, 39.09133585458095 ], [ 95, 38.03218738562889 ], [ 100, 39.049427631208154 ], [ 105, 38.90258512364431 ], [ 110, 39.12581585721431 ], [ 115, 39.099864582952094 ], [ 120, 38.49540192023814 ], [ 125, 38.880528004489506 ], [ 130, 39.117017409020484 ], [ 135, 38.36661176786346 ], [ 140, 37.92490331710768 ], [ 145, 38.571949526444726 ], [ 150, 38.73840804699366 ], [ 155, 38.78620201662834 ], [ 160, 38.67742364444878 ], [ 165, 38.848386880325975 ], [ 170, 38.84815264400349 ], [ 175, 38.67130422052374 ], [ 180, 38.93882490728089 ], [ 185, 38.943182705446034 ], [ 190, 38.00493851259028 ], [ 195, 38.94796505953543 ], [ 200, 38.52442416552801 ], [ 205, 38.344729650595355 ], [ 210, 38.28055338668749 ], [ 215, 38.26578664844818 ], [ 220, 38.48842963107554 ], [ 225, 38.40904667448733 ], [ 230, 38.54013358953244 ], [ 235, 38.10351663769177 ], [ 240, 38.407888492390285 ], [ 245, 36.98000548998078 ], [ 250, 38.463176258883095 ], [ 255, 38.42818678134627 ], [ 260, 38.03211272760545 ], [ 265, 37.162876054566404 ], [ 270, 38.3143045371918 ], [ 275, 37.635121451315776 ], [ 280, 38.255210023546056 ], [ 285, 38.12848097405053 ], [ 290, 37.71580270108702 ], [ 295, 38.05807951023221 ], [ 300, 33.80045348055109 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAFS2_R2", "pairs": [ [ 1, 39.318137397321784 ], [ 2, 38.8116003275138 ], [ 3, 38.95686854546895 ], [ 4, 39.34793058820422 ], [ 5, 38.51240062333272 ], [ 6, 38.49937930852328 ], [ 7, 38.648926335807296 ], [ 8, 38.792319273130666 ], [ 9, 39.2884498560524 ], [ 10, 39.113594463960276 ], [ 15, 39.019978341829315 ], [ 20, 38.99911254325031 ], [ 25, 39.278962520799766 ], [ 30, 39.11918861097171 ], [ 35, 39.311275454953645 ], [ 40, 39.20286310451388 ], [ 45, 38.8208341036951 ], [ 50, 39.2340720002113 ], [ 55, 38.994041361823506 ], [ 60, 39.058894376799344 ], [ 65, 39.008451969044664 ], [ 70, 38.93377882253507 ], [ 75, 39.25255011753519 ], [ 80, 38.824383930693855 ], [ 85, 39.14265867251261 ], [ 90, 39.09332558569504 ], [ 95, 38.00195451784158 ], [ 100, 39.07234357254166 ], [ 105, 39.011917276352975 ], [ 110, 39.17174929346821 ], [ 115, 39.07598320171152 ], [ 120, 38.44937534666279 ], [ 125, 38.950402789149784 ], [ 130, 39.17878555769789 ], [ 135, 38.40354454451811 ], [ 140, 37.93660494968437 ], [ 145, 38.59471751934709 ], [ 150, 38.76506431420195 ], [ 155, 38.846660151607196 ], [ 160, 38.728760465914796 ], [ 165, 38.90735057182853 ], [ 170, 38.906753651514755 ], [ 175, 38.739372969546494 ], [ 180, 38.97937719553103 ], [ 185, 38.98235123213861 ], [ 190, 38.00581601119886 ], [ 195, 39.01462190644727 ], [ 200, 38.54412191965348 ], [ 205, 38.42559890124402 ], [ 210, 38.253223633818436 ], [ 215, 38.335168114946775 ], [ 220, 38.53749768891471 ], [ 225, 38.453593923580605 ], [ 230, 38.59003849633196 ], [ 235, 38.10105716342122 ], [ 240, 38.45262970226422 ], [ 245, 37.06614633888658 ], [ 250, 38.536040622544455 ], [ 255, 38.46580700011989 ], [ 260, 38.054204249811804 ], [ 265, 37.173851375444066 ], [ 270, 38.365386088403476 ], [ 275, 37.65395068739188 ], [ 280, 38.30167060656885 ], [ 285, 38.15423726575191 ], [ 290, 37.70206943912521 ], [ 295, 38.11817673019904 ], [ 300, 33.95348813466491 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAMS1_R2", "pairs": [ [ 1, 39.13143463647621 ], [ 2, 38.62137190599954 ], [ 3, 39.135571309991974 ], [ 4, 39.34860999605383 ], [ 5, 38.395732694689 ], [ 6, 38.80531780266434 ], [ 7, 38.630434486793945 ], [ 8, 38.742614540951706 ], [ 9, 39.20031569350515 ], [ 10, 39.06997781980977 ], [ 15, 39.0095497285308 ], [ 20, 39.038424798269126 ], [ 25, 39.162383485963886 ], [ 30, 38.93061546626026 ], [ 35, 39.23350705547769 ], [ 40, 39.110321272571404 ], [ 45, 38.73797711222088 ], [ 50, 39.135135870674524 ], [ 55, 38.89819156608472 ], [ 60, 38.996377689177976 ], [ 65, 38.92887370899046 ], [ 70, 38.79571092272313 ], [ 75, 39.183986719100815 ], [ 80, 38.72573582440909 ], [ 85, 39.0908135911497 ], [ 90, 39.036122412878115 ], [ 95, 37.98437317149505 ], [ 100, 39.0597482396323 ], [ 105, 38.94486545330839 ], [ 110, 39.08998945398877 ], [ 115, 39.02663718319442 ], [ 120, 38.330725633611166 ], [ 125, 38.85670352100697 ], [ 130, 39.06745500935533 ], [ 135, 38.323268583092364 ], [ 140, 37.96059166927484 ], [ 145, 38.50008300787895 ], [ 150, 38.63303985738975 ], [ 155, 38.73118238600025 ], [ 160, 38.65894648032985 ], [ 165, 38.81225250724618 ], [ 170, 38.81236137003824 ], [ 175, 38.5387347421993 ], [ 180, 38.89010573298678 ], [ 185, 38.8733626355682 ], [ 190, 38.05894375876005 ], [ 195, 38.915726591097744 ], [ 200, 38.448498373862044 ], [ 205, 38.32779675316723 ], [ 210, 38.23257991209329 ], [ 215, 38.21589668921034 ], [ 220, 38.43664321580688 ], [ 225, 38.447866969668105 ], [ 230, 38.48710656306557 ], [ 235, 38.030323730727886 ], [ 240, 38.328858165389796 ], [ 245, 36.975560303182874 ], [ 250, 38.445520976499246 ], [ 255, 38.35280253650306 ], [ 260, 37.95986228856805 ], [ 265, 37.033338525088865 ], [ 270, 38.246056078327314 ], [ 275, 37.53295095017452 ], [ 280, 38.178391949541755 ], [ 285, 37.981953147857084 ], [ 290, 37.58018139386146 ], [ 295, 37.97408701822875 ], [ 300, 34.654904817389166 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAMS2_R2", "pairs": [ [ 1, 38.96969044800746 ], [ 2, 38.97736647655942 ], [ 3, 39.07167880244389 ], [ 4, 39.40932840728386 ], [ 5, 38.22078745053027 ], [ 6, 38.75901813790547 ], [ 7, 38.655427621746355 ], [ 8, 38.89348015830314 ], [ 9, 39.33708765259395 ], [ 10, 39.114128914236524 ], [ 15, 39.055767184380116 ], [ 20, 39.083869579253204 ], [ 25, 39.20104738333514 ], [ 30, 39.05207025598718 ], [ 35, 39.292475818118774 ], [ 40, 39.20588256393702 ], [ 45, 38.77728278154406 ], [ 50, 39.19539438286883 ], [ 55, 39.009969271972935 ], [ 60, 39.036034291043435 ], [ 65, 39.04834463216041 ], [ 70, 38.87621313660902 ], [ 75, 39.210483461168266 ], [ 80, 38.81268106628087 ], [ 85, 39.17428395497181 ], [ 90, 39.10791101971029 ], [ 95, 38.07885313230467 ], [ 100, 39.08990930993047 ], [ 105, 39.000929020224426 ], [ 110, 39.15485224752351 ], [ 115, 39.06579065360219 ], [ 120, 38.39830695928213 ], [ 125, 38.93768868855105 ], [ 130, 39.09693973325044 ], [ 135, 38.40414651497851 ], [ 140, 37.99184805676947 ], [ 145, 38.59013708129824 ], [ 150, 38.73912747139771 ], [ 155, 38.823738723389 ], [ 160, 38.74152483096293 ], [ 165, 38.8915950762535 ], [ 170, 38.87807450185627 ], [ 175, 38.650372150581994 ], [ 180, 38.973990709686674 ], [ 185, 38.949594966220495 ], [ 190, 38.110451366054875 ], [ 195, 38.97417110061578 ], [ 200, 38.541634041641124 ], [ 205, 38.43478468813707 ], [ 210, 38.27481242788562 ], [ 215, 38.320654753720056 ], [ 220, 38.54238143349934 ], [ 225, 38.516438857535505 ], [ 230, 38.58723709540492 ], [ 235, 38.14980689440771 ], [ 240, 38.440814032738274 ], [ 245, 37.05374591755599 ], [ 250, 38.55003258302693 ], [ 255, 38.469238417129006 ], [ 260, 38.063968719920126 ], [ 265, 37.19395381968079 ], [ 270, 38.38187514199281 ], [ 275, 37.6938886298143 ], [ 280, 38.33302005237293 ], [ 285, 38.135504776936784 ], [ 290, 37.74940341750537 ], [ 295, 38.104475157322746 ], [ 300, 34.80683239501148 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCFS1_R2", "pairs": [ [ 1, 31.14260200196597 ], [ 2, 32.65483393096955 ], [ 3, 32.48548828494557 ], [ 4, 33.2696377724552 ], [ 5, 32.365028820372245 ], [ 6, 32.72687332419573 ], [ 7, 32.46263504501885 ], [ 8, 32.47684909570025 ], [ 9, 32.83789982786231 ], [ 10, 33.03721496905675 ], [ 15, 32.95022774785751 ], [ 20, 32.777990373211125 ], [ 25, 32.94734432614786 ], [ 30, 32.70791971830336 ], [ 35, 32.68849538735596 ], [ 40, 32.720177253112624 ], [ 45, 32.721842666346696 ], [ 50, 32.52063457399473 ], [ 55, 32.440045411751676 ], [ 60, 32.43764468073323 ], [ 65, 32.03617249081612 ], [ 70, 32.17206900371047 ], [ 75, 32.56088312934965 ], [ 80, 32.31563748665221 ], [ 85, 32.495366964644205 ], [ 90, 32.43770392693473 ], [ 95, 32.11525869588293 ], [ 100, 32.057267651250484 ], [ 105, 31.98082056488831 ], [ 110, 32.29600701495293 ], [ 115, 31.999139745246445 ], [ 120, 31.616506368838838 ], [ 125, 31.181696510983937 ], [ 130, 31.848359587014663 ], [ 135, 31.591845964980298 ], [ 140, 31.67863650209066 ], [ 145, 31.400347981797875 ], [ 150, 31.31828427436103 ], [ 155, 31.124971263524117 ], [ 160, 31.15694657897773 ], [ 165, 31.12711849544248 ], [ 170, 30.78745309795777 ], [ 175, 30.96692373370255 ], [ 180, 30.980861659166955 ], [ 185, 30.43835359475123 ], [ 190, 30.557268136879323 ], [ 195, 30.914328573142928 ], [ 200, 29.83974835916514 ], [ 205, 29.64534448460008 ], [ 210, 29.49842469894811 ], [ 215, 29.260512238238324 ], [ 220, 29.630047494426673 ], [ 225, 28.960711154814238 ], [ 230, 29.497816755135013 ], [ 235, 28.535854142626356 ], [ 240, 27.910677129009922 ], [ 245, 27.927807985229634 ], [ 250, 28.004789291483963 ], [ 255, 27.06265589660743 ], [ 260, 27.46156963567799 ], [ 265, 27.02477186601369 ], [ 270, 26.88127154983406 ], [ 275, 25.33976362436054 ], [ 280, 25.894287929357905 ], [ 285, 25.954255829840655 ], [ 290, 24.532159611163515 ], [ 295, 24.8407091668833 ], [ 300, 22.17592038216233 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCFS2_R2", "pairs": [ [ 1, 31.012527155306184 ], [ 2, 32.81177739791821 ], [ 3, 32.657387474815145 ], [ 4, 33.33719870541234 ], [ 5, 32.37374568347627 ], [ 6, 32.85362489470391 ], [ 7, 32.53881053601249 ], [ 8, 32.592534938595755 ], [ 9, 32.90911777890531 ], [ 10, 33.06843876078207 ], [ 15, 33.027204074896915 ], [ 20, 32.845583475780664 ], [ 25, 32.997404913324694 ], [ 30, 32.77636343036172 ], [ 35, 32.76368750584978 ], [ 40, 32.761441911289616 ], [ 45, 32.80676082426488 ], [ 50, 32.558576284084936 ], [ 55, 32.529559091580865 ], [ 60, 32.49655943642544 ], [ 65, 32.100287698901425 ], [ 70, 32.206170747327455 ], [ 75, 32.63392381632404 ], [ 80, 32.42315863233753 ], [ 85, 32.55026996669754 ], [ 90, 32.50985674029992 ], [ 95, 32.2198642284273 ], [ 100, 32.13444212238494 ], [ 105, 32.073596413439745 ], [ 110, 32.37843137254902 ], [ 115, 32.079194994580746 ], [ 120, 31.7341600157651 ], [ 125, 31.293321509508324 ], [ 130, 31.93454691339533 ], [ 135, 31.732447727032252 ], [ 140, 31.785164302265635 ], [ 145, 31.523513964911594 ], [ 150, 31.449041913807093 ], [ 155, 31.22591762887702 ], [ 160, 31.264802999472828 ], [ 165, 31.212059980542314 ], [ 170, 30.92712160031533 ], [ 175, 31.102549247647318 ], [ 180, 31.162748141250205 ], [ 185, 30.57565756116702 ], [ 190, 30.69513096434695 ], [ 195, 31.049615854221134 ], [ 200, 30.03688520551455 ], [ 205, 29.840217980429067 ], [ 210, 29.653891029494368 ], [ 215, 29.48260295436404 ], [ 220, 29.835569636469348 ], [ 225, 29.175804331347173 ], [ 230, 29.726982437466738 ], [ 235, 28.763463246710565 ], [ 240, 28.13126887994205 ], [ 245, 28.120255385632827 ], [ 250, 28.18603670646113 ], [ 255, 27.2802739928545 ], [ 260, 27.68022569914993 ], [ 265, 27.23918554753528 ], [ 270, 27.06662461438385 ], [ 275, 25.52904726911405 ], [ 280, 26.05767225912964 ], [ 285, 26.09137273271508 ], [ 290, 24.703656443304276 ], [ 295, 25.012562364317017 ], [ 300, 22.348297115121213 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCMS1_R2", "pairs": [ [ 1, 31.134958807562263 ], [ 2, 32.59026620315253 ], [ 3, 32.507433687318446 ], [ 4, 33.266255535977905 ], [ 5, 32.35375017857993 ], [ 6, 32.75390732892043 ], [ 7, 32.443240154293065 ], [ 8, 32.497966569836656 ], [ 9, 32.86259821896281 ], [ 10, 33.01149292823468 ], [ 15, 32.93935901709605 ], [ 20, 32.801261012429165 ], [ 25, 32.95828848992809 ], [ 30, 32.67726653650174 ], [ 35, 32.668184199247584 ], [ 40, 32.686658412305356 ], [ 45, 32.776633173008236 ], [ 50, 32.56726129815705 ], [ 55, 32.57842087718463 ], [ 60, 32.39098528501357 ], [ 65, 32.082260107624165 ], [ 70, 32.185621220058096 ], [ 75, 32.58717177008429 ], [ 80, 32.329258536120776 ], [ 85, 32.547518453259684 ], [ 90, 32.41800180960998 ], [ 95, 32.14762226772704 ], [ 100, 32.05831899344461 ], [ 105, 31.967028121056263 ], [ 110, 32.30661047217659 ], [ 115, 32.048487272900445 ], [ 120, 31.80154772959973 ], [ 125, 31.32708907779127 ], [ 130, 31.875806367121463 ], [ 135, 31.610314070052624 ], [ 140, 31.65008940724308 ], [ 145, 31.41952364619405 ], [ 150, 31.33735337959149 ], [ 155, 31.082043701404483 ], [ 160, 31.10330507667397 ], [ 165, 31.222348795123345 ], [ 170, 30.68878083627012 ], [ 175, 31.02015620535289 ], [ 180, 31.065370987713116 ], [ 185, 30.456933308210182 ], [ 190, 30.643106625963792 ], [ 195, 30.782853360129916 ], [ 200, 29.891430013763408 ], [ 205, 29.55847354710278 ], [ 210, 29.48227091538597 ], [ 215, 29.417902913176203 ], [ 220, 29.768398443639068 ], [ 225, 29.044172936569073 ], [ 230, 29.668086849261567 ], [ 235, 28.572811461123145 ], [ 240, 27.941474101308746 ], [ 245, 27.944964090450156 ], [ 250, 28.057519097784468 ], [ 255, 27.11828624769017 ], [ 260, 27.487398092022545 ], [ 265, 26.948412118093376 ], [ 270, 26.827845062842606 ], [ 275, 25.37270739966376 ], [ 280, 25.896245366188644 ], [ 285, 25.952699458965174 ], [ 290, 24.66562399754683 ], [ 295, 24.822732963579416 ], [ 300, 22.342806966963003 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCMS2_R2", "pairs": [ [ 1, 30.974817568288113 ], [ 2, 32.714167466471665 ], [ 3, 32.688406128283646 ], [ 4, 33.33009348831777 ], [ 5, 32.39868882761282 ], [ 6, 32.856476897061285 ], [ 7, 32.53857599163125 ], [ 8, 32.58905257384866 ], [ 9, 32.92959176937178 ], [ 10, 33.046881268312994 ], [ 15, 33.017895319490364 ], [ 20, 32.83704188946949 ], [ 25, 33.00519492390426 ], [ 30, 32.75233162200454 ], [ 35, 32.716705514338095 ], [ 40, 32.71895918709343 ], [ 45, 32.837209467659946 ], [ 50, 32.59005643743044 ], [ 55, 32.61957018514945 ], [ 60, 32.43090665339575 ], [ 65, 32.13102954469282 ], [ 70, 32.202208390530615 ], [ 75, 32.639376196545825 ], [ 80, 32.40145791745044 ], [ 85, 32.568190127970745 ], [ 90, 32.47050782043469 ], [ 95, 32.22175096485883 ], [ 100, 32.10646838478529 ], [ 105, 32.023755548107296 ], [ 110, 32.36419499171856 ], [ 115, 32.11971581358265 ], [ 120, 31.888192247337656 ], [ 125, 31.424663683961956 ], [ 130, 31.96416664191606 ], [ 135, 31.709124761395934 ], [ 140, 31.763728606977804 ], [ 145, 31.51780813569651 ], [ 150, 31.437433905516382 ], [ 155, 31.175977735908464 ], [ 160, 31.204663067711483 ], [ 165, 31.316010949220196 ], [ 170, 30.828580714949545 ], [ 175, 31.138373563422697 ], [ 180, 31.197875160607186 ], [ 185, 30.585206070803103 ], [ 190, 30.76052227966644 ], [ 195, 30.93302184798838 ], [ 200, 30.05557880409942 ], [ 205, 29.749894849663132 ], [ 210, 29.642487493969174 ], [ 215, 29.610012270416327 ], [ 220, 29.92809490919433 ], [ 225, 29.22606187998925 ], [ 230, 29.833773489080748 ], [ 235, 28.769557253008816 ], [ 240, 28.161827129645143 ], [ 245, 28.13138614213379 ], [ 250, 28.230402365687087 ], [ 255, 27.302110240379488 ], [ 260, 27.694535186088086 ], [ 265, 27.151158933843373 ], [ 270, 27.004224769413497 ], [ 275, 25.536780196450884 ], [ 280, 26.031434354428775 ], [ 285, 26.095915095930373 ], [ 290, 24.811978366818046 ], [ 295, 24.99875115937892 ], [ 300, 22.448725017788423 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPFS1_R2", "pairs": [ [ 1, 31.133692268640367 ], [ 2, 32.38345513085998 ], [ 3, 32.51877730424443 ], [ 4, 33.18940962712589 ], [ 5, 32.31023633618789 ], [ 6, 32.72207452138248 ], [ 7, 32.38050927843315 ], [ 8, 32.44711493500421 ], [ 9, 32.82749061468785 ], [ 10, 33.07754605816889 ], [ 15, 32.78873094547835 ], [ 20, 32.77273650318633 ], [ 25, 32.91609330536666 ], [ 30, 32.69908217659082 ], [ 35, 32.66248358596938 ], [ 40, 32.71447282802781 ], [ 45, 32.71641146918925 ], [ 50, 32.6455487076461 ], [ 55, 32.577346062116284 ], [ 60, 32.610676945893765 ], [ 65, 31.83280712419916 ], [ 70, 32.07432110549979 ], [ 75, 32.5960450543137 ], [ 80, 32.198100022714215 ], [ 85, 32.21800101303554 ], [ 90, 32.2065230316999 ], [ 95, 31.01721882620169 ], [ 100, 32.07949981471338 ], [ 105, 31.954802116458673 ], [ 110, 32.18330883728388 ], [ 115, 31.956022019721548 ], [ 120, 31.862335319740254 ], [ 125, 31.646199994655404 ], [ 130, 31.87547900911253 ], [ 135, 31.35660057187141 ], [ 140, 31.880357286015872 ], [ 145, 31.11572100084561 ], [ 150, 31.35684747098869 ], [ 155, 31.242557358688895 ], [ 160, 31.350557879123965 ], [ 165, 31.19816637760686 ], [ 170, 30.265414603836366 ], [ 175, 30.917791452032098 ], [ 180, 30.292233068088432 ], [ 185, 30.48931807945862 ], [ 190, 30.770095543529102 ], [ 195, 30.801983029331193 ], [ 200, 30.101162557626775 ], [ 205, 29.602804837308742 ], [ 210, 29.390000668136565 ], [ 215, 28.81582425218315 ], [ 220, 29.34051674027354 ], [ 225, 28.675373968951828 ], [ 230, 29.275455007082343 ], [ 235, 28.44540182270091 ], [ 240, 27.48894486463372 ], [ 245, 27.959952695298927 ], [ 250, 27.697078867894277 ], [ 255, 26.53578186385867 ], [ 260, 27.283915065344626 ], [ 265, 26.69351497982201 ], [ 270, 26.841752063901374 ], [ 275, 24.857413394657122 ], [ 280, 25.719227266181747 ], [ 285, 25.739941744454313 ], [ 290, 24.44982658955845 ], [ 295, 24.510564008374637 ], [ 300, 21.252517560711738 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPFS2_R2", "pairs": [ [ 1, 31.201303629626324 ], [ 2, 30.972716415911425 ], [ 3, 31.855160944685032 ], [ 4, 32.840913656859684 ], [ 5, 31.52301442028662 ], [ 6, 32.23516674851556 ], [ 7, 31.828195455154248 ], [ 8, 31.948675164069826 ], [ 9, 32.39906915487298 ], [ 10, 32.482142059913386 ], [ 15, 32.46954328318229 ], [ 20, 32.27456917719541 ], [ 25, 32.40615987320863 ], [ 30, 32.04807134247064 ], [ 35, 32.08090808552426 ], [ 40, 32.123832757996524 ], [ 45, 32.15506395517557 ], [ 50, 32.00569501577383 ], [ 55, 31.9543968524151 ], [ 60, 31.81183916064403 ], [ 65, 31.289299885593103 ], [ 70, 31.483126377765995 ], [ 75, 31.976807210424976 ], [ 80, 31.65541908178158 ], [ 85, 31.909273149388337 ], [ 90, 31.771783194928116 ], [ 95, 31.45865702294848 ], [ 100, 31.39459438342709 ], [ 105, 31.144925886239843 ], [ 110, 31.583444658864476 ], [ 115, 31.286085175490978 ], [ 120, 30.883442067606858 ], [ 125, 30.512207073215656 ], [ 130, 31.12275343917433 ], [ 135, 30.860279579875133 ], [ 140, 30.88377256136356 ], [ 145, 30.535578028552614 ], [ 150, 30.425119155253434 ], [ 155, 30.17385630622964 ], [ 160, 30.203919029786185 ], [ 165, 30.147298514750013 ], [ 170, 29.72308233245524 ], [ 175, 29.97694334062598 ], [ 180, 30.075899674063486 ], [ 185, 29.370623098154073 ], [ 190, 29.480631352171947 ], [ 195, 29.792229779892807 ], [ 200, 28.772048892113634 ], [ 205, 28.456538483004966 ], [ 210, 28.342802924596754 ], [ 215, 28.135966958754256 ], [ 220, 28.48320031255232 ], [ 225, 27.764404299620633 ], [ 230, 28.26577587265441 ], [ 235, 27.164266458292634 ], [ 240, 26.508958781011916 ], [ 245, 26.428408450311167 ], [ 250, 26.559912929422598 ], [ 255, 25.631832110066135 ], [ 260, 25.979467164128955 ], [ 265, 25.33315956330513 ], [ 270, 25.307086245004577 ], [ 275, 23.86936744645876 ], [ 280, 24.407664862166932 ], [ 285, 24.423502051461295 ], [ 290, 23.04573364741608 ], [ 295, 23.38438952112802 ], [ 300, 21.21033188601945 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPMS1_R2", "pairs": [ [ 1, 31.24400293878129 ], [ 2, 32.430168537336684 ], [ 3, 32.59721877987466 ], [ 4, 33.26863293559466 ], [ 5, 32.27020854725065 ], [ 6, 32.77400594837659 ], [ 7, 32.449213079347096 ], [ 8, 32.49045781255532 ], [ 9, 32.91849307793081 ], [ 10, 33.08418900258471 ], [ 15, 32.92661544453493 ], [ 20, 32.82225418687817 ], [ 25, 33.01976330418157 ], [ 30, 32.73429876429558 ], [ 35, 32.74085260064441 ], [ 40, 32.7490555181815 ], [ 45, 32.74082161951634 ], [ 50, 32.567006061714665 ], [ 55, 32.581657239468534 ], [ 60, 32.44441670871286 ], [ 65, 32.02618371086385 ], [ 70, 32.21651809484178 ], [ 75, 32.64984575619299 ], [ 80, 32.44353859581336 ], [ 85, 32.62262125007745 ], [ 90, 32.46727863396153 ], [ 95, 32.11949472864237 ], [ 100, 32.10763588403573 ], [ 105, 32.04086931503817 ], [ 110, 32.36078875733097 ], [ 115, 32.052118180812215 ], [ 120, 31.694284386411418 ], [ 125, 31.262242779683522 ], [ 130, 31.876091454279333 ], [ 135, 31.653223678968846 ], [ 140, 31.722999088180877 ], [ 145, 31.450637751363928 ], [ 150, 31.344990505530696 ], [ 155, 31.077057996699956 ], [ 160, 31.184277620396603 ], [ 165, 31.10538066572238 ], [ 170, 30.742026381019834 ], [ 175, 30.984378541076488 ], [ 180, 31.115696152762617 ], [ 185, 30.501436355809677 ], [ 190, 30.616861059592686 ], [ 195, 30.907416018938097 ], [ 200, 29.940870057897627 ], [ 205, 29.71518574282656 ], [ 210, 29.5458882583638 ], [ 215, 29.44348114769337 ], [ 220, 29.806234230724964 ], [ 225, 29.085732253244743 ], [ 230, 29.666394277164432 ], [ 235, 28.64120799374556 ], [ 240, 27.98378648770684 ], [ 245, 27.884117610603017 ], [ 250, 28.053859706593244 ], [ 255, 27.141500607760047 ], [ 260, 27.50925156155239 ], [ 265, 26.910450753176697 ], [ 270, 26.832253740702804 ], [ 275, 25.37593504219824 ], [ 280, 25.967459607083946 ], [ 285, 25.98117759931129 ], [ 290, 24.544046336491068 ], [ 295, 24.881440496198753 ], [ 300, 22.322942148612576 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPMS2_R2", "pairs": [ [ 1, 31.23090483794567 ], [ 2, 30.878668014474282 ], [ 3, 31.771697993426997 ], [ 4, 32.8199260659156 ], [ 5, 31.44672009063518 ], [ 6, 32.19448473217207 ], [ 7, 31.787700767176002 ], [ 8, 31.886432558343955 ], [ 9, 32.357774554759565 ], [ 10, 32.42950526670476 ], [ 15, 32.475963609194395 ], [ 20, 32.27948158240427 ], [ 25, 32.3923214032826 ], [ 30, 32.0094922769647 ], [ 35, 32.02913833882964 ], [ 40, 32.088534636025884 ], [ 45, 32.11334446755936 ], [ 50, 31.95942426119292 ], [ 55, 31.98315305240437 ], [ 60, 31.799979489483473 ], [ 65, 31.298047105819613 ], [ 70, 31.478431238493357 ], [ 75, 31.994411372593067 ], [ 80, 31.714816894805466 ], [ 85, 31.94759074682697 ], [ 90, 31.801348810634217 ], [ 95, 31.420201882084065 ], [ 100, 31.372545464423162 ], [ 105, 31.21397463508016 ], [ 110, 31.594700421446397 ], [ 115, 31.24556797593409 ], [ 120, 30.89264202450542 ], [ 125, 30.350285929159888 ], [ 130, 31.018402355459482 ], [ 135, 30.75202881791999 ], [ 140, 30.847351148616973 ], [ 145, 30.537673855289892 ], [ 150, 30.427255368296652 ], [ 155, 30.192328842049744 ], [ 160, 30.211961888390213 ], [ 165, 30.186636518579654 ], [ 170, 29.70364479076079 ], [ 175, 29.971967025775758 ], [ 180, 30.07386773194769 ], [ 185, 29.400194617758153 ], [ 190, 29.478265144848393 ], [ 195, 29.71551298894755 ], [ 200, 28.674207207779205 ], [ 205, 28.405801192668168 ], [ 210, 28.282837202260303 ], [ 215, 28.108902032224506 ], [ 220, 28.430492647166563 ], [ 225, 27.671576152856282 ], [ 230, 28.204357636853825 ], [ 235, 27.130811159301373 ], [ 240, 26.471263626772945 ], [ 245, 26.437672937496586 ], [ 250, 26.5440674406451 ], [ 255, 25.614201218112463 ], [ 260, 25.932990138857008 ], [ 265, 25.319519592855432 ], [ 270, 25.26042013646376 ], [ 275, 23.883727353173708 ], [ 280, 24.40327518846937 ], [ 285, 24.427955532163054 ], [ 290, 23.107741289681563 ], [ 295, 23.402145886874045 ], [ 300, 21.062028117424845 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVFS1_R2", "pairs": [ [ 1, 31.174337517433752 ], [ 2, 32.51121229523888 ], [ 3, 32.543231146479975 ], [ 4, 33.2730512939718 ], [ 5, 32.286332850201916 ], [ 6, 32.79500642655947 ], [ 7, 32.474813356304864 ], [ 8, 32.50778479685691 ], [ 9, 32.91647295831396 ], [ 10, 33.032496513249654 ], [ 15, 32.95394299049234 ], [ 20, 32.79490797713786 ], [ 25, 32.98440852863693 ], [ 30, 32.69895990009207 ], [ 35, 32.73620370961256 ], [ 40, 32.745530133762905 ], [ 45, 32.71411186114669 ], [ 50, 32.55051651734792 ], [ 55, 32.52877347955495 ], [ 60, 32.45797085595255 ], [ 65, 31.90612644888397 ], [ 70, 32.16048734462813 ], [ 75, 32.54297356798075 ], [ 80, 32.239287976596714 ], [ 85, 32.50606220828472 ], [ 90, 32.37792171091015 ], [ 95, 32.15681884480747 ], [ 100, 31.974595357586452 ], [ 105, 31.948150984333626 ], [ 110, 32.284114373230864 ], [ 115, 31.985689215860553 ], [ 120, 31.55508211516635 ], [ 125, 31.18674214971717 ], [ 130, 31.857740887108168 ], [ 135, 31.523682657031266 ], [ 140, 31.635989534427903 ], [ 145, 31.393294125916746 ], [ 150, 31.23777377669394 ], [ 155, 31.00593203728605 ], [ 160, 31.02044730134598 ], [ 165, 31.102900215622206 ], [ 170, 30.792897453766322 ], [ 175, 30.93512747229705 ], [ 180, 30.974792712222115 ], [ 185, 30.31520209821947 ], [ 190, 30.551647149453686 ], [ 195, 30.853181046179152 ], [ 200, 29.938151456262254 ], [ 205, 29.63130222317444 ], [ 210, 29.52495817587557 ], [ 215, 29.342884884510717 ], [ 220, 29.667807504182413 ], [ 225, 29.018674001794267 ], [ 230, 29.543739429717597 ], [ 235, 28.547487423263345 ], [ 240, 27.888934273028145 ], [ 245, 27.867349860048687 ], [ 250, 28.02293286895634 ], [ 255, 27.123841933218433 ], [ 260, 27.48747922104544 ], [ 265, 26.87800156881513 ], [ 270, 26.842395907752824 ], [ 275, 25.358045721567173 ], [ 280, 25.94959919592431 ], [ 285, 25.98326670297838 ], [ 290, 24.49942040369387 ], [ 295, 24.860639685848845 ], [ 300, 22.162511772085793 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVFS2_R2", "pairs": [ [ 1, 31.19461347212414 ], [ 2, 32.66585243158007 ], [ 3, 32.678699610134565 ], [ 4, 33.27779605104045 ], [ 5, 32.385444378875675 ], [ 6, 32.848866681500255 ], [ 7, 32.51078176242394 ], [ 8, 32.581591192717354 ], [ 9, 32.881811761746754 ], [ 10, 33.02858110265167 ], [ 15, 32.993729261190495 ], [ 20, 32.81976995037196 ], [ 25, 32.96243554644042 ], [ 30, 32.717135698323474 ], [ 35, 32.6973899331521 ], [ 40, 32.68284737507071 ], [ 45, 32.72685199069349 ], [ 50, 32.505241925731724 ], [ 55, 32.53942061653211 ], [ 60, 32.42766123141963 ], [ 65, 31.98460362683022 ], [ 70, 32.131229533175 ], [ 75, 32.523528928058354 ], [ 80, 32.273550452990996 ], [ 85, 32.482445812795966 ], [ 90, 32.396786954214484 ], [ 95, 32.15675063849547 ], [ 100, 31.998441151529157 ], [ 105, 31.98555155150313 ], [ 110, 32.30360122862602 ], [ 115, 32.022828258398434 ], [ 120, 31.60753621786345 ], [ 125, 31.218004691997002 ], [ 130, 31.88483152510375 ], [ 135, 31.60719088297039 ], [ 140, 31.675352868904003 ], [ 145, 31.439397486625325 ], [ 150, 31.31624800047083 ], [ 155, 31.04148636163554 ], [ 160, 31.076787934195316 ], [ 165, 31.159382536512624 ], [ 170, 30.83579223342298 ], [ 175, 30.97976994369522 ], [ 180, 30.985581332352996 ], [ 185, 30.40799850148407 ], [ 190, 30.60781989948193 ], [ 195, 30.917667090732312 ], [ 200, 30.007081769281378 ], [ 205, 29.65089005843427 ], [ 210, 29.589103556363916 ], [ 215, 29.436695561317286 ], [ 220, 29.748593320691924 ], [ 225, 29.0478585436913 ], [ 230, 29.624252978652386 ], [ 235, 28.62251811849354 ], [ 240, 27.934645897832816 ], [ 245, 27.940688854489167 ], [ 250, 28.06046923374613 ], [ 255, 27.151796633126935 ], [ 260, 27.528564241486073 ], [ 265, 26.935610895334737 ], [ 270, 26.82928544822148 ], [ 275, 25.366704363795563 ], [ 280, 25.92315722758599 ], [ 285, 25.968509022505607 ], [ 290, 24.4169310931129 ], [ 295, 24.818001988560017 ], [ 300, 22.02193134236933 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVMS1_R2", "pairs": [ [ 1, 31.171849436094327 ], [ 2, 32.329399445910866 ], [ 3, 32.43002443227678 ], [ 4, 33.21384786544796 ], [ 5, 32.161634781091166 ], [ 6, 32.717801749525535 ], [ 7, 32.36830566523418 ], [ 8, 32.433345694901945 ], [ 9, 32.86182674898017 ], [ 10, 32.952614471761095 ], [ 15, 32.92538011823477 ], [ 20, 32.751672083942324 ], [ 25, 32.92892388909492 ], [ 30, 32.624097423703674 ], [ 35, 32.65478057392569 ], [ 40, 32.6577132719512 ], [ 45, 32.602592685507354 ], [ 50, 32.42125985119497 ], [ 55, 32.507483052557525 ], [ 60, 32.37911987827292 ], [ 65, 31.994841869317902 ], [ 70, 32.21342318984099 ], [ 75, 32.56862456369983 ], [ 80, 32.29695898778359 ], [ 85, 32.49849694589877 ], [ 90, 32.34850785340314 ], [ 95, 31.92599585514834 ], [ 100, 31.95383507853403 ], [ 105, 31.79895833333334 ], [ 110, 32.18022289066584 ], [ 115, 31.899847839484288 ], [ 120, 31.64760824393676 ], [ 125, 31.18854596720096 ], [ 130, 31.741892135101086 ], [ 135, 31.50638147023053 ], [ 140, 31.616714750843972 ], [ 145, 31.35614303712682 ], [ 150, 31.213230217122163 ], [ 155, 31.03314698968656 ], [ 160, 31.131561523400215 ], [ 165, 31.1348808036956 ], [ 170, 30.76467469853234 ], [ 175, 30.849041717123164 ], [ 180, 30.627345215759853 ], [ 185, 30.213054212936605 ], [ 190, 30.495511268189453 ], [ 195, 30.779370377642515 ], [ 200, 29.638990591308676 ], [ 205, 29.36238307434699 ], [ 210, 29.30447521857938 ], [ 215, 29.01087298244259 ], [ 220, 29.449135495412946 ], [ 225, 28.65725058737994 ], [ 230, 29.260227557843983 ], [ 235, 28.31743630024335 ], [ 240, 27.543545184797313 ], [ 245, 27.690724134921673 ], [ 250, 27.666813937251824 ], [ 255, 26.67420582973339 ], [ 260, 27.07036152201423 ], [ 265, 26.557919884801674 ], [ 270, 26.493151372343675 ], [ 275, 25.042218691774757 ], [ 280, 25.66413398522617 ], [ 285, 25.69853400054974 ], [ 290, 24.216996229779873 ], [ 295, 24.58607420539707 ], [ 300, 22.068195862086483 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVMS2_R2", "pairs": [ [ 1, 31.20180420835979 ], [ 2, 32.547664820126556 ], [ 3, 32.62618291694949 ], [ 4, 33.23651770269974 ], [ 5, 32.30366315605089 ], [ 6, 32.78586411508397 ], [ 7, 32.43307131440082 ], [ 8, 32.47803639070745 ], [ 9, 32.82163298373147 ], [ 10, 32.95496923649581 ], [ 15, 32.96011648529701 ], [ 20, 32.76140045105209 ], [ 25, 32.91648529701561 ], [ 30, 32.64092837905892 ], [ 35, 32.63709575003831 ], [ 40, 32.586716296993714 ], [ 45, 32.645915351098076 ], [ 50, 32.41794689096109 ], [ 55, 32.49731292040359 ], [ 60, 32.35176569506727 ], [ 65, 32.03702879764574 ], [ 70, 32.17372915498879 ], [ 75, 32.51879729540359 ], [ 80, 32.338792152918465 ], [ 85, 32.49070159535101 ], [ 90, 32.37862851487403 ], [ 95, 31.985051083638787 ], [ 100, 31.97876186752645 ], [ 105, 31.87144039553837 ], [ 110, 32.22523352616851 ], [ 115, 31.952051045119923 ], [ 120, 31.694468506264588 ], [ 125, 31.21061016785857 ], [ 130, 31.790989061124968 ], [ 135, 31.56346405658105 ], [ 140, 31.673177866824325 ], [ 145, 31.412818323151374 ], [ 150, 31.282282884717244 ], [ 155, 31.06639018323232 ], [ 160, 31.16326945310584 ], [ 165, 31.16406783259622 ], [ 170, 30.777834223076685 ], [ 175, 30.909452884476423 ], [ 180, 30.75295335138088 ], [ 185, 30.3215237226228 ], [ 190, 30.56505180726132 ], [ 195, 30.832853927073025 ], [ 200, 29.752542283807337 ], [ 205, 29.481070167908978 ], [ 210, 29.40417013374909 ], [ 215, 29.13238619940615 ], [ 220, 29.58066638054113 ], [ 225, 28.794767173095458 ], [ 230, 29.41450632423531 ], [ 235, 28.454188906923427 ], [ 240, 27.70251185925199 ], [ 245, 27.839986685412207 ], [ 250, 27.80165030811883 ], [ 255, 26.835937696219084 ], [ 260, 27.227319551506657 ], [ 265, 26.719196135171075 ], [ 270, 26.583477502967337 ], [ 275, 25.174132296365322 ], [ 280, 25.74380460832173 ], [ 285, 25.785725246407594 ], [ 290, 24.189249728791793 ], [ 295, 24.602708779574563 ], [ 300, 22.02466618573827 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAFS1_R2", "pairs": [ [ 1, 38.485614831125794 ], [ 2, 39.123967125968925 ], [ 3, 39.236468377094944 ], [ 4, 39.323969350192954 ], [ 5, 38.51662051401817 ], [ 6, 38.69309044806993 ], [ 7, 38.67026990958529 ], [ 8, 38.704211568189145 ], [ 9, 39.19821172388483 ], [ 10, 39.075479042249135 ], [ 15, 38.99352083541854 ], [ 20, 38.999668590620445 ], [ 25, 39.1705690677165 ], [ 30, 39.0872763264716 ], [ 35, 39.244956015969926 ], [ 40, 39.170924943560316 ], [ 45, 38.92562862131474 ], [ 50, 39.184421534936995 ], [ 55, 38.90159810496113 ], [ 60, 38.959374548204494 ], [ 65, 38.941643034286415 ], [ 70, 38.84330564174424 ], [ 75, 39.158101317132726 ], [ 80, 38.77834795858219 ], [ 85, 38.954980155151475 ], [ 90, 38.897057057057054 ], [ 95, 37.874959403848294 ], [ 100, 38.79212545879212 ], [ 105, 38.74983175227668 ], [ 110, 39.06330531677619 ], [ 115, 39.03355394147025 ], [ 120, 38.72746404458138 ], [ 125, 38.86909447553151 ], [ 130, 38.96300152389851 ], [ 135, 38.10907142823117 ], [ 140, 38.11474052617437 ], [ 145, 38.46633766395501 ], [ 150, 38.77753378942099 ], [ 155, 38.88463331296846 ], [ 160, 38.490201470145365 ], [ 165, 38.8248920927335 ], [ 170, 38.65443520393568 ], [ 175, 38.759364286949165 ], [ 180, 38.77330366579518 ], [ 185, 38.816142068635244 ], [ 190, 37.900695338150925 ], [ 195, 38.765244422216895 ], [ 200, 38.439096558174896 ], [ 205, 38.47815279251071 ], [ 210, 37.888298202491725 ], [ 215, 38.34225246767013 ], [ 220, 38.32774865613836 ], [ 225, 38.23491237689542 ], [ 230, 38.59275810159927 ], [ 235, 38.257666581340224 ], [ 240, 38.383045901448405 ], [ 245, 37.00804711417976 ], [ 250, 38.37746441251433 ], [ 255, 38.41484268049728 ], [ 260, 37.985130167372475 ], [ 265, 37.57220163166272 ], [ 270, 38.34474161630327 ], [ 275, 37.634530196113346 ], [ 280, 38.180032500055646 ], [ 285, 38.192005188881346 ], [ 290, 37.731640046747174 ], [ 295, 38.0367305536855 ], [ 300, 35.363635887128865 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAFS2_R2", "pairs": [ [ 1, 38.782409381663115 ], [ 2, 38.59626865671642 ], [ 3, 39.239125799573564 ], [ 4, 39.12601279317697 ], [ 5, 37.78443496801706 ], [ 6, 38.45938166311301 ], [ 7, 38.64765458422175 ], [ 8, 38.83827292110874 ], [ 9, 39.26300639658849 ], [ 10, 39.183070362473345 ], [ 15, 39.03669509594883 ], [ 20, 39.02927505330491 ], [ 25, 39.207803837953094 ], [ 30, 38.99528784648188 ], [ 35, 39.297391136181126 ], [ 40, 39.201044803965985 ], [ 45, 38.89980010128201 ], [ 50, 39.23456382099736 ], [ 55, 38.9432654124398 ], [ 60, 38.9862134222947 ], [ 65, 38.99015379694538 ], [ 70, 38.88797078657675 ], [ 75, 39.1303753930755 ], [ 80, 38.8305247440273 ], [ 85, 39.01564182112511 ], [ 90, 39.03248619963199 ], [ 95, 37.83657164191045 ], [ 100, 38.750388010346946 ], [ 105, 38.88302088055682 ], [ 110, 39.129858702335106 ], [ 115, 39.067011601546874 ], [ 120, 38.64310725009596 ], [ 125, 38.90160407816585 ], [ 130, 39.103405969114235 ], [ 135, 38.39857412638289 ], [ 140, 38.21100212453159 ], [ 145, 38.57551553954915 ], [ 150, 38.75169267707083 ], [ 155, 38.89628384687208 ], [ 160, 38.63023205426303 ], [ 165, 38.882281782657074 ], [ 170, 38.65452919025955 ], [ 175, 38.7878658520317 ], [ 180, 38.86751592464306 ], [ 185, 38.90068139703904 ], [ 190, 38.05276977265449 ], [ 195, 38.875418934784925 ], [ 200, 38.50009606147935 ], [ 205, 38.516493662441626 ], [ 210, 38.1018162692511 ], [ 215, 38.441052463041046 ], [ 220, 38.38588888295885 ], [ 225, 38.36336660084326 ], [ 230, 38.6636067673587 ], [ 235, 38.17183113625447 ], [ 240, 38.45068047179378 ], [ 245, 37.14739819608262 ], [ 250, 38.50347440892352 ], [ 255, 38.52571916528793 ], [ 260, 38.13408763409297 ], [ 265, 37.56713424439645 ], [ 270, 38.44972113254877 ], [ 275, 37.784406112566145 ], [ 280, 38.36240392826644 ], [ 285, 38.31216908625107 ], [ 290, 37.87256618274979 ], [ 295, 38.18557734107149 ], [ 300, 35.701699637914224 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAMS1_R2", "pairs": [ [ 1, 39.38213937698425 ], [ 2, 38.91981265520385 ], [ 3, 39.24056203438846 ], [ 4, 39.37811586458366 ], [ 5, 37.85817118787917 ], [ 6, 39.25489579731556 ], [ 7, 38.47131675730048 ], [ 8, 38.679030584980985 ], [ 9, 39.2350925722189 ], [ 10, 39.08959230503253 ], [ 15, 39.03783987677993 ], [ 20, 39.16684374312388 ], [ 25, 39.14935403765757 ], [ 30, 38.537503536290195 ], [ 35, 39.21771602803885 ], [ 40, 39.11629836859146 ], [ 45, 38.94308615974602 ], [ 50, 39.16811366422532 ], [ 55, 38.94054631754314 ], [ 60, 38.64734542482633 ], [ 65, 38.88864300757552 ], [ 70, 38.40667651588973 ], [ 75, 38.92568577143739 ], [ 80, 38.61051572643393 ], [ 85, 39.005983214368506 ], [ 90, 38.990137546176214 ], [ 95, 38.484501281815035 ], [ 100, 39.05002043575314 ], [ 105, 38.891753387619076 ], [ 110, 39.09302573914438 ], [ 115, 39.09662327862667 ], [ 120, 38.46534616110167 ], [ 125, 38.91570143997988 ], [ 130, 38.84976843779908 ], [ 135, 38.74487117008065 ], [ 140, 38.75339486792916 ], [ 145, 38.68408640694274 ], [ 150, 38.485262396629246 ], [ 155, 38.89706262593738 ], [ 160, 38.6012577825294 ], [ 165, 38.88691940609578 ], [ 170, 38.94690566037737 ], [ 175, 38.950930817610065 ], [ 180, 38.60753459119497 ], [ 185, 39.01008800602958 ], [ 190, 38.40338980148722 ], [ 195, 39.08188451377531 ], [ 200, 38.60067619018436 ], [ 205, 38.76343433298625 ], [ 210, 38.64360195885658 ], [ 215, 38.664313910513485 ], [ 220, 38.594259652433756 ], [ 225, 38.564907232388364 ], [ 230, 38.79760946149975 ], [ 235, 38.43938097634625 ], [ 240, 38.49151987921489 ], [ 245, 37.52681306738965 ], [ 250, 38.64421132099212 ], [ 255, 38.423259643502305 ], [ 260, 38.029531299150676 ], [ 265, 37.21496443093752 ], [ 270, 38.501417134588465 ], [ 275, 37.56225168687774 ], [ 280, 38.25387627990374 ], [ 285, 38.22447034398151 ], [ 290, 37.77078595133613 ], [ 295, 38.18478152324444 ], [ 300, 34.225525186565385 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAMS2_R2", "pairs": [ [ 1, 39.061161360571155 ], [ 2, 38.598893824471965 ], [ 3, 39.18603298729259 ], [ 4, 39.333226097823534 ], [ 5, 37.898711936549574 ], [ 6, 38.97261782501639 ], [ 7, 38.43269528205001 ], [ 8, 38.703077246687045 ], [ 9, 39.267152526014925 ], [ 10, 39.049213675002164 ], [ 15, 38.99339511748475 ], [ 20, 39.11669285687772 ], [ 25, 39.115851470570036 ], [ 30, 38.429131763570446 ], [ 35, 39.18300399658496 ], [ 40, 39.05200509781116 ], [ 45, 38.93266351555347 ], [ 50, 39.15096141948575 ], [ 55, 38.92055730159124 ], [ 60, 38.525602621151265 ], [ 65, 38.81755571228827 ], [ 70, 38.25368116023446 ], [ 75, 38.804890120768164 ], [ 80, 38.57949910908731 ], [ 85, 38.96781836993596 ], [ 90, 38.9416720289066 ], [ 95, 38.48064148888779 ], [ 100, 39.024916834756596 ], [ 105, 38.82560542500403 ], [ 110, 39.054923072225556 ], [ 115, 39.052746033500256 ], [ 120, 38.37996188401851 ], [ 125, 38.862258523606215 ], [ 130, 38.73616731637894 ], [ 135, 38.74192933605594 ], [ 140, 38.70319417433693 ], [ 145, 38.639271305165714 ], [ 150, 38.45785995396154 ], [ 155, 38.85171697169742 ], [ 160, 38.52574257425742 ], [ 165, 38.82876237623763 ], [ 170, 38.92269306930693 ], [ 175, 38.951534653465345 ], [ 180, 38.51609366542021 ], [ 185, 39.002694357210125 ], [ 190, 38.466733465711705 ], [ 195, 39.07097650552624 ], [ 200, 38.568430967248354 ], [ 205, 38.78522779713812 ], [ 210, 38.608456419355825 ], [ 215, 38.68203340930946 ], [ 220, 38.63570897924818 ], [ 225, 38.56988416271378 ], [ 230, 38.85502024441886 ], [ 235, 38.43408491512203 ], [ 240, 38.47586181715919 ], [ 245, 37.5172734503054 ], [ 250, 38.60794566060422 ], [ 255, 38.35078569040455 ], [ 260, 37.93032430625209 ], [ 265, 36.9923032161753 ], [ 270, 38.45232459324606 ], [ 275, 37.611422344404 ], [ 280, 38.204522376600536 ], [ 285, 38.23886666749223 ], [ 290, 37.78703769547615 ], [ 295, 38.152509939490585 ], [ 300, 33.36004259953072 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCFS1_R2", "pairs": [ [ 1, 31.08375700690914 ], [ 2, 32.21835484291488 ], [ 3, 32.567649263459785 ], [ 4, 33.24050808238822 ], [ 5, 32.43317364098553 ], [ 6, 32.68641637335419 ], [ 7, 32.32204080302438 ], [ 8, 32.3184477251988 ], [ 9, 32.83796929996089 ], [ 10, 33.02457143788293 ], [ 15, 32.98720342849694 ], [ 20, 32.813479337765614 ], [ 25, 32.872862077955936 ], [ 30, 32.44127884239343 ], [ 35, 32.477734738560706 ], [ 40, 32.741137695265024 ], [ 45, 32.59203454738043 ], [ 50, 32.59269127352725 ], [ 55, 32.481632852603276 ], [ 60, 32.40140934502036 ], [ 65, 31.815407557102 ], [ 70, 31.576337812400688 ], [ 75, 32.38922090303865 ], [ 80, 32.09875732364181 ], [ 85, 32.03435574686601 ], [ 90, 32.08122173236303 ], [ 95, 31.447051922622233 ], [ 100, 31.87562863199268 ], [ 105, 31.5958004576129 ], [ 110, 31.956405929824836 ], [ 115, 31.746058037169878 ], [ 120, 31.589252195827395 ], [ 125, 31.58141584657553 ], [ 130, 31.556921112016123 ], [ 135, 31.294851635508184 ], [ 140, 31.43677573622042 ], [ 145, 30.92518966419355 ], [ 150, 31.07317451252346 ], [ 155, 30.917263754116686 ], [ 160, 30.733595825446752 ], [ 165, 31.11318973191361 ], [ 170, 30.630746898985297 ], [ 175, 30.824599746530417 ], [ 180, 30.917789437050864 ], [ 185, 30.455574756636373 ], [ 190, 30.085286670056018 ], [ 195, 30.71402368670565 ], [ 200, 29.682248995034534 ], [ 205, 29.68143928512267 ], [ 210, 29.40183990231793 ], [ 215, 28.93643412256791 ], [ 220, 29.42421039435026 ], [ 225, 28.640139519941556 ], [ 230, 29.27531723566697 ], [ 235, 28.47145161844843 ], [ 240, 27.087953490159645 ], [ 245, 27.408557666690207 ], [ 250, 27.529410588340255 ], [ 255, 26.64021999358021 ], [ 260, 27.270403595566258 ], [ 265, 26.47975284255052 ], [ 270, 26.517094111077967 ], [ 275, 24.77504958556407 ], [ 280, 25.369132866976166 ], [ 285, 25.447332766818576 ], [ 290, 24.244131936526948 ], [ 295, 24.245909062674013 ], [ 300, 21.353272287500587 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCFS2_R2", "pairs": [ [ 1, 30.98414813775689 ], [ 2, 32.517963105842746 ], [ 3, 32.67241355123799 ], [ 4, 33.241411236585535 ], [ 5, 32.66562390404714 ], [ 6, 32.82741109630357 ], [ 7, 32.4109139370134 ], [ 8, 32.50960230062425 ], [ 9, 32.93110752612752 ], [ 10, 33.00388581047906 ], [ 15, 32.989981061934486 ], [ 20, 32.78170162025672 ], [ 25, 32.886576418601386 ], [ 30, 32.565622501227466 ], [ 35, 32.544661569755206 ], [ 40, 32.78146644563378 ], [ 45, 32.66298925394911 ], [ 50, 32.63492936406616 ], [ 55, 32.54016769872865 ], [ 60, 32.47207550029079 ], [ 65, 31.938191053488243 ], [ 70, 31.687591812435016 ], [ 75, 32.41138739378042 ], [ 80, 32.21032811560228 ], [ 85, 32.12513298807509 ], [ 90, 32.132154111198616 ], [ 95, 31.563287048459255 ], [ 100, 31.95839706111483 ], [ 105, 31.729257705792616 ], [ 110, 32.00394104410201 ], [ 115, 31.830635262715937 ], [ 120, 31.72307987858601 ], [ 125, 31.663026647328934 ], [ 130, 31.718926815237317 ], [ 135, 31.494976341888197 ], [ 140, 31.62245777195135 ], [ 145, 31.09484475723962 ], [ 150, 31.252193883838288 ], [ 155, 31.123125918162486 ], [ 160, 30.948657660910253 ], [ 165, 31.255789308250634 ], [ 170, 30.838039734102285 ], [ 175, 31.00591729492615 ], [ 180, 31.132545625783315 ], [ 185, 30.672342466419064 ], [ 190, 30.314111529499478 ], [ 195, 30.984436609449414 ], [ 200, 29.858690350667494 ], [ 205, 29.9302750325514 ], [ 210, 29.657850801965758 ], [ 215, 29.336230719252466 ], [ 220, 29.675809097111596 ], [ 225, 28.849573277071688 ], [ 230, 29.601802753639173 ], [ 235, 28.849272376570845 ], [ 240, 27.46159936050625 ], [ 245, 27.849676083174007 ], [ 250, 27.948330432699066 ], [ 255, 27.108792705783817 ], [ 260, 27.693403650888406 ], [ 265, 26.970061899252364 ], [ 270, 26.935434755304065 ], [ 275, 25.326882325847553 ], [ 280, 25.87758599751147 ], [ 285, 25.95080130183593 ], [ 290, 24.69632811075715 ], [ 295, 24.697723847574682 ], [ 300, 21.711171333220943 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCMS1_R2", "pairs": [ [ 1, 31.100666586670748 ], [ 2, 32.15056748827991 ], [ 3, 32.52978951419031 ], [ 4, 33.20436198428494 ], [ 5, 32.41468228517993 ], [ 6, 32.64557532925906 ], [ 7, 32.32338349629053 ], [ 8, 32.34947182005884 ], [ 9, 32.79315124607434 ], [ 10, 33.019787403953174 ], [ 15, 32.92556490220499 ], [ 20, 32.805006641040386 ], [ 25, 32.83931164892275 ], [ 30, 32.38443720803214 ], [ 35, 32.40976950175012 ], [ 40, 32.6830245739927 ], [ 45, 32.64598545884904 ], [ 50, 32.57177924265183 ], [ 55, 32.469090743568415 ], [ 60, 32.38055279914224 ], [ 65, 31.860776151025846 ], [ 70, 31.72608878595984 ], [ 75, 32.404225652336926 ], [ 80, 32.18133844055374 ], [ 85, 32.203304860574534 ], [ 90, 32.191467154462806 ], [ 95, 31.527615658137726 ], [ 100, 31.95842564768744 ], [ 105, 31.567510914307615 ], [ 110, 32.02615452017043 ], [ 115, 31.76694632514011 ], [ 120, 31.60176740568074 ], [ 125, 31.57894931623111 ], [ 130, 31.413237749522274 ], [ 135, 31.337280991190397 ], [ 140, 31.468169137618673 ], [ 145, 30.944782823226127 ], [ 150, 31.06114973560967 ], [ 155, 30.917582175542613 ], [ 160, 30.74462345670569 ], [ 165, 31.12870853043471 ], [ 170, 30.597781055498324 ], [ 175, 30.80208879447074 ], [ 180, 30.959597197805444 ], [ 185, 30.48914212038765 ], [ 190, 30.104724475995443 ], [ 195, 30.711061213333146 ], [ 200, 29.754281217643403 ], [ 205, 29.683373890407903 ], [ 210, 29.289754935050315 ], [ 215, 28.999766400622928 ], [ 220, 29.48063132602777 ], [ 225, 28.69016837006591 ], [ 230, 29.323081192580748 ], [ 235, 28.39394377641279 ], [ 240, 26.906754478616552 ], [ 245, 27.32558765662214 ], [ 250, 27.486482760311663 ], [ 255, 26.624170097840228 ], [ 260, 27.161694213164328 ], [ 265, 26.408864587216765 ], [ 270, 26.413625487814993 ], [ 275, 24.82850831560509 ], [ 280, 25.392914417057757 ], [ 285, 25.480123611237683 ], [ 290, 24.342669893642913 ], [ 295, 24.32745345363451 ], [ 300, 21.45210397642693 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCMS2_R2", "pairs": [ [ 1, 30.936593029797987 ], [ 2, 32.487001199562634 ], [ 3, 32.68690353605588 ], [ 4, 33.24313966943026 ], [ 5, 32.62120359656479 ], [ 6, 32.8455324253458 ], [ 7, 32.43771297544612 ], [ 8, 32.51787136017664 ], [ 9, 32.96294094542521 ], [ 10, 33.021997643337116 ], [ 15, 32.97478158405962 ], [ 20, 32.797231451895414 ], [ 25, 32.886517128268274 ], [ 30, 32.54328722625025 ], [ 35, 32.511261401834645 ], [ 40, 32.7571327490755 ], [ 45, 32.72661277830757 ], [ 50, 32.64174572113047 ], [ 55, 32.52773095807849 ], [ 60, 32.46633303821392 ], [ 65, 32.01326323615315 ], [ 70, 31.84295303439047 ], [ 75, 32.47432001555089 ], [ 80, 32.32957584958152 ], [ 85, 32.343049495534686 ], [ 90, 32.274412793929784 ], [ 95, 31.709485675580744 ], [ 100, 32.092897868146004 ], [ 105, 31.742394686719273 ], [ 110, 32.1184623433566 ], [ 115, 31.926984252451756 ], [ 120, 31.806840174473972 ], [ 125, 31.745208141141212 ], [ 130, 31.610515876138344 ], [ 135, 31.579800874034827 ], [ 140, 31.699546227746794 ], [ 145, 31.15185339166124 ], [ 150, 31.295140516845116 ], [ 155, 31.182021273018584 ], [ 160, 31.027066504510902 ], [ 165, 31.34386022195842 ], [ 170, 30.8664264269049 ], [ 175, 31.048195838393447 ], [ 180, 31.22373815894059 ], [ 185, 30.741151749840533 ], [ 190, 30.403657597834865 ], [ 195, 30.992783559518365 ], [ 200, 29.991319050574663 ], [ 205, 29.974129971923265 ], [ 210, 29.531008191317085 ], [ 215, 29.402054853211745 ], [ 220, 29.75845388346044 ], [ 225, 28.935879265906937 ], [ 230, 29.644361536583364 ], [ 235, 28.808006252168575 ], [ 240, 27.320208880699756 ], [ 245, 27.730226985049615 ], [ 250, 27.903716413290066 ], [ 255, 27.10552622563511 ], [ 260, 27.617711855463774 ], [ 265, 26.91950500512358 ], [ 270, 26.842233601787665 ], [ 275, 25.374892783777373 ], [ 280, 25.916677624352978 ], [ 285, 25.986630285191428 ], [ 290, 24.772802321056396 ], [ 295, 24.792484447879165 ], [ 300, 21.712212981477784 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPFS1_R2", "pairs": [ [ 1, 30.857746657462066 ], [ 2, 32.38115498950394 ], [ 3, 32.54658420096085 ], [ 4, 33.22788430380817 ], [ 5, 32.596521506361036 ], [ 6, 32.76192254046972 ], [ 7, 32.38123247721157 ], [ 8, 32.43535411882388 ], [ 9, 32.88868538581834 ], [ 10, 33.03802110483382 ], [ 15, 33.03213908339086 ], [ 20, 32.867435438650865 ], [ 25, 32.92360557347948 ], [ 30, 32.51698953211513 ], [ 35, 32.566187182124295 ], [ 40, 32.757595606778516 ], [ 45, 32.70638450405388 ], [ 50, 32.64585200714039 ], [ 55, 32.57478266995421 ], [ 60, 32.52240003317574 ], [ 65, 31.932294453899914 ], [ 70, 31.769738213993854 ], [ 75, 32.46433525437597 ], [ 80, 32.19271583919674 ], [ 85, 32.0639220841735 ], [ 90, 32.096597642516436 ], [ 95, 31.376283681856187 ], [ 100, 31.939166766481833 ], [ 105, 31.750993818836044 ], [ 110, 32.0494278882403 ], [ 115, 31.817634314361932 ], [ 120, 31.688032359413377 ], [ 125, 31.619610527212796 ], [ 130, 31.70928522804646 ], [ 135, 31.420048644545204 ], [ 140, 31.612660713885425 ], [ 145, 31.01936357099553 ], [ 150, 31.225927895151784 ], [ 155, 31.058647221183872 ], [ 160, 30.893293371075764 ], [ 165, 31.235971707529007 ], [ 170, 30.67833426322132 ], [ 175, 30.982087811059056 ], [ 180, 30.96350972133347 ], [ 185, 30.577485890913124 ], [ 190, 30.26446421989605 ], [ 195, 30.84232942045684 ], [ 200, 29.89076123371632 ], [ 205, 29.719105003082422 ], [ 210, 29.3862489030608 ], [ 215, 29.11102724361236 ], [ 220, 29.518289080886795 ], [ 225, 28.676768267517808 ], [ 230, 29.421835139406255 ], [ 235, 28.609737272829893 ], [ 240, 27.293430761607983 ], [ 245, 27.65748290920892 ], [ 250, 27.730897469363565 ], [ 255, 26.788007877187482 ], [ 260, 27.471013531627886 ], [ 265, 26.58047978656827 ], [ 270, 26.690040144208723 ], [ 275, 24.90596284465466 ], [ 280, 25.565231229180387 ], [ 285, 25.62939835094224 ], [ 290, 24.289333837013345 ], [ 295, 24.364224604233534 ], [ 300, 21.299416315568738 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPFS2_R2", "pairs": [ [ 1, 31.12817640246164 ], [ 2, 32.135284277138986 ], [ 3, 32.58873488914289 ], [ 4, 33.21931464646082 ], [ 5, 32.470414133997444 ], [ 6, 32.71837222857229 ], [ 7, 32.30087731914281 ], [ 8, 32.36708879923093 ], [ 9, 32.78145745494183 ], [ 10, 32.98020543953008 ], [ 15, 33.00131862808178 ], [ 20, 32.77540932728773 ], [ 25, 32.84220669608726 ], [ 30, 32.474230737205446 ], [ 35, 32.468094107189344 ], [ 40, 32.698189718063894 ], [ 45, 32.631094469146944 ], [ 50, 32.57328447701532 ], [ 55, 32.47230936951124 ], [ 60, 32.45139881616202 ], [ 65, 31.87964395927387 ], [ 70, 31.67882670480938 ], [ 75, 32.398487248975506 ], [ 80, 32.12095221637246 ], [ 85, 31.98247054965276 ], [ 90, 32.046421590168656 ], [ 95, 31.36837509637659 ], [ 100, 31.855682336946085 ], [ 105, 31.671762889781576 ], [ 110, 31.953685949699786 ], [ 115, 31.751771658878987 ], [ 120, 31.61300613049815 ], [ 125, 31.562663021012362 ], [ 130, 31.642561073794287 ], [ 135, 31.337185081629286 ], [ 140, 31.51714019771191 ], [ 145, 30.949777667426588 ], [ 150, 31.137235824025076 ], [ 155, 30.9823081327662 ], [ 160, 30.81674253092884 ], [ 165, 31.159131938362385 ], [ 170, 30.63239589033796 ], [ 175, 30.889453591894465 ], [ 180, 30.88953731713874 ], [ 185, 30.47384283617537 ], [ 190, 30.163418477266276 ], [ 195, 30.691388931021663 ], [ 200, 29.745688608409285 ], [ 205, 29.607169156414308 ], [ 210, 29.258751448716698 ], [ 215, 28.932790432732492 ], [ 220, 29.383527182249374 ], [ 225, 28.567658698158 ], [ 230, 29.282165622076473 ], [ 235, 28.45999547012429 ], [ 240, 27.191536410147886 ], [ 245, 27.445216901072182 ], [ 250, 27.552371028294356 ], [ 255, 26.60019566029124 ], [ 260, 27.241042485471233 ], [ 265, 26.373360546770982 ], [ 270, 26.44958661297212 ], [ 275, 24.731503085287326 ], [ 280, 25.295225555689125 ], [ 285, 25.391456049123292 ], [ 290, 24.127869345956974 ], [ 295, 24.192410228801137 ], [ 300, 21.24269525474375 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPMS1_R2", "pairs": [ [ 1, 32.64253746814141 ], [ 2, 30.601173127812398 ], [ 3, 33.10531322024804 ], [ 4, 33.36055997951294 ], [ 5, 32.23077204492519 ], [ 6, 33.081179956830844 ], [ 7, 33.13271465678085 ], [ 8, 32.6363425728327 ], [ 9, 33.22749167713376 ], [ 10, 33.239071741277755 ], [ 15, 33.48514810433765 ], [ 20, 32.757274733851204 ], [ 25, 32.87131690304013 ], [ 30, 32.54053144397156 ], [ 35, 33.01964854705203 ], [ 40, 32.93627651520709 ], [ 45, 32.91820243902439 ], [ 50, 32.956049340872354 ], [ 55, 32.84090566456585 ], [ 60, 32.64591033483873 ], [ 65, 32.43733299012986 ], [ 70, 32.10457540263543 ], [ 75, 32.75159081518615 ], [ 80, 32.73881913686445 ], [ 85, 32.66110345954898 ], [ 90, 32.854249905422066 ], [ 95, 32.488240179326034 ], [ 100, 32.59289988605332 ], [ 105, 31.858476919545545 ], [ 110, 32.61061964012086 ], [ 115, 32.61181396484375 ], [ 120, 32.43458451139378 ], [ 125, 32.07314836232622 ], [ 130, 32.45954969831841 ], [ 135, 32.46766533592157 ], [ 140, 32.43762611324236 ], [ 145, 31.97269323662554 ], [ 150, 31.923647218504396 ], [ 155, 31.93432002850585 ], [ 160, 31.71755566684174 ], [ 165, 32.1187807842269 ], [ 170, 31.326597523362928 ], [ 175, 31.87544184447608 ], [ 180, 31.954149552295483 ], [ 185, 31.657203891069507 ], [ 190, 31.307839845377714 ], [ 195, 31.786041265369924 ], [ 200, 31.188348042930834 ], [ 205, 31.119296503268203 ], [ 210, 31.54310455700636 ], [ 215, 31.003673105496297 ], [ 220, 31.419586456511905 ], [ 225, 30.264515776131457 ], [ 230, 31.141518618354134 ], [ 235, 30.448170522917383 ], [ 240, 27.903751895514358 ], [ 245, 29.64524167136898 ], [ 250, 29.765042630388887 ], [ 255, 28.965226005283245 ], [ 260, 29.62093930503558 ], [ 265, 29.217490303581137 ], [ 270, 29.442105350633188 ], [ 275, 27.907817921212757 ], [ 280, 28.61860255593129 ], [ 285, 28.26658429770264 ], [ 290, 26.99224527232846 ], [ 295, 27.540529789950927 ], [ 300, 22.889068003621837 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPMS2_R2", "pairs": [ [ 1, 31.17651803203134 ], [ 2, 32.028908860467794 ], [ 3, 32.49520682106233 ], [ 4, 33.20253485424588 ], [ 5, 32.30124438299343 ], [ 6, 32.67053808042401 ], [ 7, 32.268613895610095 ], [ 8, 32.33116718515958 ], [ 9, 32.741537043438186 ], [ 10, 32.86429773015325 ], [ 15, 32.92986058301648 ], [ 20, 32.71747897223183 ], [ 25, 32.8106556054845 ], [ 30, 32.488749855974184 ], [ 35, 32.503521142988824 ], [ 40, 32.62680529770908 ], [ 45, 32.59082270136778 ], [ 50, 32.475436130251424 ], [ 55, 32.44258060055769 ], [ 60, 32.37915224818325 ], [ 65, 31.886796496888685 ], [ 70, 31.774238303756626 ], [ 75, 32.39288459377191 ], [ 80, 32.17169432918396 ], [ 85, 32.12900367459271 ], [ 90, 32.1387025382115 ], [ 95, 31.542934538286858 ], [ 100, 31.857088515670927 ], [ 105, 31.600853754964426 ], [ 110, 32.01735172874105 ], [ 115, 31.734172597042658 ], [ 120, 31.595392969551636 ], [ 125, 31.420425585792515 ], [ 130, 31.436400548748928 ], [ 135, 31.266835219978987 ], [ 140, 31.438581202481362 ], [ 145, 30.96193331872542 ], [ 150, 31.058470090299966 ], [ 155, 30.84497644661448 ], [ 160, 30.758717383832646 ], [ 165, 31.07241372845386 ], [ 170, 30.603387475605263 ], [ 175, 30.73901686745012 ], [ 180, 30.7233136073892 ], [ 185, 30.373808997596683 ], [ 190, 30.12458312499664 ], [ 195, 30.654272586640808 ], [ 200, 29.599576744599098 ], [ 205, 29.460388215960922 ], [ 210, 29.24480341799086 ], [ 215, 28.820198301292464 ], [ 220, 29.295280654957793 ], [ 225, 28.393393734379053 ], [ 230, 29.11616531368723 ], [ 235, 28.21835182122237 ], [ 240, 27.046947966465734 ], [ 245, 27.31030212814154 ], [ 250, 27.35818975472308 ], [ 255, 26.418086427123672 ], [ 260, 26.950141200444204 ], [ 265, 26.176880615285125 ], [ 270, 26.242926761669402 ], [ 275, 24.59199844718672 ], [ 280, 25.188960191806345 ], [ 285, 25.261038931080307 ], [ 290, 24.01687746168151 ], [ 295, 24.13694969586512 ], [ 300, 21.366254256122872 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVFS1_R2", "pairs": [ [ 1, 31.363299055030573 ], [ 2, 32.20476653696498 ], [ 3, 32.49897165091718 ], [ 4, 33.245344635908836 ], [ 5, 32.333129516397996 ], [ 6, 32.72830739299611 ], [ 7, 32.33164257921067 ], [ 8, 32.423707615341854 ], [ 9, 32.8316564758199 ], [ 10, 32.97389938854919 ], [ 15, 32.99283212896053 ], [ 20, 32.792929405225124 ], [ 25, 32.87974986103391 ], [ 30, 32.48311561978878 ], [ 35, 32.57607837687604 ], [ 40, 32.74185712016155 ], [ 45, 32.65020706523249 ], [ 50, 32.54379221212373 ], [ 55, 32.52260485283082 ], [ 60, 32.425570586616104 ], [ 65, 31.795766771074618 ], [ 70, 31.62702017006607 ], [ 75, 32.41035383717375 ], [ 80, 32.15097071297107 ], [ 85, 32.14726701393763 ], [ 90, 32.14256407405348 ], [ 95, 31.615431954754524 ], [ 100, 31.924347408439882 ], [ 105, 31.69300864537292 ], [ 110, 32.05165877496918 ], [ 115, 31.795496246872393 ], [ 120, 31.57494312612325 ], [ 125, 31.47053126251159 ], [ 130, 31.609472965062274 ], [ 135, 31.386445390963537 ], [ 140, 31.513081343085247 ], [ 145, 31.028815751053266 ], [ 150, 31.154969686856884 ], [ 155, 30.883201128388606 ], [ 160, 30.768506389665287 ], [ 165, 31.158834062149577 ], [ 170, 30.792943055241995 ], [ 175, 30.887174218624693 ], [ 180, 30.917180416138223 ], [ 185, 30.564075422918876 ], [ 190, 30.174093535475276 ], [ 195, 30.740860028795414 ], [ 200, 29.762292185478373 ], [ 205, 29.69731178461859 ], [ 210, 29.608025942664085 ], [ 215, 28.929236632235597 ], [ 220, 29.54579657715319 ], [ 225, 28.607982322777122 ], [ 230, 29.33713312182629 ], [ 235, 28.427205256873304 ], [ 240, 27.30289098331722 ], [ 245, 27.49811286992347 ], [ 250, 27.624855266087728 ], [ 255, 26.713616121131157 ], [ 260, 27.284769539078155 ], [ 265, 26.555456425302378 ], [ 270, 26.54337206874957 ], [ 275, 24.784353621518967 ], [ 280, 25.456227647298537 ], [ 285, 25.531852137085217 ], [ 290, 24.28454758347105 ], [ 295, 24.378565437460868 ], [ 300, 21.651063395266647 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVFS2_R2", "pairs": [ [ 1, 31.005183083047573 ], [ 2, 32.449440305861025 ], [ 3, 32.64962949824603 ], [ 4, 33.24715226045485 ], [ 5, 32.54314965905956 ], [ 6, 32.769441488313426 ], [ 7, 32.44902644751882 ], [ 8, 32.47343423593867 ], [ 9, 32.905699420598324 ], [ 10, 33.02547790784754 ], [ 15, 33.03338063142958 ], [ 20, 32.825915415237866 ], [ 25, 32.907904694336054 ], [ 30, 32.54982854440109 ], [ 35, 32.579164637280186 ], [ 40, 32.77316003665639 ], [ 45, 32.62863167852427 ], [ 50, 32.598224315642184 ], [ 55, 32.489245383417746 ], [ 60, 32.42003383680135 ], [ 65, 31.86906786759561 ], [ 70, 31.64876770105541 ], [ 75, 32.36384965662277 ], [ 80, 32.16190588814979 ], [ 85, 32.08668946984714 ], [ 90, 32.120535199974604 ], [ 95, 31.569130229073846 ], [ 100, 31.891659855648328 ], [ 105, 31.711189606205032 ], [ 110, 32.02849700393295 ], [ 115, 31.81108223684558 ], [ 120, 31.664626883332023 ], [ 125, 31.525142710570815 ], [ 130, 31.63387396865741 ], [ 135, 31.42049357122213 ], [ 140, 31.5389196465896 ], [ 145, 31.027794171958373 ], [ 150, 31.188065587508994 ], [ 155, 30.968503123051885 ], [ 160, 30.829795512651835 ], [ 165, 31.183747979908397 ], [ 170, 30.799364190201175 ], [ 175, 30.902630642738558 ], [ 180, 30.94789880083506 ], [ 185, 30.55375237132987 ], [ 190, 30.230246643130876 ], [ 195, 30.83631227932932 ], [ 200, 29.835836544521243 ], [ 205, 29.809359512305043 ], [ 210, 29.627620993824042 ], [ 215, 29.053626093482983 ], [ 220, 29.598872399879042 ], [ 225, 28.699077489002587 ], [ 230, 29.40381735984979 ], [ 235, 28.567980745365183 ], [ 240, 27.351016447335848 ], [ 245, 27.64647649325251 ], [ 250, 27.723877049829674 ], [ 255, 26.83110538991938 ], [ 260, 27.413649260527627 ], [ 265, 26.704129775981936 ], [ 270, 26.6871372828649 ], [ 275, 24.98844902662487 ], [ 280, 25.570244870845475 ], [ 285, 25.633336794018597 ], [ 290, 24.455569516794775 ], [ 295, 24.434585306468193 ], [ 300, 21.507031476854824 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVMS1_R2", "pairs": [ [ 1, 31.347120144218884 ], [ 2, 32.15968985704725 ], [ 3, 32.411892028771426 ], [ 4, 33.19418904008827 ], [ 5, 32.20065236134307 ], [ 6, 32.662152792432124 ], [ 7, 32.28149211076879 ], [ 8, 32.38753398971416 ], [ 9, 32.79391531360975 ], [ 10, 32.92953773988749 ], [ 15, 32.86634671618664 ], [ 20, 32.68987151737319 ], [ 25, 32.817613756262844 ], [ 30, 32.461712659548176 ], [ 35, 32.46425988718385 ], [ 40, 32.61452486002259 ], [ 45, 32.60736466360358 ], [ 50, 32.404547619765445 ], [ 55, 32.43415116524466 ], [ 60, 32.29974467457173 ], [ 65, 31.836196885005698 ], [ 70, 31.827278311952284 ], [ 75, 32.41291116593963 ], [ 80, 32.170559432383456 ], [ 85, 32.33860491666474 ], [ 90, 32.20440085411313 ], [ 95, 31.81723014608853 ], [ 100, 31.91198441326561 ], [ 105, 31.7045232877907 ], [ 110, 32.07894432462776 ], [ 115, 31.84937506032236 ], [ 120, 31.574453479393885 ], [ 125, 31.25722785675182 ], [ 130, 31.58817587783749 ], [ 135, 31.417424349759052 ], [ 140, 31.481466019199683 ], [ 145, 31.106126109378984 ], [ 150, 31.12345760952858 ], [ 155, 30.881554721940308 ], [ 160, 30.848564771369844 ], [ 165, 31.06087701046127 ], [ 170, 30.57966215671769 ], [ 175, 30.780013377159946 ], [ 180, 30.870283044361155 ], [ 185, 30.421802819223878 ], [ 190, 30.30325852122113 ], [ 195, 30.66350750314735 ], [ 200, 29.734262788331158 ], [ 205, 29.538369800405736 ], [ 210, 29.414685519679175 ], [ 215, 29.12215065182624 ], [ 220, 29.523561716127602 ], [ 225, 28.743844534282893 ], [ 230, 29.35668258991877 ], [ 235, 28.359105597265092 ], [ 240, 27.456312098717707 ], [ 245, 27.543779709234553 ], [ 250, 27.71829875020966 ], [ 255, 26.824079211698187 ], [ 260, 27.216279781938443 ], [ 265, 26.595597870661113 ], [ 270, 26.508252314647017 ], [ 275, 25.02030718096695 ], [ 280, 25.58447472221583 ], [ 285, 25.635319219078735 ], [ 290, 24.40332615507416 ], [ 295, 24.52609037062669 ], [ 300, 22.008787406962586 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVMS2_R2", "pairs": [ [ 1, 31.00576807256968 ], [ 2, 32.45171645173508 ], [ 3, 32.601624249498634 ], [ 4, 33.230008878733884 ], [ 5, 32.435225600556315 ], [ 6, 32.767501350436795 ], [ 7, 32.455087887047604 ], [ 8, 32.47626646135888 ], [ 9, 32.878628328749095 ], [ 10, 33.00700488640809 ], [ 15, 32.96110617848118 ], [ 20, 32.80989947783111 ], [ 25, 32.89249778031653 ], [ 30, 32.52832936998243 ], [ 35, 32.551835292999726 ], [ 40, 32.69412038022888 ], [ 45, 32.7042011673195 ], [ 50, 32.50939968208236 ], [ 55, 32.50875981026734 ], [ 60, 32.407045241550925 ], [ 65, 31.9728031991853 ], [ 70, 31.897033133326214 ], [ 75, 32.471100497397416 ], [ 80, 32.28893568442497 ], [ 85, 32.345949096046105 ], [ 90, 32.28094421667288 ], [ 95, 31.8251546775997 ], [ 100, 32.0306695165447 ], [ 105, 31.78412856894051 ], [ 110, 32.15900012278728 ], [ 115, 31.907019655277896 ], [ 120, 31.735336572254443 ], [ 125, 31.482755680441265 ], [ 130, 31.623237974484994 ], [ 135, 31.52147632591724 ], [ 140, 31.599640226644926 ], [ 145, 31.17284543671563 ], [ 150, 31.247739568577522 ], [ 155, 30.988333535165793 ], [ 160, 30.960289109436467 ], [ 165, 31.179265606836232 ], [ 170, 30.775693599639418 ], [ 175, 30.904938557236658 ], [ 180, 31.055228826803063 ], [ 185, 30.682695060938403 ], [ 190, 30.39731328130596 ], [ 195, 30.869269275493895 ], [ 200, 29.961256863562028 ], [ 205, 29.815482623210123 ], [ 210, 29.667310340104656 ], [ 215, 29.252034423434047 ], [ 220, 29.75042757897915 ], [ 225, 28.852679787375376 ], [ 230, 29.56345806860699 ], [ 235, 28.62854535296655 ], [ 240, 27.543491747620987 ], [ 245, 27.733871267817136 ], [ 250, 27.86065261743631 ], [ 255, 26.998969944267515 ], [ 260, 27.440708351057925 ], [ 265, 26.797958460074273 ], [ 270, 26.70348183725509 ], [ 275, 25.186768560727508 ], [ 280, 25.728568745842505 ], [ 285, 25.80309322371317 ], [ 290, 24.638153077433394 ], [ 295, 24.654668458779582 ], [ 300, 21.92274393253682 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAFS1_R2", "pairs": [ [ 1, 38.85498717184859 ], [ 2, 39.218200167799516 ], [ 3, 39.20351163045196 ], [ 4, 39.375493975024625 ], [ 5, 38.63936479371603 ], [ 6, 37.89491859291594 ], [ 7, 38.701037195559394 ], [ 8, 38.808185698131105 ], [ 9, 39.234323512603204 ], [ 10, 39.133877263165566 ], [ 15, 38.989992825962716 ], [ 20, 39.050799479578316 ], [ 25, 39.14560863802727 ], [ 30, 39.118648849114194 ], [ 35, 39.277640106516216 ], [ 40, 39.205758684840895 ], [ 45, 38.90345204946438 ], [ 50, 39.216213073542455 ], [ 55, 38.96573099628529 ], [ 60, 39.004733677446026 ], [ 65, 39.020686887847226 ], [ 70, 37.79866124354789 ], [ 75, 39.02090575811188 ], [ 80, 38.818781500598845 ], [ 85, 38.99566272092218 ], [ 90, 38.966363288160935 ], [ 95, 37.872425386518806 ], [ 100, 38.81532186478696 ], [ 105, 38.806361867704275 ], [ 110, 39.11113326848249 ], [ 115, 39.10275778210117 ], [ 120, 38.59376945525292 ], [ 125, 38.63206712062257 ], [ 130, 38.892174124513616 ], [ 135, 38.05119649805448 ], [ 140, 37.808205252918285 ], [ 145, 38.53769698443579 ], [ 150, 38.82278453307393 ], [ 155, 38.98773655450864 ], [ 160, 38.25120045720122 ], [ 165, 38.89128703360307 ], [ 170, 38.794472242657115 ], [ 175, 38.83604350707385 ], [ 180, 38.82530657409153 ], [ 185, 38.54509329458472 ], [ 190, 38.19049483520693 ], [ 195, 38.48772913259444 ], [ 200, 37.576702192985124 ], [ 205, 38.50591990466868 ], [ 210, 37.80433003605323 ], [ 215, 38.467422588901925 ], [ 220, 37.799509967837835 ], [ 225, 38.24348153867667 ], [ 230, 38.490827400458414 ], [ 235, 38.12976975784143 ], [ 240, 37.94925795998273 ], [ 245, 37.021798527471596 ], [ 250, 38.304065564600954 ], [ 255, 38.407431951799325 ], [ 260, 37.47224630499942 ], [ 265, 37.56281592178941 ], [ 270, 38.21028094771977 ], [ 275, 37.39646763416606 ], [ 280, 38.05190936228941 ], [ 285, 38.003000991007966 ], [ 290, 37.661600569069606 ], [ 295, 37.90125702759736 ], [ 300, 35.272862282286255 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAFS2_R2", "pairs": [ [ 1, 38.40942207614352 ], [ 2, 39.12096098916148 ], [ 3, 39.075071409007315 ], [ 4, 39.36339946003052 ], [ 5, 38.66215909535548 ], [ 6, 37.9060140079039 ], [ 7, 38.69903353288727 ], [ 8, 38.85492037406581 ], [ 9, 39.30721133153344 ], [ 10, 39.16720741871111 ], [ 15, 39.02224517744649 ], [ 20, 39.04407559572719 ], [ 25, 39.1902774191024 ], [ 30, 39.182752279219 ], [ 35, 39.32899792620417 ], [ 40, 39.29482803145909 ], [ 45, 39.160120514927414 ], [ 50, 39.269407233482966 ], [ 55, 39.02343329368309 ], [ 60, 38.94131346647468 ], [ 65, 39.07540224128216 ], [ 70, 38.96008890001878 ], [ 75, 38.88403556000752 ], [ 80, 38.87275402241282 ], [ 85, 38.89289425906217 ], [ 90, 39.091973956050836 ], [ 95, 37.396606773931005 ], [ 100, 38.30634821260877 ], [ 105, 38.789513554122586 ], [ 110, 39.128685907468856 ], [ 115, 39.08434232767796 ], [ 120, 38.75429787766856 ], [ 125, 38.93420146497214 ], [ 130, 39.123013835848 ], [ 135, 38.151499405246355 ], [ 140, 38.009171727289804 ], [ 145, 38.503806423339384 ], [ 150, 38.91574218994553 ], [ 155, 39.101646528516866 ], [ 160, 38.36518499968697 ], [ 165, 38.91118136855944 ], [ 170, 38.75304576472798 ], [ 175, 38.94054967758092 ], [ 180, 38.75513053277406 ], [ 185, 38.98900018781695 ], [ 190, 37.947110749389594 ], [ 195, 38.82912414699806 ], [ 200, 38.493125899956176 ], [ 205, 38.61526325674576 ], [ 210, 37.55420709948037 ], [ 215, 38.48470544043072 ], [ 220, 38.423721279659425 ], [ 225, 38.17230326175421 ], [ 230, 38.714054967758095 ], [ 235, 38.12394039942403 ], [ 240, 38.50236649345771 ], [ 245, 37.070303011331625 ], [ 250, 38.38387278532524 ], [ 255, 38.570932198084265 ], [ 260, 38.08779815939398 ], [ 265, 37.75973830839543 ], [ 270, 38.48027358881855 ], [ 275, 37.87818209442615 ], [ 280, 38.35633153598736 ], [ 285, 38.443461860526995 ], [ 290, 37.96305867069439 ], [ 295, 38.267461527456376 ], [ 300, 34.829284805683756 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAMS1_R2", "pairs": [ [ 1, 38.96169511632505 ], [ 2, 38.315165095894024 ], [ 3, 38.78499967046728 ], [ 4, 39.25942134053911 ], [ 5, 38.316825940815924 ], [ 6, 38.56447637250379 ], [ 7, 38.49791076253872 ], [ 8, 38.654952876820666 ], [ 9, 39.17951624596322 ], [ 10, 39.05414618071575 ], [ 15, 38.85873591247611 ], [ 20, 38.889991432149216 ], [ 25, 39.11249719897186 ], [ 30, 39.05081921834839 ], [ 35, 39.22015685757596 ], [ 40, 39.18357872536743 ], [ 45, 38.95353061358993 ], [ 50, 39.17932512933785 ], [ 55, 38.89898896695358 ], [ 60, 38.912950977419825 ], [ 65, 38.94781909494747 ], [ 70, 38.22662430961074 ], [ 75, 39.09053952519673 ], [ 80, 38.708498213885555 ], [ 85, 38.89288849636846 ], [ 90, 38.94596839038794 ], [ 95, 37.460806981005234 ], [ 100, 38.397964752250765 ], [ 105, 38.740893452671266 ], [ 110, 39.03546656472852 ], [ 115, 38.9569091652057 ], [ 120, 38.530002768147845 ], [ 125, 38.8239958873232 ], [ 130, 39.01145485941764 ], [ 135, 38.04816049984841 ], [ 140, 37.84289894808995 ], [ 145, 38.43049748227044 ], [ 150, 38.7999604545095 ], [ 155, 38.99750599773272 ], [ 160, 38.19345653950594 ], [ 165, 38.857905143550134 ], [ 170, 38.741267037515485 ], [ 175, 38.83715430650391 ], [ 180, 38.732026574569616 ], [ 185, 38.71868333479967 ], [ 190, 37.97262115829505 ], [ 195, 38.64121853641175 ], [ 200, 37.931090210449305 ], [ 205, 38.44081648794184 ], [ 210, 37.58458242982276 ], [ 215, 38.40292638558425 ], [ 220, 38.0495350078762 ], [ 225, 38.111827475069695 ], [ 230, 38.525259848539775 ], [ 235, 38.02898703558459 ], [ 240, 38.138436492819146 ], [ 245, 36.96280722105416 ], [ 250, 38.25670728894103 ], [ 255, 38.39557614863929 ], [ 260, 37.67552183914107 ], [ 265, 37.406420911793205 ], [ 270, 38.23327511319972 ], [ 275, 37.47045866480363 ], [ 280, 38.080554537187254 ], [ 285, 38.110591740156345 ], [ 290, 37.64377339499488 ], [ 295, 37.962059077104165 ], [ 300, 35.697722461408496 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAMS2_R2", "pairs": [ [ 1, 39.34867774752263 ], [ 2, 38.90939059687617 ], [ 3, 39.10565492869529 ], [ 4, 39.38670692872166 ], [ 5, 38.09482241400909 ], [ 6, 38.84119124695892 ], [ 7, 38.60739881191775 ], [ 8, 38.745195255582736 ], [ 9, 39.22923658132957 ], [ 10, 39.07774752263092 ], [ 15, 38.97301695094051 ], [ 20, 39.02521872713008 ], [ 25, 39.15811515563086 ], [ 30, 39.0270859019074 ], [ 35, 39.26052494511218 ], [ 40, 39.174592709315434 ], [ 45, 38.877469292491085 ], [ 50, 39.171968377763584 ], [ 55, 38.87328445593123 ], [ 60, 38.92706366369534 ], [ 65, 39.00100743710111 ], [ 70, 38.509412237360564 ], [ 75, 39.09717216870727 ], [ 80, 38.64320535896776 ], [ 85, 39.03474757864061 ], [ 90, 38.885266135253275 ], [ 95, 37.65683354101971 ], [ 100, 38.66091505418059 ], [ 105, 38.862859177402974 ], [ 110, 39.109411469940525 ], [ 115, 38.94705471232841 ], [ 120, 38.45813827753089 ], [ 125, 38.83611092796012 ], [ 130, 39.02831221236137 ], [ 135, 38.17417219416349 ], [ 140, 37.87102363762239 ], [ 145, 38.446602709919894 ], [ 150, 38.83423598061517 ], [ 155, 38.782421784854776 ], [ 160, 38.43494543896087 ], [ 165, 38.88949460983088 ], [ 170, 38.75886460290773 ], [ 175, 38.7776692051561 ], [ 180, 38.8433086077869 ], [ 185, 38.82131803646193 ], [ 190, 38.08259519335377 ], [ 195, 38.74375762371015 ], [ 200, 38.201947713711135 ], [ 205, 38.430145386213034 ], [ 210, 37.96884713018825 ], [ 215, 38.42764513895757 ], [ 220, 38.18457785250388 ], [ 225, 38.377931798018466 ], [ 230, 38.59451276201528 ], [ 235, 38.114494827279266 ], [ 240, 38.32355055024034 ], [ 245, 37.08989390812404 ], [ 250, 38.4548802922307 ], [ 255, 38.485369343469976 ], [ 260, 37.8887597998167 ], [ 265, 37.43283243549759 ], [ 270, 38.34895985124719 ], [ 275, 37.65585087794489 ], [ 280, 38.28005354046196 ], [ 285, 38.20079255708455 ], [ 290, 37.804920183831044 ], [ 295, 38.11340730665112 ], [ 300, 35.74135483737 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICFS1_R2", "pairs": [ [ 1, 30.830982996090317 ], [ 2, 32.341336154214524 ], [ 3, 32.44265915702349 ], [ 4, 33.19064534804766 ], [ 5, 32.41431216004689 ], [ 6, 32.682364965799195 ], [ 7, 32.32025102030605 ], [ 8, 32.41143886383292 ], [ 9, 32.82833841997298 ], [ 10, 32.98394099021507 ], [ 15, 32.92875654889964 ], [ 20, 32.77786990115003 ], [ 25, 32.86982109799941 ], [ 30, 32.554820633411715 ], [ 35, 32.52930441338375 ], [ 40, 32.6972597058074 ], [ 45, 32.60561572441374 ], [ 50, 32.5540890080429 ], [ 55, 32.48641429848078 ], [ 60, 32.38527685433423 ], [ 65, 31.780142243438473 ], [ 70, 31.702023249495973 ], [ 75, 32.38876560332871 ], [ 80, 32.133838990998456 ], [ 85, 32.16119555132699 ], [ 90, 32.13115651900363 ], [ 95, 31.51669431177968 ], [ 100, 31.865856378871506 ], [ 105, 31.716171584739055 ], [ 110, 32.04095462117583 ], [ 115, 31.764833734905302 ], [ 120, 31.579630518343237 ], [ 125, 31.31615130808741 ], [ 130, 31.617267475252145 ], [ 135, 31.359479732000487 ], [ 140, 31.53291717613746 ], [ 145, 31.01936319141968 ], [ 150, 31.12934234194959 ], [ 155, 31.022240965391724 ], [ 160, 30.877651727788134 ], [ 165, 31.058651047365675 ], [ 170, 30.479442172467866 ], [ 175, 30.871237618451637 ], [ 180, 30.84254747005185 ], [ 185, 30.234893120070826 ], [ 190, 30.172912583861415 ], [ 195, 30.73413964266812 ], [ 200, 29.585630909637086 ], [ 205, 29.572253136309666 ], [ 210, 29.238877365642924 ], [ 215, 29.073363182513912 ], [ 220, 29.357178823293804 ], [ 225, 28.59545990378866 ], [ 230, 29.282611276813366 ], [ 235, 28.415043380612122 ], [ 240, 27.243802616426695 ], [ 245, 27.626838043330544 ], [ 250, 27.578516146389045 ], [ 255, 26.629072728313112 ], [ 260, 27.22371252002747 ], [ 265, 26.614321068894487 ], [ 270, 26.61311986900729 ], [ 275, 24.893871295218094 ], [ 280, 25.532674804765776 ], [ 285, 25.572994549122278 ], [ 290, 24.340166130035836 ], [ 295, 24.346501521775824 ], [ 300, 21.655688000848496 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICFS2_R2", "pairs": [ [ 1, 31.16161697990927 ], [ 2, 32.11589204703268 ], [ 3, 32.443367512267386 ], [ 4, 33.17990811036015 ], [ 5, 32.08742246088325 ], [ 6, 32.61312031293399 ], [ 7, 32.230389547264146 ], [ 8, 32.294718081659106 ], [ 9, 32.70882325710583 ], [ 10, 32.871106841959076 ], [ 15, 32.779163966299414 ], [ 20, 32.63419475048607 ], [ 25, 32.76552518285344 ], [ 30, 32.50859179705583 ], [ 35, 32.49655436711425 ], [ 40, 32.528241197220595 ], [ 45, 32.55796692167915 ], [ 50, 32.3528130461453 ], [ 55, 32.41750905660815 ], [ 60, 32.25967060566429 ], [ 65, 31.791020937257674 ], [ 70, 31.863955259256016 ], [ 75, 32.414738596511526 ], [ 80, 32.18512598525446 ], [ 85, 32.32502576532612 ], [ 90, 32.218199600682894 ], [ 95, 31.83095575682167 ], [ 100, 31.87391393775986 ], [ 105, 31.776621347085484 ], [ 110, 32.11266343699536 ], [ 115, 31.75472093440526 ], [ 120, 31.40976997820774 ], [ 125, 31.062917035642595 ], [ 130, 31.641492266268067 ], [ 135, 31.42058275355104 ], [ 140, 31.475344685875694 ], [ 145, 31.10141810309899 ], [ 150, 31.056292548511095 ], [ 155, 30.850366837209343 ], [ 160, 30.88517049904284 ], [ 165, 30.882362408025976 ], [ 170, 30.50187276758578 ], [ 175, 30.743684981388107 ], [ 180, 30.86479717955991 ], [ 185, 30.148898855234222 ], [ 190, 30.180555024809944 ], [ 195, 30.55141882776629 ], [ 200, 29.539686068796208 ], [ 205, 29.34948035179749 ], [ 210, 29.122903313589596 ], [ 215, 29.00993092587124 ], [ 220, 29.372497727443793 ], [ 225, 28.595863117870827 ], [ 230, 29.258871215235757 ], [ 235, 28.174953704589775 ], [ 240, 27.40534458997788 ], [ 245, 27.396516462263605 ], [ 250, 27.504883669758772 ], [ 255, 26.523400386802393 ], [ 260, 26.957024400977428 ], [ 265, 26.467731990259516 ], [ 270, 26.37988377916411 ], [ 275, 24.820925473002966 ], [ 280, 25.334240217704924 ], [ 285, 25.361986575281115 ], [ 290, 24.064786783365527 ], [ 295, 24.266582942534757 ], [ 300, 21.746336860010498 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICMS1_R2", "pairs": [ [ 1, 30.79950430271402 ], [ 2, 32.369674204754794 ], [ 3, 32.40426012305198 ], [ 4, 33.18265367385582 ], [ 5, 32.42209701504026 ], [ 6, 32.70983748723554 ], [ 7, 32.32154127988424 ], [ 8, 32.42226635262242 ], [ 9, 32.82018401350596 ], [ 10, 32.963903385212205 ], [ 15, 32.77122184762696 ], [ 20, 32.749195646484715 ], [ 25, 32.83352063096209 ], [ 30, 32.62052063609353 ], [ 35, 32.52489283402989 ], [ 40, 32.61981718779582 ], [ 45, 32.67153442737358 ], [ 50, 32.566247934562846 ], [ 55, 32.53329741268717 ], [ 60, 32.54000431047754 ], [ 65, 31.820633845459117 ], [ 70, 31.79856420045773 ], [ 75, 32.443231873111465 ], [ 80, 32.2953320953379 ], [ 85, 32.31750381187324 ], [ 90, 32.27499358546723 ], [ 95, 31.45562477549135 ], [ 100, 32.023718376353465 ], [ 105, 31.814224867860624 ], [ 110, 32.20158156719865 ], [ 115, 31.93848143358581 ], [ 120, 31.722178089783853 ], [ 125, 30.76132150994519 ], [ 130, 31.366845249091693 ], [ 135, 31.095932631319663 ], [ 140, 31.64609992405115 ], [ 145, 30.928358683827003 ], [ 150, 31.205032150133167 ], [ 155, 31.107301903349462 ], [ 160, 31.097723062396405 ], [ 165, 31.075145335127765 ], [ 170, 30.196748996613497 ], [ 175, 30.874420752828883 ], [ 180, 30.530042764931693 ], [ 185, 30.3124617649156 ], [ 190, 30.31027199014677 ], [ 195, 30.66602175921174 ], [ 200, 29.796227034794207 ], [ 205, 29.54736734065483 ], [ 210, 29.104608436826442 ], [ 215, 28.930515241711998 ], [ 220, 29.18731294262547 ], [ 225, 28.439800453615998 ], [ 230, 29.1460099149124 ], [ 235, 28.17583060485071 ], [ 240, 27.085496104855842 ], [ 245, 27.735215387615597 ], [ 250, 27.521517207402315 ], [ 255, 26.24881914009176 ], [ 260, 26.87167065247514 ], [ 265, 26.410569867707192 ], [ 270, 26.440374294327274 ], [ 275, 24.70100977893835 ], [ 280, 25.374987747980963 ], [ 285, 25.463571643625702 ], [ 290, 24.477360170835777 ], [ 295, 24.272527718293734 ], [ 300, 21.500865905551116 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICMS2_R2", "pairs": [ [ 1, 31.12517407392671 ], [ 2, 32.088903035849285 ], [ 3, 32.30952930410218 ], [ 4, 33.16860701070306 ], [ 5, 32.034082680141644 ], [ 6, 32.55554848207536 ], [ 7, 32.1998488043608 ], [ 8, 32.242995265189194 ], [ 9, 32.62780408228226 ], [ 10, 32.82677117733657 ], [ 15, 32.638099709545216 ], [ 20, 32.55943659730235 ], [ 25, 32.67923288107269 ], [ 30, 32.53535511081049 ], [ 35, 32.366785145906384 ], [ 40, 32.48460480208002 ], [ 45, 32.518370276798215 ], [ 50, 32.400961316558046 ], [ 55, 32.404033073109396 ], [ 60, 32.371900589681765 ], [ 65, 31.632000381980088 ], [ 70, 31.450978426082873 ], [ 75, 32.334573177039815 ], [ 80, 32.07713928744798 ], [ 85, 32.27698808699597 ], [ 90, 32.0030256006239 ], [ 95, 31.650765153866352 ], [ 100, 31.73515887984339 ], [ 105, 31.565672722642667 ], [ 110, 31.997192446343735 ], [ 115, 31.662668608398786 ], [ 120, 31.35947827886138 ], [ 125, 29.736979651602326 ], [ 130, 30.789979232606452 ], [ 135, 30.633783224574252 ], [ 140, 31.169294922807573 ], [ 145, 30.62056627802962 ], [ 150, 30.851634210589147 ], [ 155, 30.726679771122974 ], [ 160, 30.711002172580912 ], [ 165, 30.70930230707402 ], [ 170, 29.96937695472596 ], [ 175, 30.562860803616196 ], [ 180, 30.38771894920299 ], [ 185, 29.8467001771154 ], [ 190, 29.811042847138218 ], [ 195, 30.233828866110656 ], [ 200, 29.026499331508244 ], [ 205, 29.166602428537082 ], [ 210, 28.357989733794916 ], [ 215, 28.471685169710714 ], [ 220, 28.48755083363177 ], [ 225, 27.655989684647853 ], [ 230, 28.432174065227503 ], [ 235, 27.460789010831586 ], [ 240, 26.395438432001487 ], [ 245, 27.13844327506659 ], [ 250, 26.758603729436764 ], [ 255, 25.45755378206463 ], [ 260, 25.90832570614499 ], [ 265, 25.61891330473469 ], [ 270, 25.55022153552813 ], [ 275, 24.043123838430265 ], [ 280, 24.559159180985205 ], [ 285, 24.680117233703967 ], [ 290, 23.943768090726312 ], [ 295, 23.575881974999195 ], [ 300, 21.3488742906732 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPFS1_R2", "pairs": [ [ 1, 31.348442489531692 ], [ 2, 32.00475888719077 ], [ 3, 32.468309290391524 ], [ 4, 33.20267516556703 ], [ 5, 32.40066599570085 ], [ 6, 32.70457623538475 ], [ 7, 32.26233520955257 ], [ 8, 32.37324958685901 ], [ 9, 32.78881350877847 ], [ 10, 32.979762925410974 ], [ 15, 32.987334898920246 ], [ 20, 32.7890781675178 ], [ 25, 32.85880766889079 ], [ 30, 32.43348616443633 ], [ 35, 32.458376511226255 ], [ 40, 32.726178197870766 ], [ 45, 32.63064650405696 ], [ 50, 32.62852421128493 ], [ 55, 32.525238882192866 ], [ 60, 32.45895823755266 ], [ 65, 31.74388474011854 ], [ 70, 31.434200304957663 ], [ 75, 32.381563905663654 ], [ 80, 32.05950073311961 ], [ 85, 31.931181986696004 ], [ 90, 32.027396477276255 ], [ 95, 31.300494050905332 ], [ 100, 31.84652136635312 ], [ 105, 31.582956621146415 ], [ 110, 31.946691601327085 ], [ 115, 31.707520254485807 ], [ 120, 31.51246029891947 ], [ 125, 31.55985059379035 ], [ 130, 31.502888363822002 ], [ 135, 31.205793211429853 ], [ 140, 31.431286075540395 ], [ 145, 30.863949001845327 ], [ 150, 31.005502432477773 ], [ 155, 30.998670678798515 ], [ 160, 30.700904069243627 ], [ 165, 30.957428590956823 ], [ 170, 30.297822020914214 ], [ 175, 30.745616324298794 ], [ 180, 30.863561659362016 ], [ 185, 30.26113075302758 ], [ 190, 30.12548264227617 ], [ 195, 30.7050050640934 ], [ 200, 29.58254969335827 ], [ 205, 29.369333889731372 ], [ 210, 28.990874576692455 ], [ 215, 29.119488644852147 ], [ 220, 29.338294434916612 ], [ 225, 28.55690602865908 ], [ 230, 29.262997576586095 ], [ 235, 28.493737649909896 ], [ 240, 27.186795501149568 ], [ 245, 27.463325669545764 ], [ 250, 27.576118809420244 ], [ 255, 26.622798732368114 ], [ 260, 27.304357173926554 ], [ 265, 26.423405207232957 ], [ 270, 26.53624997402131 ], [ 275, 24.748759071175535 ], [ 280, 25.298615994365566 ], [ 285, 25.420602827918163 ], [ 290, 24.014606932129272 ], [ 295, 24.142513185469983 ], [ 300, 21.253775236929137 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPFS2_R2", "pairs": [ [ 1, 31.005641007360936 ], [ 2, 32.60948722975743 ], [ 3, 32.54901794784964 ], [ 4, 33.270665870568735 ], [ 5, 32.32401037303723 ], [ 6, 32.759807154187534 ], [ 7, 32.43105583973479 ], [ 8, 32.451467731299125 ], [ 9, 32.882857753934445 ], [ 10, 32.98998164221933 ], [ 15, 32.9075801593384 ], [ 20, 32.74870247919154 ], [ 25, 32.917029069456575 ], [ 30, 32.66465146951361 ], [ 35, 32.64288858787673 ], [ 40, 32.64245136816658 ], [ 45, 32.67560587629831 ], [ 50, 32.512691649984404 ], [ 55, 32.44396282070705 ], [ 60, 32.37285341270619 ], [ 65, 31.91575753254971 ], [ 70, 32.07431159491821 ], [ 75, 32.49685284616241 ], [ 80, 32.2497422301437 ], [ 85, 32.43358538487245 ], [ 90, 32.33005413835357 ], [ 95, 32.096419739333854 ], [ 100, 31.976387948249602 ], [ 105, 31.921301672318293 ], [ 110, 32.24774818531408 ], [ 115, 31.966484121219686 ], [ 120, 31.54248793551348 ], [ 125, 31.194062000098036 ], [ 130, 31.81330230574138 ], [ 135, 31.59083313652709 ], [ 140, 31.618978954357296 ], [ 145, 31.314950293426968 ], [ 150, 31.231190150478795 ], [ 155, 31.005905834955293 ], [ 160, 31.05231246657768 ], [ 165, 31.011619595925385 ], [ 170, 30.65927081198143 ], [ 175, 30.893528033010416 ], [ 180, 30.981519869526856 ], [ 185, 30.323462940689474 ], [ 190, 30.519593426376485 ], [ 195, 30.836481115091885 ], [ 200, 29.86676678059454 ], [ 205, 29.600145421021757 ], [ 210, 29.466300966980082 ], [ 215, 29.338153379974152 ], [ 220, 29.66368967514817 ], [ 225, 28.967179274904982 ], [ 230, 29.525053140053565 ], [ 235, 28.515570353029194 ], [ 240, 27.86108927568781 ], [ 245, 27.813988930777253 ], [ 250, 27.936496350364962 ], [ 255, 27.010081726870048 ], [ 260, 27.429255902248606 ], [ 265, 26.818567239735124 ], [ 270, 26.739940209602082 ], [ 275, 25.266648156805985 ], [ 280, 25.808817228612288 ], [ 285, 25.83974510050445 ], [ 290, 24.429886380179163 ], [ 295, 24.736531355729905 ], [ 300, 22.101989642441524 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPMS1_R2", "pairs": [ [ 1, 31.364326018990106 ], [ 2, 32.2456797943076 ], [ 3, 32.26927137109952 ], [ 4, 33.220390503211775 ], [ 5, 32.019224373045965 ], [ 6, 32.61523488904121 ], [ 7, 32.22757469798328 ], [ 8, 32.31623471840212 ], [ 9, 32.75580389809087 ], [ 10, 32.90020852674839 ], [ 15, 32.75001431633016 ], [ 20, 32.64149826902553 ], [ 25, 32.804940435389966 ], [ 30, 32.60661790437848 ], [ 35, 32.52363293507906 ], [ 40, 32.586092027253926 ], [ 45, 32.33105770065076 ], [ 50, 32.447876487495805 ], [ 55, 32.397023265499726 ], [ 60, 32.370613857491584 ], [ 65, 31.64808415377674 ], [ 70, 31.303445056070416 ], [ 75, 32.40710752980512 ], [ 80, 32.09488099267287 ], [ 85, 32.43946874016927 ], [ 90, 32.08579518831961 ], [ 95, 31.97480896159564 ], [ 100, 31.70965170560707 ], [ 105, 31.704126776613776 ], [ 110, 32.06010551220274 ], [ 115, 31.699967605902668 ], [ 120, 31.281082081673855 ], [ 125, 30.114818896225792 ], [ 130, 30.92038491240553 ], [ 135, 30.97137510448573 ], [ 140, 31.2638449012411 ], [ 145, 30.975755261886786 ], [ 150, 31.02517007589782 ], [ 155, 30.934181928344287 ], [ 160, 30.837431954785 ], [ 165, 30.901574078894846 ], [ 170, 30.365422421828914 ], [ 175, 30.71255857273432 ], [ 180, 30.846641527161665 ], [ 185, 29.924355565210647 ], [ 190, 29.895699083354305 ], [ 195, 30.325408354231932 ], [ 200, 29.177372822279494 ], [ 205, 29.268982433608993 ], [ 210, 28.461357121576317 ], [ 215, 28.817802422212385 ], [ 220, 28.612675107096265 ], [ 225, 27.842052639573115 ], [ 230, 28.690099997975164 ], [ 235, 27.598394015741654 ], [ 240, 26.61923999224777 ], [ 245, 27.37006424515558 ], [ 250, 27.103171182533185 ], [ 255, 25.759501543214345 ], [ 260, 26.076980795876278 ], [ 265, 25.808654727847575 ], [ 270, 25.612591322014644 ], [ 275, 24.365295980566913 ], [ 280, 24.703880824749543 ], [ 285, 24.689906389678576 ], [ 290, 24.04082089884285 ], [ 295, 23.76247390303691 ], [ 300, 21.539525353328134 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPMS2_R2", "pairs": [ [ 1, 31.022794964131936 ], [ 2, 32.41875709269979 ], [ 3, 32.503869490226926 ], [ 4, 33.221111971453034 ], [ 5, 32.351576678998235 ], [ 6, 32.690227744798 ], [ 7, 32.38031619614157 ], [ 8, 32.41141550827772 ], [ 9, 32.82176173444932 ], [ 10, 32.922186579485356 ], [ 15, 32.87162059740505 ], [ 20, 32.72051423865885 ], [ 25, 32.854189250642186 ], [ 30, 32.56290451433698 ], [ 35, 32.54469563410874 ], [ 40, 32.613504146045685 ], [ 45, 32.549534594080825 ], [ 50, 32.48240388712268 ], [ 55, 32.43768197336475 ], [ 60, 32.34570214718523 ], [ 65, 31.854731304821637 ], [ 70, 31.771462609598235 ], [ 75, 32.43629786222889 ], [ 80, 32.214216910157134 ], [ 85, 32.3477280455579 ], [ 90, 32.246278140811604 ], [ 95, 31.949207857918346 ], [ 100, 31.901997479338217 ], [ 105, 31.85073171531112 ], [ 110, 32.15672719227807 ], [ 115, 31.85873469789089 ], [ 120, 31.57332885400108 ], [ 125, 31.00328985103489 ], [ 130, 31.49837596892873 ], [ 135, 31.32911456711624 ], [ 140, 31.513569918552626 ], [ 145, 31.13705559198781 ], [ 150, 31.09545787441341 ], [ 155, 30.955332125732895 ], [ 160, 30.98678575818413 ], [ 165, 31.054273773917323 ], [ 170, 30.355161412458102 ], [ 175, 30.825836955942787 ], [ 180, 31.04325856534295 ], [ 185, 30.327805163897615 ], [ 190, 30.17336747864211 ], [ 195, 30.719505029603983 ], [ 200, 29.675687857245293 ], [ 205, 29.52207872028322 ], [ 210, 29.181014857367632 ], [ 215, 29.201391495324806 ], [ 220, 29.43885943274849 ], [ 225, 28.582160213433973 ], [ 230, 29.328863812368628 ], [ 235, 28.405009567593925 ], [ 240, 27.499126829008457 ], [ 245, 27.812623487521154 ], [ 250, 27.784083667446673 ], [ 255, 26.80399177224526 ], [ 260, 27.231151940798775 ], [ 265, 26.65652914437071 ], [ 270, 26.657011735396317 ], [ 275, 25.138714530563718 ], [ 280, 25.70154982203814 ], [ 285, 25.718977662157407 ], [ 290, 24.442965023367826 ], [ 295, 24.581587164004112 ], [ 300, 21.618577760873443 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVFS1_R2", "pairs": [ [ 1, 31.14006106323408 ], [ 2, 32.49083833093827 ], [ 3, 32.424367637359516 ], [ 4, 33.26841615598642 ], [ 5, 32.1629444883661 ], [ 6, 32.6701449705822 ], [ 7, 32.36520880743242 ], [ 8, 32.3570015243969 ], [ 9, 32.7924417868203 ], [ 10, 33.03363719353726 ], [ 15, 32.78016100077312 ], [ 20, 32.6680038262799 ], [ 25, 32.864278881643024 ], [ 30, 32.67035637691478 ], [ 35, 32.587170605783975 ], [ 40, 32.63699610820161 ], [ 45, 32.433834622591654 ], [ 50, 32.561910862150526 ], [ 55, 32.49560017646468 ], [ 60, 32.4548324677537 ], [ 65, 31.720503535845484 ], [ 70, 31.40250282823959 ], [ 75, 32.46601875592402 ], [ 80, 32.12396702938178 ], [ 85, 32.46142768808319 ], [ 90, 32.15609378958495 ], [ 95, 31.775619600066392 ], [ 100, 31.738480892123157 ], [ 105, 31.773395300890638 ], [ 110, 32.091930094305425 ], [ 115, 31.78730189482668 ], [ 120, 31.471541391480592 ], [ 125, 31.205859279449278 ], [ 130, 31.578622846559732 ], [ 135, 31.344083936121887 ], [ 140, 31.55170615368487 ], [ 145, 31.186726421357935 ], [ 150, 31.286458105829627 ], [ 155, 31.200532031065723 ], [ 160, 31.013923663588635 ], [ 165, 31.11372884761547 ], [ 170, 30.692626695903623 ], [ 175, 30.837146077035307 ], [ 180, 30.84842880480837 ], [ 185, 30.056245904933302 ], [ 190, 30.279329413717488 ], [ 195, 30.609782732141138 ], [ 200, 29.426320249504222 ], [ 205, 29.551104685193117 ], [ 210, 28.64462858291036 ], [ 215, 28.846955017603324 ], [ 220, 28.72251740676352 ], [ 225, 27.821445482104014 ], [ 230, 28.653693204154912 ], [ 235, 27.702974656451204 ], [ 240, 26.65445150130605 ], [ 245, 27.469639284684668 ], [ 250, 27.136544156831224 ], [ 255, 25.762784907440572 ], [ 260, 26.075511719534887 ], [ 265, 25.792696585041977 ], [ 270, 25.558199306350296 ], [ 275, 24.35456594477011 ], [ 280, 24.678374698803815 ], [ 285, 24.667280163404357 ], [ 290, 23.92577842512916 ], [ 295, 23.701514476208494 ], [ 300, 21.494872572289275 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVFS2_R2", "pairs": [ [ 1, 31.05904881494271 ], [ 2, 32.45933134515774 ], [ 3, 32.71726573536336 ], [ 4, 33.23413121958876 ], [ 5, 32.65366504473395 ], [ 6, 32.83369172814315 ], [ 7, 32.40225239365876 ], [ 8, 32.536799560508555 ], [ 9, 32.98075655313138 ], [ 10, 33.0019886987914 ], [ 15, 33.02225396327107 ], [ 20, 32.86347512164495 ], [ 25, 32.93894992936744 ], [ 30, 32.58681054779469 ], [ 35, 32.569194788887145 ], [ 40, 32.83596746148008 ], [ 45, 32.75830122957716 ], [ 50, 32.73389750675124 ], [ 55, 32.63077780568988 ], [ 60, 32.58747880424543 ], [ 65, 31.970098285498967 ], [ 70, 31.635863216730513 ], [ 75, 32.489171324499154 ], [ 80, 32.27276304477432 ], [ 85, 32.099005129230946 ], [ 90, 32.11589260480453 ], [ 95, 31.554507772020724 ], [ 100, 32.01130475741875 ], [ 105, 31.7156932014445 ], [ 110, 32.07755691631339 ], [ 115, 31.843093107238182 ], [ 120, 31.690881523181055 ], [ 125, 31.728369106125076 ], [ 130, 31.658907844294657 ], [ 135, 31.393903137929136 ], [ 140, 31.615004278637436 ], [ 145, 31.046798087566827 ], [ 150, 31.231186163907143 ], [ 155, 31.204483643346624 ], [ 160, 30.88503328727547 ], [ 165, 31.175967215173976 ], [ 170, 30.56514257002889 ], [ 175, 31.00242902901645 ], [ 180, 31.190930264802375 ], [ 185, 30.512623554442463 ], [ 190, 30.29803176497374 ], [ 195, 31.00509527136834 ], [ 200, 29.82685027439096 ], [ 205, 29.653248333634288 ], [ 210, 29.257698256302355 ], [ 215, 29.457874630515317 ], [ 220, 29.698971516502844 ], [ 225, 28.888519545901307 ], [ 230, 29.622736908220144 ], [ 235, 28.912252492737696 ], [ 240, 27.552951244406064 ], [ 245, 27.86816204757792 ], [ 250, 27.97334223129466 ], [ 255, 27.070638297872335 ], [ 260, 27.786048520059673 ], [ 265, 26.876531365313657 ], [ 270, 26.96144915983312 ], [ 275, 25.21642286964407 ], [ 280, 25.770259782307896 ], [ 285, 25.892957570163823 ], [ 290, 24.441103815280005 ], [ 295, 24.563830131555118 ], [ 300, 21.673773991472274 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVMS1_R2", "pairs": [ [ 1, 31.107776760035613 ], [ 2, 32.26452257572749 ], [ 3, 32.33311768586783 ], [ 4, 33.21002568553475 ], [ 5, 32.07332227339401 ], [ 6, 32.58037138336782 ], [ 7, 32.27465587148265 ], [ 8, 32.25054605781487 ], [ 9, 32.72245530652899 ], [ 10, 32.9617355991263 ], [ 15, 32.77054298323715 ], [ 20, 32.61217148457266 ], [ 25, 32.79671916935158 ], [ 30, 32.519230843138885 ], [ 35, 32.39158755858446 ], [ 40, 32.5504047445378 ], [ 45, 32.410925048046124 ], [ 50, 32.458466367713 ], [ 55, 32.36625752722614 ], [ 60, 32.2349865470852 ], [ 65, 31.54419474695708 ], [ 70, 31.515614916491813 ], [ 75, 32.29698332468498 ], [ 80, 32.00377537533434 ], [ 85, 32.29741354461911 ], [ 90, 32.148815330533445 ], [ 95, 31.676974329077268 ], [ 100, 31.799164562256017 ], [ 105, 31.516293164200142 ], [ 110, 31.925336664744698 ], [ 115, 31.550722019347813 ], [ 120, 31.152899669345356 ], [ 125, 30.417016042232586 ], [ 130, 31.103339901830218 ], [ 135, 31.03146598669964 ], [ 140, 31.13057929602911 ], [ 145, 30.740446407362505 ], [ 150, 30.823334969933068 ], [ 155, 30.647067848621454 ], [ 160, 30.558876611890174 ], [ 165, 30.667983951598433 ], [ 170, 30.19049914117979 ], [ 175, 30.454127811212164 ], [ 180, 30.312685624923894 ], [ 185, 29.61698864672576 ], [ 190, 29.800180741424395 ], [ 195, 30.21308504439643 ], [ 200, 28.807938573159085 ], [ 205, 29.07054570089101 ], [ 210, 28.423424901616436 ], [ 215, 28.199506479855405 ], [ 220, 28.422057630638687 ], [ 225, 27.617041424835225 ], [ 230, 28.471303400314078 ], [ 235, 27.439626958946253 ], [ 240, 26.42193378841778 ], [ 245, 26.942022241451145 ], [ 250, 26.57882767682595 ], [ 255, 25.601148606971595 ], [ 260, 26.070805637991707 ], [ 265, 25.562765923352536 ], [ 270, 25.48605535790925 ], [ 275, 24.048562417183568 ], [ 280, 24.57962822895968 ], [ 285, 24.631172310168502 ], [ 290, 23.711257063071134 ], [ 295, 23.56420291679625 ], [ 300, 21.1620172797811 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVMS2_R2", "pairs": [ [ 1, 31.030837365701633 ], [ 2, 32.382633022590376 ], [ 3, 32.56185242898931 ], [ 4, 33.214813599788584 ], [ 5, 32.514922040879554 ], [ 6, 32.75836773376345 ], [ 7, 32.36099948057629 ], [ 8, 32.45636385175465 ], [ 9, 32.900343548666356 ], [ 10, 32.90192551281701 ], [ 15, 32.9239108049245 ], [ 20, 32.75098280434129 ], [ 25, 32.87404795101014 ], [ 30, 32.58321076756244 ], [ 35, 32.5111603196734 ], [ 40, 32.729230797269835 ], [ 45, 32.62375862288927 ], [ 50, 32.611859263511846 ], [ 55, 32.53775116870336 ], [ 60, 32.46858944567466 ], [ 65, 31.840524162315358 ], [ 70, 31.603147525447206 ], [ 75, 32.394630799092376 ], [ 80, 32.218063529223315 ], [ 85, 32.17365082350481 ], [ 90, 32.18142069531143 ], [ 95, 31.59338952932064 ], [ 100, 31.945049437280723 ], [ 105, 31.607091629835516 ], [ 110, 32.06361689524765 ], [ 115, 31.80511778375177 ], [ 120, 31.66647651159612 ], [ 125, 31.47696541668565 ], [ 130, 31.418654030163577 ], [ 135, 31.322666423656994 ], [ 140, 31.50580490041702 ], [ 145, 30.954706836531976 ], [ 150, 31.107031549018537 ], [ 155, 31.07950133960304 ], [ 160, 30.805850511236265 ], [ 165, 31.03564443637733 ], [ 170, 30.385585010890065 ], [ 175, 30.847387750266556 ], [ 180, 30.966148742857666 ], [ 185, 30.299782198609353 ], [ 190, 30.13252895664932 ], [ 195, 30.895085343515625 ], [ 200, 29.5643425405302 ], [ 205, 29.477843492841714 ], [ 210, 29.127017396772168 ], [ 215, 29.182017869630073 ], [ 220, 29.398128149748015 ], [ 225, 28.574343994714233 ], [ 230, 29.37627631459036 ], [ 235, 28.577719857832864 ], [ 240, 27.083315410553173 ], [ 245, 27.61645858015128 ], [ 250, 27.622805066982597 ], [ 255, 26.7075869867572 ], [ 260, 27.36150298920968 ], [ 265, 26.49792578011082 ], [ 270, 26.698134027197533 ], [ 275, 25.07082079506339 ], [ 280, 25.671072415305268 ], [ 285, 25.750527577852665 ], [ 290, 24.460255442797358 ], [ 295, 24.53704506272656 ], [ 300, 21.54396315607207 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAFS1_R2", "pairs": [ [ 1, 39.125949988668125 ], [ 2, 38.64174661932462 ], [ 3, 39.238316839162955 ], [ 4, 39.19661554732946 ], [ 5, 38.55671224597719 ], [ 6, 38.021696759084385 ], [ 7, 38.59261161894689 ], [ 8, 38.77313590692755 ], [ 9, 39.21994409609428 ], [ 10, 39.150333157059755 ], [ 15, 38.988290398126466 ], [ 20, 38.99696910176022 ], [ 25, 39.16695323713832 ], [ 30, 38.94414746543778 ], [ 35, 39.28214456348279 ], [ 40, 39.21334451419894 ], [ 45, 39.026757020148224 ], [ 50, 39.23412568729579 ], [ 55, 38.97826060679318 ], [ 60, 38.835990571739394 ], [ 65, 38.997739634957085 ], [ 70, 38.87008944760063 ], [ 75, 39.094886981747855 ], [ 80, 38.66710383174181 ], [ 85, 38.942473328919284 ], [ 90, 38.86933607325254 ], [ 95, 37.58366927563385 ], [ 100, 38.448073494303586 ], [ 105, 38.76055725121634 ], [ 110, 39.080698679399234 ], [ 115, 38.98620388764242 ], [ 120, 38.70276061105152 ], [ 125, 38.931675254227045 ], [ 130, 39.050939947808004 ], [ 135, 38.12931603720129 ], [ 140, 38.20808244120247 ], [ 145, 38.5083046237534 ], [ 150, 38.795092172861885 ], [ 155, 39.00116651556362 ], [ 160, 38.454977334542164 ], [ 165, 38.88121486854034 ], [ 170, 38.76275007555152 ], [ 175, 38.9166817769719 ], [ 180, 38.70209126624358 ], [ 185, 38.975624828342454 ], [ 190, 38.01945919809004 ], [ 195, 38.923062277593516 ], [ 200, 38.54483639193406 ], [ 205, 38.64346512137444 ], [ 210, 37.870397932894626 ], [ 215, 38.51790358041387 ], [ 220, 38.49268126836861 ], [ 225, 38.271531214348855 ], [ 230, 38.75047711149223 ], [ 235, 38.22084482354808 ], [ 240, 38.5331862585846 ], [ 245, 37.13243829282482 ], [ 250, 38.42634048308011 ], [ 255, 38.509199978845416 ], [ 260, 38.04020882599597 ], [ 265, 37.59039581743591 ], [ 270, 38.47913628842768 ], [ 275, 37.734173529688135 ], [ 280, 38.31253352674962 ], [ 285, 38.40976752268486 ], [ 290, 37.944456281118484 ], [ 295, 38.254179365527285 ], [ 300, 34.54381064982604 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAFS2_R2", "pairs": [ [ 1, 38.5863884300467 ], [ 2, 38.732248749242416 ], [ 3, 39.25755505115925 ], [ 4, 39.40857288856671 ], [ 5, 38.51064183769267 ], [ 6, 38.542157363723874 ], [ 7, 38.74717465448193 ], [ 8, 38.89206051171137 ], [ 9, 39.32096638106216 ], [ 10, 39.23083102591831 ], [ 15, 39.084956446303586 ], [ 20, 39.13350841958906 ], [ 25, 39.20093168070922 ], [ 30, 39.07820176116174 ], [ 35, 39.30943445554908 ], [ 40, 39.279886867342455 ], [ 45, 38.984087749111694 ], [ 50, 39.26054023220716 ], [ 55, 39.054011337033124 ], [ 60, 39.075858298969685 ], [ 65, 39.10467385233336 ], [ 70, 38.993128854769516 ], [ 75, 38.76909754533729 ], [ 80, 38.89013969779046 ], [ 85, 38.97892022294319 ], [ 90, 39.14937370760346 ], [ 95, 37.79557435885247 ], [ 100, 38.41289187840182 ], [ 105, 38.82398687994676 ], [ 110, 39.19343046609465 ], [ 115, 39.18237349368954 ], [ 120, 38.77764078802749 ], [ 125, 38.85644066789471 ], [ 130, 39.109622675144095 ], [ 135, 38.02236615366333 ], [ 140, 37.98634886074507 ], [ 145, 38.60745635406392 ], [ 150, 38.919787011505186 ], [ 155, 39.064961490919465 ], [ 160, 38.55744984311115 ], [ 165, 38.97108491014548 ], [ 170, 38.74811257963297 ], [ 175, 38.9924503185319 ], [ 180, 38.83036512313397 ], [ 185, 39.05360082057954 ], [ 190, 38.13459796755215 ], [ 195, 38.93057228720884 ], [ 200, 38.62558299854993 ], [ 205, 38.6528823067963 ], [ 210, 37.97700810611643 ], [ 215, 38.57358024104405 ], [ 220, 38.490883590462836 ], [ 225, 38.30214657570067 ], [ 230, 38.85326740675589 ], [ 235, 38.16703829605154 ], [ 240, 38.58433451398959 ], [ 245, 37.20607602158462 ], [ 250, 38.48766966981244 ], [ 255, 38.61273682458934 ], [ 260, 38.22271138897473 ], [ 265, 37.89779161813298 ], [ 270, 38.564566049397385 ], [ 275, 38.031226527285554 ], [ 280, 38.47453912257972 ], [ 285, 38.54925891148538 ], [ 290, 38.1185694079612 ], [ 295, 38.38668722823576 ], [ 300, 34.936471592439844 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAMS1_R2", "pairs": [ [ 1, 39.03556591594623 ], [ 2, 38.93212924383424 ], [ 3, 39.28863273434776 ], [ 4, 39.17771944959405 ], [ 5, 38.244843768163825 ], [ 6, 38.90028939752697 ], [ 7, 38.64610904107242 ], [ 8, 38.83342816761807 ], [ 9, 39.27282294133123 ], [ 10, 39.13249756795947 ], [ 15, 39.13325134756459 ], [ 20, 39.26262733797104 ], [ 25, 39.10939471252975 ], [ 30, 38.5870646035621 ], [ 35, 39.27718409476087 ], [ 40, 39.14713753418623 ], [ 45, 39.0282655115239 ], [ 50, 39.210910225583234 ], [ 55, 39.01429122079257 ], [ 60, 38.85388300508434 ], [ 65, 38.933343122678856 ], [ 70, 38.3811848779085 ], [ 75, 39.02015993343245 ], [ 80, 38.82949285071861 ], [ 85, 39.127046689618915 ], [ 90, 39.16661078547742 ], [ 95, 38.6548916435188 ], [ 100, 39.20318155676019 ], [ 105, 38.97269490094345 ], [ 110, 39.19154195372058 ], [ 115, 39.19206568691034 ], [ 120, 38.533385543495555 ], [ 125, 38.9821600925975 ], [ 130, 38.87936200075419 ], [ 135, 38.90679954248012 ], [ 140, 38.91340288187964 ], [ 145, 38.80388900786245 ], [ 150, 38.59696367774346 ], [ 155, 38.98451280100997 ], [ 160, 38.647524061847975 ], [ 165, 38.94834947654391 ], [ 170, 39.06928466099258 ], [ 175, 39.09095959812278 ], [ 180, 38.67459815337172 ], [ 185, 39.12899353251792 ], [ 190, 38.56346759834305 ], [ 195, 39.195888223308636 ], [ 200, 38.747450025392666 ], [ 205, 38.91966493914938 ], [ 210, 38.74392809285762 ], [ 215, 38.85618693899029 ], [ 220, 38.80502468901629 ], [ 225, 38.72686177210233 ], [ 230, 39.06249533447958 ], [ 235, 38.52196312862152 ], [ 240, 38.702173979551254 ], [ 245, 37.70365837988656 ], [ 250, 38.73444897909235 ], [ 255, 38.57337012720809 ], [ 260, 38.14041962149627 ], [ 265, 37.343498559042544 ], [ 270, 38.65846677231649 ], [ 275, 38.07077885127239 ], [ 280, 38.44395195584735 ], [ 285, 38.496088305299416 ], [ 290, 38.13016954960136 ], [ 295, 38.413375148656534 ], [ 300, 32.724769277657764 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAMS2_R2", "pairs": [ [ 1, 39.38093336491929 ], [ 2, 38.76663169650411 ], [ 3, 39.18348505871603 ], [ 4, 39.41588547835798 ], [ 5, 38.549852786896345 ], [ 6, 38.87278757318352 ], [ 7, 38.584696605638094 ], [ 8, 38.853998443263734 ], [ 9, 39.27271988899793 ], [ 10, 39.13193136823581 ], [ 15, 39.0946021861992 ], [ 20, 39.22901756404616 ], [ 25, 39.24168804358862 ], [ 30, 38.57705100003385 ], [ 35, 39.27368912653559 ], [ 40, 39.16841043690141 ], [ 45, 38.993043419405055 ], [ 50, 39.227441876205624 ], [ 55, 39.01838979322481 ], [ 60, 38.6469064942976 ], [ 65, 38.93613455616095 ], [ 70, 38.38332261667062 ], [ 75, 38.80027344410978 ], [ 80, 38.63395334220645 ], [ 85, 39.026380995500546 ], [ 90, 39.01366291465585 ], [ 95, 38.604311540986714 ], [ 100, 39.08234163378299 ], [ 105, 38.915143187832925 ], [ 110, 39.147254353844176 ], [ 115, 39.136744211231665 ], [ 120, 38.51667633131996 ], [ 125, 38.96184971098266 ], [ 130, 38.829437863346826 ], [ 135, 38.765363241933414 ], [ 140, 38.824922329242796 ], [ 145, 38.716179207927496 ], [ 150, 38.52753460566933 ], [ 155, 38.93254409488784 ], [ 160, 38.604187529473876 ], [ 165, 38.899929270686364 ], [ 170, 39.04298053231527 ], [ 175, 39.050957138602335 ], [ 180, 38.59931497576693 ], [ 185, 39.096906513544845 ], [ 190, 38.49909903811657 ], [ 195, 39.16759191999403 ], [ 200, 38.69352395264302 ], [ 205, 38.89200360118866 ], [ 210, 38.69792247944102 ], [ 215, 38.77173833109448 ], [ 220, 38.82195760927695 ], [ 225, 38.587493992052586 ], [ 230, 38.954499360280536 ], [ 235, 38.536906736347575 ], [ 240, 38.618230312548654 ], [ 245, 37.63920363387738 ], [ 250, 38.71100791356679 ], [ 255, 38.53428557889534 ], [ 260, 38.077164384210775 ], [ 265, 37.284255561847075 ], [ 270, 38.61610570117607 ], [ 275, 37.77817613170953 ], [ 280, 38.34005375070235 ], [ 285, 38.389788329728795 ], [ 290, 38.004952086392116 ], [ 295, 38.33865211550604 ], [ 300, 32.48386617101416 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCFS1_R2", "pairs": [ [ 1, 31.124088948386138 ], [ 2, 32.03207007925884 ], [ 3, 32.58205308004505 ], [ 4, 33.196309045706634 ], [ 5, 32.56188245043667 ], [ 6, 32.756470325747436 ], [ 7, 32.41060007224666 ], [ 8, 32.46561377786277 ], [ 9, 32.86996132678863 ], [ 10, 33.01353031172308 ], [ 15, 32.997206816684724 ], [ 20, 32.85069271796179 ], [ 25, 32.909523809523805 ], [ 30, 32.48641444083211 ], [ 35, 32.512054567476255 ], [ 40, 32.7865983387166 ], [ 45, 32.6583062431914 ], [ 50, 32.67207675267344 ], [ 55, 32.57744617810433 ], [ 60, 32.508957713557166 ], [ 65, 31.86231831704207 ], [ 70, 31.55690509699889 ], [ 75, 32.380107069375185 ], [ 80, 32.13418594455801 ], [ 85, 32.02979682839426 ], [ 90, 32.07989204925784 ], [ 95, 31.461783737263197 ], [ 100, 31.898179924986984 ], [ 105, 31.634462424429167 ], [ 110, 32.00323214722101 ], [ 115, 31.781137307818994 ], [ 120, 31.637719009318186 ], [ 125, 31.68913285034997 ], [ 130, 31.64961733353858 ], [ 135, 31.34791852607421 ], [ 140, 31.549934440461687 ], [ 145, 30.987166757918033 ], [ 150, 31.08660930327983 ], [ 155, 31.135260098716117 ], [ 160, 30.808964134975717 ], [ 165, 31.096632078930174 ], [ 170, 30.44220872716067 ], [ 175, 30.88509752041527 ], [ 180, 31.083864020008455 ], [ 185, 30.404747579576867 ], [ 190, 30.149964213785818 ], [ 195, 30.918022804799 ], [ 200, 29.6489318411772 ], [ 205, 29.693622673992287 ], [ 210, 29.497720485871262 ], [ 215, 29.43121688100303 ], [ 220, 29.666334744974684 ], [ 225, 28.882502073687686 ], [ 230, 29.576454334842396 ], [ 235, 28.822876150396393 ], [ 240, 27.325466003528238 ], [ 245, 27.73402941614062 ], [ 250, 27.863372228952795 ], [ 255, 26.94788943441943 ], [ 260, 27.624511679313052 ], [ 265, 26.821811303109524 ], [ 270, 26.90411592169865 ], [ 275, 25.13998542080818 ], [ 280, 25.7196817824842 ], [ 285, 25.842596796454593 ], [ 290, 24.51298622647552 ], [ 295, 24.51163018248375 ], [ 300, 21.7496348675988 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCFS2_R2", "pairs": [ [ 1, 31.211525321279336 ], [ 2, 32.28532758666001 ], [ 3, 32.74479645738614 ], [ 4, 33.20563191506137 ], [ 5, 32.660869622348955 ], [ 6, 32.87270373971775 ], [ 7, 32.45983679798166 ], [ 8, 32.51882999132743 ], [ 9, 32.82908464954929 ], [ 10, 33.02862211242806 ], [ 15, 33.06302199679378 ], [ 20, 32.88591627026885 ], [ 25, 32.919902236472105 ], [ 30, 32.54302909253371 ], [ 35, 32.52359450695663 ], [ 40, 32.77404858574327 ], [ 45, 32.72192688935608 ], [ 50, 32.66602495449976 ], [ 55, 32.551553578585654 ], [ 60, 32.53013659927594 ], [ 65, 31.866900136007935 ], [ 70, 31.46854003324599 ], [ 75, 32.3885948197695 ], [ 80, 32.21076389345178 ], [ 85, 31.99832434487654 ], [ 90, 32.10550952421628 ], [ 95, 31.503676114614102 ], [ 100, 31.920745121230045 ], [ 105, 31.714006176489914 ], [ 110, 32.025522044812405 ], [ 115, 31.842448255470135 ], [ 120, 31.703863591563174 ], [ 125, 31.66636593495578 ], [ 130, 31.7132604853176 ], [ 135, 31.396399214135055 ], [ 140, 31.610400226034734 ], [ 145, 31.01142395311094 ], [ 150, 31.141214639467684 ], [ 155, 31.16459019571394 ], [ 160, 30.824891366611165 ], [ 165, 31.11529297349866 ], [ 170, 30.497972808694907 ], [ 175, 30.94858096608644 ], [ 180, 31.138751340504946 ], [ 185, 30.470051321816044 ], [ 190, 30.22031844496869 ], [ 195, 31.014887926559204 ], [ 200, 29.782509725580905 ], [ 205, 29.785698138996953 ], [ 210, 29.553443381347915 ], [ 215, 29.51820782940117 ], [ 220, 29.75102711369879 ], [ 225, 28.978889434631668 ], [ 230, 29.685764228871086 ], [ 235, 28.959275298508935 ], [ 240, 27.436338903747707 ], [ 245, 27.88674206330952 ], [ 250, 27.97838775604082 ], [ 255, 27.07930110564506 ], [ 260, 27.784930111519277 ], [ 265, 26.952367807152406 ], [ 270, 27.024805435685874 ], [ 275, 25.28213466787611 ], [ 280, 25.855435265089376 ], [ 285, 25.965049030246472 ], [ 290, 24.645954992333174 ], [ 295, 24.620343582388905 ], [ 300, 21.6691689279453 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCMS1_R2", "pairs": [ [ 1, 31.137136200561383 ], [ 2, 31.95514508603543 ], [ 3, 32.55408428188144 ], [ 4, 33.1721142347277 ], [ 5, 32.49580821255739 ], [ 6, 32.75879098068618 ], [ 7, 32.38979595630379 ], [ 8, 32.48026792740431 ], [ 9, 32.88661416347042 ], [ 10, 33.02016519298333 ], [ 15, 32.95386617261613 ], [ 20, 32.83460129998079 ], [ 25, 32.877634505877175 ], [ 30, 32.4725981646601 ], [ 35, 32.47469834384574 ], [ 40, 32.74745215240943 ], [ 45, 32.71770610651548 ], [ 50, 32.63402670632338 ], [ 55, 32.563255568981006 ], [ 60, 32.487340211295965 ], [ 65, 31.961448709607463 ], [ 70, 31.758256233833954 ], [ 75, 32.460509846203415 ], [ 80, 32.27149744085462 ], [ 85, 32.32554153920025 ], [ 90, 32.275172576187586 ], [ 95, 31.672571658890735 ], [ 100, 32.051158467439606 ], [ 105, 31.663163895722438 ], [ 110, 32.14906461267715 ], [ 115, 31.8988418423939 ], [ 120, 31.732316521769405 ], [ 125, 31.73058819155265 ], [ 130, 31.411457792919908 ], [ 135, 31.47037732458342 ], [ 140, 31.632230918431212 ], [ 145, 31.072651558810954 ], [ 150, 31.15215184696325 ], [ 155, 31.1596165268982 ], [ 160, 30.910742326688187 ], [ 165, 31.160776099794884 ], [ 170, 30.532280273407242 ], [ 175, 30.949249865217418 ], [ 180, 31.15682495615693 ], [ 185, 30.51216258550146 ], [ 190, 30.2609310511508 ], [ 195, 30.977192221409716 ], [ 200, 29.890183159287567 ], [ 205, 29.73873546691787 ], [ 210, 29.39962195394035 ], [ 215, 29.47492377104043 ], [ 220, 29.756534619103103 ], [ 225, 28.994770042320503 ], [ 230, 29.60168828673604 ], [ 235, 28.697135551499713 ], [ 240, 27.247181832831302 ], [ 245, 27.70717588288523 ], [ 250, 27.835051701386806 ], [ 255, 26.95150268059128 ], [ 260, 27.51599491772289 ], [ 265, 26.73113142644643 ], [ 270, 26.82491431404754 ], [ 275, 25.227291828070285 ], [ 280, 25.825213397580864 ], [ 285, 25.903359778144864 ], [ 290, 24.660925764379986 ], [ 295, 24.69587742997187 ], [ 300, 21.863921257287217 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCMS2_R2", "pairs": [ [ 1, 31.221989454853592 ], [ 2, 32.30024636725983 ], [ 3, 32.71486520415529 ], [ 4, 33.19983993974202 ], [ 5, 32.6027053322035 ], [ 6, 32.84496124031008 ], [ 7, 32.452758685622825 ], [ 8, 32.516994633273704 ], [ 9, 32.85303486802875 ], [ 10, 33.024966261808366 ], [ 15, 32.99937074349559 ], [ 20, 32.858979066629004 ], [ 25, 32.89879327119229 ], [ 30, 32.51910837020996 ], [ 35, 32.48254401657094 ], [ 40, 32.72430980659313 ], [ 45, 32.739755500455104 ], [ 50, 32.59763033175356 ], [ 55, 32.51516116882709 ], [ 60, 32.464269796930424 ], [ 65, 31.9336712595336 ], [ 70, 31.687576311853558 ], [ 75, 32.42680257056096 ], [ 80, 32.31600979736917 ], [ 85, 32.3110301303695 ], [ 90, 32.292839599174485 ], [ 95, 31.731241319240098 ], [ 100, 32.05144345833627 ], [ 105, 31.74731043574472 ], [ 110, 32.16694209687924 ], [ 115, 31.939796134560606 ], [ 120, 31.798607939609372 ], [ 125, 31.62936666745137 ], [ 130, 31.502796476910454 ], [ 135, 31.52688649632745 ], [ 140, 31.677467198191977 ], [ 145, 31.133242827547242 ], [ 150, 31.235939572297433 ], [ 155, 31.170607666025468 ], [ 160, 30.95962926921145 ], [ 165, 31.183393723290244 ], [ 170, 30.612710421195544 ], [ 175, 30.99737723958783 ], [ 180, 31.17206155874528 ], [ 185, 30.575171883556273 ], [ 190, 30.32444297946146 ], [ 195, 31.00808513643962 ], [ 200, 29.952441943509207 ], [ 205, 29.8127594785707 ], [ 210, 29.48733234446982 ], [ 215, 29.511920514209027 ], [ 220, 29.795400652586615 ], [ 225, 29.015353155924515 ], [ 230, 29.635431235431234 ], [ 235, 28.745876794361642 ], [ 240, 27.33742867682261 ], [ 245, 27.801566559142316 ], [ 250, 27.895007573795453 ], [ 255, 27.02663307511792 ], [ 260, 27.58040074403711 ], [ 265, 26.825697534788446 ], [ 270, 26.8689169918061 ], [ 275, 25.282448908625078 ], [ 280, 25.85273604583914 ], [ 285, 25.940456551071787 ], [ 290, 24.66638325512586 ], [ 295, 24.681202214440003 ], [ 300, 21.78994583377954 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPFS1_R2", "pairs": [ [ 1, 31.1434918650989 ], [ 2, 32.34996554277618 ], [ 3, 32.61334714475886 ], [ 4, 33.26015418002508 ], [ 5, 32.684906879887684 ], [ 6, 32.80626479413414 ], [ 7, 32.441454822513194 ], [ 8, 32.52559893503636 ], [ 9, 32.873976449236594 ], [ 10, 33.08087645480111 ], [ 15, 33.08603091305223 ], [ 20, 32.92276188560202 ], [ 25, 32.96351044203696 ], [ 30, 32.549032415472794 ], [ 35, 32.558362832426596 ], [ 40, 32.82921801363736 ], [ 45, 32.753051711518125 ], [ 50, 32.729485538667 ], [ 55, 32.634785102494185 ], [ 60, 32.58565038545006 ], [ 65, 31.95401822594522 ], [ 70, 31.626058222007252 ], [ 75, 32.49197724539108 ], [ 80, 32.217430646811316 ], [ 85, 32.04910389816071 ], [ 90, 32.11234938340831 ], [ 95, 31.501580751895148 ], [ 100, 31.98535332565715 ], [ 105, 31.731285875106472 ], [ 110, 32.07424528198133 ], [ 115, 31.843614899281743 ], [ 120, 31.70875345643818 ], [ 125, 31.720999007832738 ], [ 130, 31.656070301899227 ], [ 135, 31.334319995293487 ], [ 140, 31.568817080301255 ], [ 145, 31.010099393026223 ], [ 150, 31.163140682652873 ], [ 155, 31.168804629780244 ], [ 160, 30.817080019519047 ], [ 165, 31.10695494354031 ], [ 170, 30.501344074514805 ], [ 175, 30.950627092090507 ], [ 180, 31.121694531438248 ], [ 185, 30.459072755835404 ], [ 190, 30.239438874603366 ], [ 195, 30.950485411958084 ], [ 200, 29.782960071228 ], [ 205, 29.56882662146428 ], [ 210, 29.196257105677695 ], [ 215, 29.389619717827543 ], [ 220, 29.656449900691733 ], [ 225, 28.829475675517994 ], [ 230, 29.595365003809707 ], [ 235, 28.891322437867593 ], [ 240, 27.47981542202094 ], [ 245, 27.801386047069094 ], [ 250, 27.90363933668359 ], [ 255, 27.008146772025647 ], [ 260, 27.701422859931334 ], [ 265, 26.786710556730338 ], [ 270, 26.883435068103797 ], [ 275, 25.113603636768346 ], [ 280, 25.65008347102485 ], [ 285, 25.783210366730827 ], [ 290, 24.37221981543957 ], [ 295, 24.442308760701035 ], [ 300, 21.221806192250035 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPFS2_R2", "pairs": [ [ 1, 30.97871855361497 ], [ 2, 32.51060603056916 ], [ 3, 32.78051464028706 ], [ 4, 33.321967369109686 ], [ 5, 32.70962769859049 ], [ 6, 32.900174454334596 ], [ 7, 32.50554586364808 ], [ 8, 32.57974842891977 ], [ 9, 32.94321313165355 ], [ 10, 33.0950835596614 ], [ 15, 33.156544019982945 ], [ 20, 32.95869892750233 ], [ 25, 33.00416509723847 ], [ 30, 32.647366334278296 ], [ 35, 32.624726919493284 ], [ 40, 32.86220882976825 ], [ 45, 32.83206589616002 ], [ 50, 32.7639236365799 ], [ 55, 32.652023075550616 ], [ 60, 32.619831294728705 ], [ 65, 31.964519358483834 ], [ 70, 31.62243081335522 ], [ 75, 32.569362296861286 ], [ 80, 32.32830903483825 ], [ 85, 32.12967393190575 ], [ 90, 32.240112011498525 ], [ 95, 31.59888285877134 ], [ 100, 32.039995043739005 ], [ 105, 31.841523554630392 ], [ 110, 32.1406071419721 ], [ 115, 31.928701211805816 ], [ 120, 31.83119074170446 ], [ 125, 31.787367481971604 ], [ 130, 31.747748122816148 ], [ 135, 31.471753772953683 ], [ 140, 31.67075359948455 ], [ 145, 31.10686194334994 ], [ 150, 31.290774911406835 ], [ 155, 31.26757366242906 ], [ 160, 30.94759322773141 ], [ 165, 31.235271901825893 ], [ 170, 30.63431831248389 ], [ 175, 31.055751273765384 ], [ 180, 31.21694653159136 ], [ 185, 30.59956859704979 ], [ 190, 30.345311531961084 ], [ 195, 31.080036315413288 ], [ 200, 29.929715503568595 ], [ 205, 29.72705789056305 ], [ 210, 29.377169904837427 ], [ 215, 29.497511657039773 ], [ 220, 29.792477088775108 ], [ 225, 28.978389845209836 ], [ 230, 29.690960908419537 ], [ 235, 29.004249584959915 ], [ 240, 27.61908443862884 ], [ 245, 27.938928937108564 ], [ 250, 28.025788704121332 ], [ 255, 27.12823374885381 ], [ 260, 27.843908701147427 ], [ 265, 26.9306842457436 ], [ 270, 27.023856791374207 ], [ 275, 25.25053412306861 ], [ 280, 25.752335173347518 ], [ 285, 25.91298904072923 ], [ 290, 24.520667178864407 ], [ 295, 24.578390120100398 ], [ 300, 21.321338940535227 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPMS1_R2", "pairs": [ [ 1, 31.153750774953505 ], [ 2, 32.4130892604459 ], [ 3, 32.552940564024176 ], [ 4, 33.244961027529186 ], [ 5, 32.57948065100827 ], [ 6, 32.77748067940351 ], [ 7, 32.4447688863859 ], [ 8, 32.48259134986252 ], [ 9, 32.855468213891896 ], [ 10, 32.9925254255737 ], [ 15, 33.03713908463202 ], [ 20, 32.87900503069052 ], [ 25, 32.94774802061495 ], [ 30, 32.600033127783334 ], [ 35, 32.62855804224266 ], [ 40, 32.80081305045361 ], [ 45, 32.733221014372724 ], [ 50, 32.66742355763998 ], [ 55, 32.60271837124887 ], [ 60, 32.52509050983659 ], [ 65, 31.981433297208277 ], [ 70, 31.761374689688807 ], [ 75, 32.51019583345165 ], [ 80, 32.28811417200198 ], [ 85, 32.21799810695693 ], [ 90, 32.232815901561764 ], [ 95, 31.6421221012778 ], [ 100, 32.02641268338855 ], [ 105, 31.742692853762424 ], [ 110, 32.14291623284429 ], [ 115, 31.88641552295315 ], [ 120, 31.76539921571876 ], [ 125, 31.672416812195042 ], [ 130, 31.550041410513064 ], [ 135, 31.39345477262079 ], [ 140, 31.593568355742338 ], [ 145, 31.06356206134435 ], [ 150, 31.219450899470395 ], [ 155, 30.987915244851887 ], [ 160, 30.85275473162605 ], [ 165, 31.22425375430094 ], [ 170, 30.730909503954262 ], [ 175, 30.954075658688726 ], [ 180, 31.008760429928394 ], [ 185, 30.650737238579637 ], [ 190, 30.262532835418234 ], [ 195, 30.939615961681362 ], [ 200, 29.876179116910652 ], [ 205, 29.737541127607802 ], [ 210, 29.603493011610237 ], [ 215, 29.125720966115892 ], [ 220, 29.689619886500786 ], [ 225, 28.682861577286673 ], [ 230, 29.523974648433988 ], [ 235, 28.674015204100648 ], [ 240, 27.28492123028001 ], [ 245, 27.68897082838304 ], [ 250, 27.76587919552036 ], [ 255, 26.876058258033673 ], [ 260, 27.477530328920277 ], [ 265, 26.572397960874156 ], [ 270, 26.725840760743516 ], [ 275, 25.00864877145981 ], [ 280, 25.637063544759524 ], [ 285, 25.725453220111138 ], [ 290, 24.495032214343873 ], [ 295, 24.546760642259862 ], [ 300, 21.42564365755895 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPMS2_R2", "pairs": [ [ 1, 31.04130679404729 ], [ 2, 32.51452034786237 ], [ 3, 32.718632397105615 ], [ 4, 33.32338234307815 ], [ 5, 32.610689241454345 ], [ 6, 32.87373221751086 ], [ 7, 32.47515854267425 ], [ 8, 32.545081264764406 ], [ 9, 32.94721702647718 ], [ 10, 33.032322584972164 ], [ 15, 33.10776132527517 ], [ 20, 32.910461953484216 ], [ 25, 32.99688354658658 ], [ 30, 32.69143087092279 ], [ 35, 32.66085057865281 ], [ 40, 32.83029167223233 ], [ 45, 32.79237442241764 ], [ 50, 32.719971679833066 ], [ 55, 32.61980772097182 ], [ 60, 32.58228648084662 ], [ 65, 31.985822030108814 ], [ 70, 31.699477613830492 ], [ 75, 32.55333696032911 ], [ 80, 32.35724588287407 ], [ 85, 32.257687618705276 ], [ 90, 32.31732115042071 ], [ 95, 31.682900944275097 ], [ 100, 32.0709212458171 ], [ 105, 31.80649887834726 ], [ 110, 32.18741881516674 ], [ 115, 31.955190197948962 ], [ 120, 31.864033806343905 ], [ 125, 31.762826436918676 ], [ 130, 31.608692512039756 ], [ 135, 31.456074947456283 ], [ 140, 31.671501185028397 ], [ 145, 31.112503646561454 ], [ 150, 31.274828948349107 ], [ 155, 31.11283595438623 ], [ 160, 30.91145561600954 ], [ 165, 31.260298129239022 ], [ 170, 30.738798539166726 ], [ 175, 31.028930461354996 ], [ 180, 31.138355817246776 ], [ 185, 30.691811540452896 ], [ 190, 30.316969965712286 ], [ 195, 31.053673407022593 ], [ 200, 29.94833901033786 ], [ 205, 29.783329730857815 ], [ 210, 29.618129644398397 ], [ 215, 29.298734403649213 ], [ 220, 29.761270366560826 ], [ 225, 28.810238586024774 ], [ 230, 29.612973770711744 ], [ 235, 28.82197625276716 ], [ 240, 27.352878215305264 ], [ 245, 27.781231328168996 ], [ 250, 27.858139101527268 ], [ 255, 26.95983184382943 ], [ 260, 27.598324401279065 ], [ 265, 26.700301876104085 ], [ 270, 26.86232064459865 ], [ 275, 25.156292531308278 ], [ 280, 25.729468915037472 ], [ 285, 25.849243482638222 ], [ 290, 24.620399400675357 ], [ 295, 24.62076556015483 ], [ 300, 21.64115501379526 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVFS1_R2", "pairs": [ [ 1, 31.147575026185162 ], [ 2, 32.0680085614099 ], [ 3, 32.63452798397012 ], [ 4, 33.17671114349469 ], [ 5, 32.539605628671616 ], [ 6, 32.76452479621112 ], [ 7, 32.39132929550526 ], [ 8, 32.441286033061616 ], [ 9, 32.87186119586502 ], [ 10, 33.04595109066897 ], [ 15, 32.972049729040485 ], [ 20, 32.891131654446916 ], [ 25, 32.89447242588461 ], [ 30, 32.47992895851359 ], [ 35, 32.51391359781703 ], [ 40, 32.76975872030944 ], [ 45, 32.63998250776673 ], [ 50, 32.67018703612127 ], [ 55, 32.56120515296733 ], [ 60, 32.50850203166852 ], [ 65, 31.860696780306483 ], [ 70, 31.556354755674295 ], [ 75, 32.39884276750402 ], [ 80, 32.147476311953355 ], [ 85, 32.01148141245024 ], [ 90, 32.07563115553167 ], [ 95, 31.483193177780414 ], [ 100, 31.91508851210379 ], [ 105, 31.674257236308637 ], [ 110, 32.00017675088147 ], [ 115, 31.79430388396396 ], [ 120, 31.648991921337036 ], [ 125, 31.668132328689744 ], [ 130, 31.662612637779308 ], [ 135, 31.34376091098614 ], [ 140, 31.57809900029209 ], [ 145, 31.001379461153682 ], [ 150, 31.11112609452306 ], [ 155, 31.10515876710688 ], [ 160, 30.821849658314353 ], [ 165, 31.110041002277903 ], [ 170, 30.49629521640091 ], [ 175, 30.898110250569477 ], [ 180, 31.102666059225516 ], [ 185, 30.432404555808652 ], [ 190, 30.194591343963555 ], [ 195, 30.952940318906606 ], [ 200, 29.7144 ], [ 205, 29.721117084282458 ], [ 210, 29.528240546697038 ], [ 215, 29.42967492580658 ], [ 220, 29.693907005986386 ], [ 225, 28.870065683908763 ], [ 230, 29.588027116667273 ], [ 235, 28.846320020525702 ], [ 240, 27.349019107583807 ], [ 245, 27.779749788149104 ], [ 250, 27.891823922294 ], [ 255, 26.974612517882036 ], [ 260, 27.64917393101799 ], [ 265, 26.837586791318138 ], [ 270, 26.91725985457329 ], [ 275, 25.140476215226947 ], [ 280, 25.771531682022026 ], [ 285, 25.864386315219956 ], [ 290, 24.55395597321376 ], [ 295, 24.544671574449872 ], [ 300, 21.78718052761986 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVFS2_R2", "pairs": [ [ 1, 31.17161040951651 ], [ 2, 30.843350771383825 ], [ 3, 31.662163873246477 ], [ 4, 32.800446502948915 ], [ 5, 31.404371730365533 ], [ 6, 32.15085801872647 ], [ 7, 31.709599813401752 ], [ 8, 31.811622405118122 ], [ 9, 32.323541368165 ], [ 10, 32.40132618040052 ], [ 15, 32.29827863116857 ], [ 20, 32.16119689447203 ], [ 25, 32.27324647629203 ], [ 30, 32.00611375828863 ], [ 35, 31.953107860451166 ], [ 40, 32.08492619372897 ], [ 45, 31.917229016027456 ], [ 50, 32.002333810935994 ], [ 55, 31.976256705874516 ], [ 60, 31.860751057945425 ], [ 65, 31.037411615740893 ], [ 70, 30.75427543234148 ], [ 75, 31.872498750458163 ], [ 80, 31.501788011062608 ], [ 85, 31.86605487148708 ], [ 90, 31.597359564414766 ], [ 95, 31.283660888631196 ], [ 100, 31.168797572059976 ], [ 105, 30.958045984671777 ], [ 110, 31.387498833722095 ], [ 115, 31.08484105298234 ], [ 120, 30.655432189270236 ], [ 125, 29.956105298233922 ], [ 130, 30.717258247250914 ], [ 135, 30.46634855048317 ], [ 140, 30.657988495163334 ], [ 145, 30.283470066444956 ], [ 150, 30.330336958839837 ], [ 155, 30.240524365536363 ], [ 160, 29.938087811900193 ], [ 165, 30.165263115802947 ], [ 170, 29.642298464491358 ], [ 175, 29.90949162934528 ], [ 180, 29.67538654297291 ], [ 185, 28.70244853208418 ], [ 190, 29.124911527721316 ], [ 195, 29.628977587022728 ], [ 200, 28.163336821129377 ], [ 205, 28.380380814011613 ], [ 210, 27.49363999280225 ], [ 215, 27.67358227755303 ], [ 220, 27.489799862709685 ], [ 225, 26.629184188954127 ], [ 230, 27.4378921271335 ], [ 235, 26.36426053170007 ], [ 240, 25.36646650716109 ], [ 245, 26.101497530773692 ], [ 250, 25.78271608229421 ], [ 255, 24.488962791658615 ], [ 260, 24.76107127298248 ], [ 265, 24.664182983884942 ], [ 270, 24.485398884187383 ], [ 275, 23.161455306443443 ], [ 280, 23.481923811948587 ], [ 285, 23.522125810185077 ], [ 290, 22.751755431079022 ], [ 295, 22.56118943954666 ], [ 300, 20.775551754250607 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVMS1_R2", "pairs": [ [ 1, 31.153744050721112 ], [ 2, 32.027514245157796 ], [ 3, 32.64321314326353 ], [ 4, 33.16535900101062 ], [ 5, 32.551479797645335 ], [ 6, 32.785111902588746 ], [ 7, 32.4452896683376 ], [ 8, 32.497205674453156 ], [ 9, 32.86552974135573 ], [ 10, 33.074742809758405 ], [ 15, 32.93459291528342 ], [ 20, 32.88064011793465 ], [ 25, 32.89556622162845 ], [ 30, 32.50204744450939 ], [ 35, 32.4763308280577 ], [ 40, 32.760122339819326 ], [ 45, 32.7148194967159 ], [ 50, 32.64876108460352 ], [ 55, 32.55104484316554 ], [ 60, 32.489578060165236 ], [ 65, 31.937971129674576 ], [ 70, 31.73147890588781 ], [ 75, 32.44711397529926 ], [ 80, 32.28439997773195 ], [ 85, 32.31275229406911 ], [ 90, 32.29305090016932 ], [ 95, 31.650184433015273 ], [ 100, 32.06286805253594 ], [ 105, 31.680751190889243 ], [ 110, 32.14893424637022 ], [ 115, 31.90242638208175 ], [ 120, 31.728039600767136 ], [ 125, 31.70194951420525 ], [ 130, 31.413716320099798 ], [ 135, 31.468214960375967 ], [ 140, 31.63974940357479 ], [ 145, 31.07461609732489 ], [ 150, 31.17813051446607 ], [ 155, 31.165532156174976 ], [ 160, 30.927232303567365 ], [ 165, 31.154181747378857 ], [ 170, 30.545288240833806 ], [ 175, 30.960230051234493 ], [ 180, 31.119544275070773 ], [ 185, 30.500129895652087 ], [ 190, 30.28956161850643 ], [ 195, 30.995273740024015 ], [ 200, 29.911339855821712 ], [ 205, 29.7396282930454 ], [ 210, 29.432458836032474 ], [ 215, 29.46491363991141 ], [ 220, 29.752309415942563 ], [ 225, 28.966677360648003 ], [ 230, 29.61027406137938 ], [ 235, 28.70480933447231 ], [ 240, 27.232225563390017 ], [ 245, 27.764788123876677 ], [ 250, 27.855852804276697 ], [ 255, 26.9813251762754 ], [ 260, 27.569673717682843 ], [ 265, 26.752845177197106 ], [ 270, 26.86452031111415 ], [ 275, 25.21805673877279 ], [ 280, 25.875651622778093 ], [ 285, 25.93386892518514 ], [ 290, 24.683228954353318 ], [ 295, 24.72041290154244 ], [ 300, 21.8076674160193 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVMS2_R2", "pairs": [ [ 1, 31.197487300126145 ], [ 2, 30.392460195697385 ], [ 3, 31.92594865500665 ], [ 4, 32.76301523984863 ], [ 5, 31.760006477788007 ], [ 6, 32.29621390337868 ], [ 7, 31.837953018990145 ], [ 8, 31.930287068289523 ], [ 9, 32.41963281170093 ], [ 10, 32.53077631175207 ], [ 15, 32.56376018546929 ], [ 20, 32.40424976986806 ], [ 25, 32.37783062289045 ], [ 30, 31.900879615423953 ], [ 35, 31.859763553363912 ], [ 40, 32.2235112408146 ], [ 45, 32.19129567596594 ], [ 50, 32.10820739680023 ], [ 55, 32.02596791004376 ], [ 60, 31.94638162941748 ], [ 65, 31.306428681020815 ], [ 70, 31.164798685249696 ], [ 75, 31.90057706896699 ], [ 80, 31.690650107762906 ], [ 85, 31.731364801573157 ], [ 90, 31.675150450926573 ], [ 95, 30.95716282796597 ], [ 100, 31.42896670474112 ], [ 105, 30.83811821266004 ], [ 110, 31.437093612015616 ], [ 115, 31.204831477913974 ], [ 120, 31.02471657261708 ], [ 125, 30.86975126583357 ], [ 130, 30.686363093918885 ], [ 135, 30.68392348739281 ], [ 140, 30.818124009069674 ], [ 145, 30.229200406669065 ], [ 150, 30.347211211416003 ], [ 155, 30.279222333858797 ], [ 160, 29.995536536297607 ], [ 165, 30.20905650083541 ], [ 170, 29.573698298496264 ], [ 175, 29.990522385515057 ], [ 180, 30.095642240938382 ], [ 185, 29.47345235769881 ], [ 190, 29.26752141852436 ], [ 195, 29.863941008482165 ], [ 200, 28.75331145304974 ], [ 205, 28.576792123097903 ], [ 210, 28.271528067857293 ], [ 215, 28.152343037381183 ], [ 220, 28.46027023571033 ], [ 225, 27.719441989226503 ], [ 230, 28.268154147838686 ], [ 235, 27.27755307357831 ], [ 240, 26.024860262393606 ], [ 245, 26.32170213491576 ], [ 250, 26.373842166291524 ], [ 255, 25.508565241115885 ], [ 260, 26.00093615715163 ], [ 265, 25.236716458631744 ], [ 270, 25.339246755289512 ], [ 275, 23.764591224046107 ], [ 280, 24.354956875892668 ], [ 285, 24.41534087543849 ], [ 290, 23.2068608911587 ], [ 295, 23.284761017574418 ], [ 300, 20.61212592023485 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null } ] } ], "pconfig": { "id": "fastqc_per_base_sequence_quality_plot", "title": "FastQC: Mean Quality Scores", "anchor": null, "table_title": null, "height": null, "width": null, "square": false, "logswitch": false, "logswitch_active": false, "logswitch_label": "Log10", "cpswitch": true, "cpswitch_c_active": true, "cpswitch_counts_label": "Counts", "cpswitch_percent_label": "Percentages", "xLog": null, "yLog": null, "xlog": false, "ylog": false, "data_labels": [], "xTitle": null, "yTitle": null, "xlab": "Position (bp)", "ylab": "Phred Score", "xsuffix": null, "ysuffix": null, "tt_suffix": null, "xLabFormat": null, "yLabFormat": null, "xLabelFormat": null, "yLabelFormat": null, "xlab_format": null, "ylab_format": null, "tt_label": "Base {point.x}: {point.y:.2f}", "xDecimals": null, "yDecimals": null, "decimalPlaces": null, "x_decimals": 0, "y_decimals": null, "tt_decimals": null, "xmin": 0, "xmax": null, "ymin": 0, "ymax": null, "xFloor": null, "xCeiling": null, "yFloor": null, "yCeiling": null, "x_clipmin": null, "x_clipmax": null, "y_clipmin": null, "y_clipmax": null, "save_data_file": true, "showlegend": false, "xMinRange": null, "yMinRange": null, "x_minrange": null, "y_minrange": null, "xPlotBands": null, "yPlotBands": null, "xPlotLines": null, "yPlotLines": null, "x_bands": null, "y_bands": [ { "from_": 28, "to": 100, "color": "#c3e6c3" }, { "from_": 20, "to": 28, "color": "#e6dcc3" }, { "from_": 0, "to": 20, "color": "#e6c3c3" } ], "x_lines": null, "y_lines": null, "categories": false, "smooth_points": 500, "smooth_points_sumcounts": null, "extra_series": null, "style": null, "hide_zero_cats": false, "hide_empty": false, "colors": { "CAFS1_R2": "#5cb85c", "CAFS2_R2": "#5cb85c", "CAMS1_R2": "#5cb85c", "CAMS2_R2": "#5cb85c", "CCFS1_R2": "#f0ad4e", "CCFS2_R2": "#f0ad4e", "CCMS1_R2": "#f0ad4e", "CCMS2_R2": "#f0ad4e", "CPFS1_R2": "#f0ad4e", "CPFS2_R2": "#f0ad4e", "CPMS1_R2": "#f0ad4e", "CPMS2_R2": "#f0ad4e", "CVFS1_R2": "#f0ad4e", "CVFS2_R2": "#f0ad4e", "CVMS1_R2": "#f0ad4e", "CVMS2_R2": "#f0ad4e", "DAFS1_R2": "#5cb85c", "DAFS2_R2": "#5cb85c", "DAMS1_R2": "#5cb85c", "DAMS2_R2": "#5cb85c", "DCFS1_R2": "#f0ad4e", "DCFS2_R2": "#f0ad4e", "DCMS1_R2": "#f0ad4e", "DCMS2_R2": "#f0ad4e", "DPFS1_R2": "#f0ad4e", "DPFS2_R2": "#f0ad4e", "DPMS1_R2": "#5cb85c", "DPMS2_R2": "#f0ad4e", "DVFS1_R2": "#f0ad4e", "DVFS2_R2": "#f0ad4e", "DVMS1_R2": "#f0ad4e", "DVMS2_R2": "#f0ad4e", "IAFS1_R2": "#5cb85c", "IAFS2_R2": "#5cb85c", "IAMS1_R2": "#5cb85c", "IAMS2_R2": "#5cb85c", "ICFS1_R2": "#f0ad4e", "ICFS2_R2": "#f0ad4e", "ICMS1_R2": "#f0ad4e", "ICMS2_R2": "#f0ad4e", "IPFS1_R2": "#f0ad4e", "IPFS2_R2": "#f0ad4e", "IPMS1_R2": "#f0ad4e", "IPMS2_R2": "#f0ad4e", "IVFS1_R2": "#f0ad4e", "IVFS2_R2": "#f0ad4e", "IVMS1_R2": "#f0ad4e", "IVMS2_R2": "#f0ad4e", "JAFS1_R2": "#5cb85c", "JAFS2_R2": "#5cb85c", "JAMS1_R2": "#5cb85c", "JAMS2_R2": "#5cb85c", "JCFS1_R2": "#f0ad4e", "JCFS2_R2": "#f0ad4e", "JCMS1_R2": "#f0ad4e", "JCMS2_R2": "#f0ad4e", "JPFS1_R2": "#f0ad4e", "JPFS2_R2": "#f0ad4e", "JPMS1_R2": "#f0ad4e", "JPMS2_R2": "#f0ad4e", "JVFS1_R2": "#f0ad4e", "JVFS2_R2": "#f0ad4e", "JVMS1_R2": "#f0ad4e", "JVMS2_R2": "#f0ad4e" } }, "add_log_tab": false, "add_pct_tab": false, "l_active": false, "p_active": false, "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "yaxis" ], "square": false, "flat": false, "defer_render": false }, "fastqc_per_sequence_quality_scores_plot": { "id": "fastqc_per_sequence_quality_scores_plot", "anchor": "fastqc_per_sequence_quality_scores_plot", "plot_type": "xy_line", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 500, "hoverlabel": { "namelength": -1 }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "white", "plot_bgcolor": "white", "showlegend": false, "title": { "font": { "size": 20 }, "text": "FastQC: Per Sequence Quality Scores", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "shapes": [ { "fillcolor": "#c3e6c3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 28, "x1": 100, "y0": 0, "y1": 1, "yref": "paper" }, { "fillcolor": "#e6dcc3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 20, "x1": 28, "y0": 0, "y1": 1, "yref": "paper" }, { "fillcolor": "#e6c3c3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 20, "y0": 0, "y1": 1, "yref": "paper" }, { "fillcolor": "#c3e6c3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 28, "x1": 100, "y0": 0, "y1": 1, "yref": "paper" }, { "fillcolor": "#e6dcc3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 20, "x1": 28, "y0": 0, "y1": 1, "yref": "paper" }, { "fillcolor": "#e6c3c3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 20, "y0": 0, "y1": 1, "yref": "paper" } ], "hoverdistance": -1 }, "datasets": [ { "plot_id": "fastqc_per_sequence_quality_scores_plot", "label": "1", "uid": "fastqc_per_sequence_quality_scores_plot", "dconfig": { "title": "FastQC: Per Sequence Quality Scores
64 samples" }, "layout": { "title": { "text": "FastQC: Per Sequence Quality Scores
64 samples" }, "xaxis": { "hoverformat": ",.0f", "ticksuffix": "", "title": { "text": "Mean Sequence Quality (Phred Score)" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": null }, "range": [ 0, 40.0 ] }, "yaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "Count" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": null } } }, "trace_params": { "hovertemplate": "%{text}
Phred %{x}: %{y} reads", "mode": "lines", "line": { "width": 2 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "n_samples": 64, "lines": [ { "name": "CAFS1_R2", "pairs": [ [ 15.0, 15.0 ], [ 16.0, 225.0 ], [ 17.0, 273.0 ], [ 18.0, 214.0 ], [ 19.0, 181.0 ], [ 20.0, 188.0 ], [ 21.0, 207.0 ], [ 22.0, 219.0 ], [ 23.0, 244.0 ], [ 24.0, 256.0 ], [ 25.0, 272.0 ], [ 26.0, 337.0 ], [ 27.0, 405.0 ], [ 28.0, 485.0 ], [ 29.0, 546.0 ], [ 30.0, 665.0 ], [ 31.0, 742.0 ], [ 32.0, 1021.0 ], [ 33.0, 1365.0 ], [ 34.0, 1782.0 ], [ 35.0, 2507.0 ], [ 36.0, 3805.0 ], [ 37.0, 6801.0 ], [ 38.0, 21178.0 ], [ 39.0, 119225.0 ], [ 40.0, 783.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAFS2_R2", "pairs": [ [ 15.0, 25.0 ], [ 16.0, 178.0 ], [ 17.0, 199.0 ], [ 18.0, 164.0 ], [ 19.0, 162.0 ], [ 20.0, 144.0 ], [ 21.0, 170.0 ], [ 22.0, 156.0 ], [ 23.0, 178.0 ], [ 24.0, 201.0 ], [ 25.0, 225.0 ], [ 26.0, 258.0 ], [ 27.0, 352.0 ], [ 28.0, 401.0 ], [ 29.0, 427.0 ], [ 30.0, 561.0 ], [ 31.0, 655.0 ], [ 32.0, 883.0 ], [ 33.0, 1176.0 ], [ 34.0, 1558.0 ], [ 35.0, 2230.0 ], [ 36.0, 3700.0 ], [ 37.0, 6800.0 ], [ 38.0, 21611.0 ], [ 39.0, 108410.0 ], [ 40.0, 620.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAMS1_R2", "pairs": [ [ 15.0, 27.0 ], [ 16.0, 204.0 ], [ 17.0, 250.0 ], [ 18.0, 191.0 ], [ 19.0, 178.0 ], [ 20.0, 175.0 ], [ 21.0, 184.0 ], [ 22.0, 181.0 ], [ 23.0, 214.0 ], [ 24.0, 249.0 ], [ 25.0, 294.0 ], [ 26.0, 300.0 ], [ 27.0, 364.0 ], [ 28.0, 462.0 ], [ 29.0, 544.0 ], [ 30.0, 686.0 ], [ 31.0, 750.0 ], [ 32.0, 946.0 ], [ 33.0, 1136.0 ], [ 34.0, 1632.0 ], [ 35.0, 2302.0 ], [ 36.0, 3649.0 ], [ 37.0, 6471.0 ], [ 38.0, 20049.0 ], [ 39.0, 104888.0 ], [ 40.0, 652.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAMS2_R2", "pairs": [ [ 15.0, 16.0 ], [ 16.0, 200.0 ], [ 17.0, 279.0 ], [ 18.0, 200.0 ], [ 19.0, 194.0 ], [ 20.0, 174.0 ], [ 21.0, 200.0 ], [ 22.0, 191.0 ], [ 23.0, 221.0 ], [ 24.0, 261.0 ], [ 25.0, 311.0 ], [ 26.0, 332.0 ], [ 27.0, 395.0 ], [ 28.0, 480.0 ], [ 29.0, 548.0 ], [ 30.0, 652.0 ], [ 31.0, 826.0 ], [ 32.0, 1009.0 ], [ 33.0, 1255.0 ], [ 34.0, 1699.0 ], [ 35.0, 2399.0 ], [ 36.0, 3798.0 ], [ 37.0, 7012.0 ], [ 38.0, 21033.0 ], [ 39.0, 122748.0 ], [ 40.0, 841.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCFS1_R2", "pairs": [ [ 14.0, 128.0 ], [ 15.0, 468.0 ], [ 16.0, 941.0 ], [ 17.0, 1363.0 ], [ 18.0, 1621.0 ], [ 19.0, 1288.0 ], [ 20.0, 1256.0 ], [ 21.0, 1488.0 ], [ 22.0, 1785.0 ], [ 23.0, 2242.0 ], [ 24.0, 2912.0 ], [ 25.0, 4115.0 ], [ 26.0, 5732.0 ], [ 27.0, 9122.0 ], [ 28.0, 13826.0 ], [ 29.0, 19820.0 ], [ 30.0, 25696.0 ], [ 31.0, 30474.0 ], [ 32.0, 40747.0 ], [ 33.0, 51632.0 ], [ 34.0, 31.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCFS2_R2", "pairs": [ [ 13.0, 1.0 ], [ 14.0, 99.0 ], [ 15.0, 452.0 ], [ 16.0, 777.0 ], [ 17.0, 1235.0 ], [ 18.0, 1416.0 ], [ 19.0, 1051.0 ], [ 20.0, 1124.0 ], [ 21.0, 1266.0 ], [ 22.0, 1479.0 ], [ 23.0, 1962.0 ], [ 24.0, 2595.0 ], [ 25.0, 3466.0 ], [ 26.0, 5136.0 ], [ 27.0, 7789.0 ], [ 28.0, 12245.0 ], [ 29.0, 18356.0 ], [ 30.0, 24086.0 ], [ 31.0, 29130.0 ], [ 32.0, 38254.0 ], [ 33.0, 51050.0 ], [ 34.0, 30.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCMS1_R2", "pairs": [ [ 13.0, 3.0 ], [ 14.0, 98.0 ], [ 15.0, 499.0 ], [ 16.0, 826.0 ], [ 17.0, 1251.0 ], [ 18.0, 1517.0 ], [ 19.0, 1164.0 ], [ 20.0, 1161.0 ], [ 21.0, 1391.0 ], [ 22.0, 1619.0 ], [ 23.0, 2167.0 ], [ 24.0, 2855.0 ], [ 25.0, 4016.0 ], [ 26.0, 5855.0 ], [ 27.0, 8657.0 ], [ 28.0, 13511.0 ], [ 29.0, 19376.0 ], [ 30.0, 24721.0 ], [ 31.0, 29581.0 ], [ 32.0, 39325.0 ], [ 33.0, 50370.0 ], [ 34.0, 27.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCMS2_R2", "pairs": [ [ 13.0, 2.0 ], [ 14.0, 93.0 ], [ 15.0, 430.0 ], [ 16.0, 754.0 ], [ 17.0, 1174.0 ], [ 18.0, 1449.0 ], [ 19.0, 1071.0 ], [ 20.0, 1035.0 ], [ 21.0, 1165.0 ], [ 22.0, 1492.0 ], [ 23.0, 1829.0 ], [ 24.0, 2506.0 ], [ 25.0, 3404.0 ], [ 26.0, 4951.0 ], [ 27.0, 7677.0 ], [ 28.0, 11804.0 ], [ 29.0, 17399.0 ], [ 30.0, 23469.0 ], [ 31.0, 28462.0 ], [ 32.0, 36865.0 ], [ 33.0, 49863.0 ], [ 34.0, 29.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPFS1_R2", "pairs": [ [ 13.0, 4.0 ], [ 14.0, 105.0 ], [ 15.0, 397.0 ], [ 16.0, 723.0 ], [ 17.0, 973.0 ], [ 18.0, 1165.0 ], [ 19.0, 1020.0 ], [ 20.0, 899.0 ], [ 21.0, 1060.0 ], [ 22.0, 1312.0 ], [ 23.0, 1555.0 ], [ 24.0, 2126.0 ], [ 25.0, 2891.0 ], [ 26.0, 4210.0 ], [ 27.0, 6458.0 ], [ 28.0, 10065.0 ], [ 29.0, 14111.0 ], [ 30.0, 17889.0 ], [ 31.0, 20898.0 ], [ 32.0, 28757.0 ], [ 33.0, 33069.0 ], [ 34.0, 15.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPFS2_R2", "pairs": [ [ 13.0, 4.0 ], [ 14.0, 97.0 ], [ 15.0, 546.0 ], [ 16.0, 1075.0 ], [ 17.0, 1728.0 ], [ 18.0, 1886.0 ], [ 19.0, 1490.0 ], [ 20.0, 1600.0 ], [ 21.0, 1847.0 ], [ 22.0, 2336.0 ], [ 23.0, 3188.0 ], [ 24.0, 4329.0 ], [ 25.0, 6109.0 ], [ 26.0, 8525.0 ], [ 27.0, 12368.0 ], [ 28.0, 15675.0 ], [ 29.0, 17861.0 ], [ 30.0, 18505.0 ], [ 31.0, 19393.0 ], [ 32.0, 33994.0 ], [ 33.0, 26630.0 ], [ 34.0, 6.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPMS1_R2", "pairs": [ [ 13.0, 4.0 ], [ 14.0, 94.0 ], [ 15.0, 486.0 ], [ 16.0, 857.0 ], [ 17.0, 1251.0 ], [ 18.0, 1506.0 ], [ 19.0, 1098.0 ], [ 20.0, 1076.0 ], [ 21.0, 1385.0 ], [ 22.0, 1647.0 ], [ 23.0, 2288.0 ], [ 24.0, 3150.0 ], [ 25.0, 4359.0 ], [ 26.0, 6255.0 ], [ 27.0, 9654.0 ], [ 28.0, 15049.0 ], [ 29.0, 21131.0 ], [ 30.0, 26737.0 ], [ 31.0, 31214.0 ], [ 32.0, 43367.0 ], [ 33.0, 53305.0 ], [ 34.0, 31.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPMS2_R2", "pairs": [ [ 13.0, 2.0 ], [ 14.0, 127.0 ], [ 15.0, 637.0 ], [ 16.0, 1327.0 ], [ 17.0, 2046.0 ], [ 18.0, 2192.0 ], [ 19.0, 1691.0 ], [ 20.0, 1866.0 ], [ 21.0, 2191.0 ], [ 22.0, 2746.0 ], [ 23.0, 3576.0 ], [ 24.0, 5047.0 ], [ 25.0, 6971.0 ], [ 26.0, 10025.0 ], [ 27.0, 13727.0 ], [ 28.0, 17816.0 ], [ 29.0, 20146.0 ], [ 30.0, 20906.0 ], [ 31.0, 22386.0 ], [ 32.0, 38967.0 ], [ 33.0, 30375.0 ], [ 34.0, 10.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVFS1_R2", "pairs": [ [ 2.0, 1.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 2.0 ], [ 14.0, 122.0 ], [ 15.0, 415.0 ], [ 16.0, 797.0 ], [ 17.0, 1311.0 ], [ 18.0, 1589.0 ], [ 19.0, 1230.0 ], [ 20.0, 1314.0 ], [ 21.0, 1397.0 ], [ 22.0, 1819.0 ], [ 23.0, 2397.0 ], [ 24.0, 3144.0 ], [ 25.0, 4472.0 ], [ 26.0, 6255.0 ], [ 27.0, 9264.0 ], [ 28.0, 14555.0 ], [ 29.0, 20119.0 ], [ 30.0, 25676.0 ], [ 31.0, 30323.0 ], [ 32.0, 41563.0 ], [ 33.0, 51613.0 ], [ 34.0, 24.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVFS2_R2", "pairs": [ [ 13.0, 3.0 ], [ 14.0, 124.0 ], [ 15.0, 482.0 ], [ 16.0, 883.0 ], [ 17.0, 1286.0 ], [ 18.0, 1504.0 ], [ 19.0, 1196.0 ], [ 20.0, 1237.0 ], [ 21.0, 1360.0 ], [ 22.0, 1572.0 ], [ 23.0, 2121.0 ], [ 24.0, 2826.0 ], [ 25.0, 3900.0 ], [ 26.0, 5648.0 ], [ 27.0, 8559.0 ], [ 28.0, 13021.0 ], [ 29.0, 18822.0 ], [ 30.0, 24627.0 ], [ 31.0, 28812.0 ], [ 32.0, 38936.0 ], [ 33.0, 49787.0 ], [ 34.0, 32.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVMS1_R2", "pairs": [ [ 13.0, 1.0 ], [ 14.0, 97.0 ], [ 15.0, 394.0 ], [ 16.0, 807.0 ], [ 17.0, 1161.0 ], [ 18.0, 1399.0 ], [ 19.0, 1007.0 ], [ 20.0, 1050.0 ], [ 21.0, 1292.0 ], [ 22.0, 1584.0 ], [ 23.0, 1986.0 ], [ 24.0, 2729.0 ], [ 25.0, 3906.0 ], [ 26.0, 5704.0 ], [ 27.0, 8759.0 ], [ 28.0, 13189.0 ], [ 29.0, 17590.0 ], [ 30.0, 21524.0 ], [ 31.0, 24383.0 ], [ 32.0, 34791.0 ], [ 33.0, 39986.0 ], [ 34.0, 25.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVMS2_R2", "pairs": [ [ 14.0, 123.0 ], [ 15.0, 553.0 ], [ 16.0, 1045.0 ], [ 17.0, 1540.0 ], [ 18.0, 1813.0 ], [ 19.0, 1335.0 ], [ 20.0, 1326.0 ], [ 21.0, 1513.0 ], [ 22.0, 1875.0 ], [ 23.0, 2413.0 ], [ 24.0, 3222.0 ], [ 25.0, 4544.0 ], [ 26.0, 6549.0 ], [ 27.0, 10051.0 ], [ 28.0, 15337.0 ], [ 29.0, 21685.0 ], [ 30.0, 27313.0 ], [ 31.0, 31396.0 ], [ 32.0, 42761.0 ], [ 33.0, 51930.0 ], [ 34.0, 31.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAFS1_R2", "pairs": [ [ 14.0, 2.0 ], [ 15.0, 24.0 ], [ 16.0, 143.0 ], [ 17.0, 177.0 ], [ 18.0, 145.0 ], [ 19.0, 111.0 ], [ 20.0, 118.0 ], [ 21.0, 112.0 ], [ 22.0, 123.0 ], [ 23.0, 146.0 ], [ 24.0, 150.0 ], [ 25.0, 165.0 ], [ 26.0, 202.0 ], [ 27.0, 243.0 ], [ 28.0, 275.0 ], [ 29.0, 315.0 ], [ 30.0, 407.0 ], [ 31.0, 451.0 ], [ 32.0, 510.0 ], [ 33.0, 726.0 ], [ 34.0, 923.0 ], [ 35.0, 1314.0 ], [ 36.0, 2110.0 ], [ 37.0, 3814.0 ], [ 38.0, 11321.0 ], [ 39.0, 65409.0 ], [ 40.0, 483.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAFS2_R2", "pairs": [ [ 15.0, 5.0 ], [ 16.0, 56.0 ], [ 17.0, 52.0 ], [ 18.0, 34.0 ], [ 19.0, 52.0 ], [ 20.0, 43.0 ], [ 21.0, 42.0 ], [ 22.0, 37.0 ], [ 23.0, 55.0 ], [ 24.0, 45.0 ], [ 25.0, 91.0 ], [ 26.0, 73.0 ], [ 27.0, 94.0 ], [ 28.0, 110.0 ], [ 29.0, 128.0 ], [ 30.0, 140.0 ], [ 31.0, 163.0 ], [ 32.0, 232.0 ], [ 33.0, 275.0 ], [ 34.0, 402.0 ], [ 35.0, 563.0 ], [ 36.0, 871.0 ], [ 37.0, 1507.0 ], [ 38.0, 4847.0 ], [ 39.0, 27400.0 ], [ 40.0, 203.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAMS1_R2", "pairs": [ [ 15.0, 14.0 ], [ 16.0, 107.0 ], [ 17.0, 137.0 ], [ 18.0, 89.0 ], [ 19.0, 71.0 ], [ 20.0, 72.0 ], [ 21.0, 67.0 ], [ 22.0, 73.0 ], [ 23.0, 77.0 ], [ 24.0, 102.0 ], [ 25.0, 94.0 ], [ 26.0, 120.0 ], [ 27.0, 162.0 ], [ 28.0, 175.0 ], [ 29.0, 219.0 ], [ 30.0, 249.0 ], [ 31.0, 282.0 ], [ 32.0, 376.0 ], [ 33.0, 488.0 ], [ 34.0, 636.0 ], [ 35.0, 913.0 ], [ 36.0, 1363.0 ], [ 37.0, 2596.0 ], [ 38.0, 7220.0 ], [ 39.0, 47357.0 ], [ 40.0, 567.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAMS2_R2", "pairs": [ [ 15.0, 35.0 ], [ 16.0, 181.0 ], [ 17.0, 173.0 ], [ 18.0, 120.0 ], [ 19.0, 111.0 ], [ 20.0, 89.0 ], [ 21.0, 114.0 ], [ 22.0, 120.0 ], [ 23.0, 116.0 ], [ 24.0, 127.0 ], [ 25.0, 153.0 ], [ 26.0, 167.0 ], [ 27.0, 203.0 ], [ 28.0, 246.0 ], [ 29.0, 289.0 ], [ 30.0, 356.0 ], [ 31.0, 402.0 ], [ 32.0, 478.0 ], [ 33.0, 580.0 ], [ 34.0, 799.0 ], [ 35.0, 1158.0 ], [ 36.0, 1716.0 ], [ 37.0, 3123.0 ], [ 38.0, 8617.0 ], [ 39.0, 60484.0 ], [ 40.0, 862.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCFS1_R2", "pairs": [ [ 2.0, 3.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 3.0 ], [ 14.0, 78.0 ], [ 15.0, 351.0 ], [ 16.0, 604.0 ], [ 17.0, 972.0 ], [ 18.0, 1115.0 ], [ 19.0, 765.0 ], [ 20.0, 819.0 ], [ 21.0, 974.0 ], [ 22.0, 1134.0 ], [ 23.0, 1468.0 ], [ 24.0, 1912.0 ], [ 25.0, 2492.0 ], [ 26.0, 3816.0 ], [ 27.0, 5814.0 ], [ 28.0, 8657.0 ], [ 29.0, 11873.0 ], [ 30.0, 14350.0 ], [ 31.0, 15581.0 ], [ 32.0, 22064.0 ], [ 33.0, 27850.0 ], [ 34.0, 41.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCFS2_R2", "pairs": [ [ 13.0, 3.0 ], [ 14.0, 43.0 ], [ 15.0, 187.0 ], [ 16.0, 307.0 ], [ 17.0, 498.0 ], [ 18.0, 630.0 ], [ 19.0, 445.0 ], [ 20.0, 492.0 ], [ 21.0, 541.0 ], [ 22.0, 610.0 ], [ 23.0, 775.0 ], [ 24.0, 1000.0 ], [ 25.0, 1323.0 ], [ 26.0, 1880.0 ], [ 27.0, 2950.0 ], [ 28.0, 4491.0 ], [ 29.0, 6302.0 ], [ 30.0, 8074.0 ], [ 31.0, 9594.0 ], [ 32.0, 12666.0 ], [ 33.0, 18387.0 ], [ 34.0, 87.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCMS1_R2", "pairs": [ [ 13.0, 6.0 ], [ 14.0, 162.0 ], [ 15.0, 749.0 ], [ 16.0, 1206.0 ], [ 17.0, 1870.0 ], [ 18.0, 2242.0 ], [ 19.0, 1545.0 ], [ 20.0, 1628.0 ], [ 21.0, 1847.0 ], [ 22.0, 2230.0 ], [ 23.0, 2834.0 ], [ 24.0, 3694.0 ], [ 25.0, 5080.0 ], [ 26.0, 7358.0 ], [ 27.0, 11343.0 ], [ 28.0, 17123.0 ], [ 29.0, 23536.0 ], [ 30.0, 28126.0 ], [ 31.0, 30541.0 ], [ 32.0, 43449.0 ], [ 33.0, 55026.0 ], [ 34.0, 84.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCMS2_R2", "pairs": [ [ 13.0, 1.0 ], [ 14.0, 52.0 ], [ 15.0, 258.0 ], [ 16.0, 412.0 ], [ 17.0, 640.0 ], [ 18.0, 795.0 ], [ 19.0, 568.0 ], [ 20.0, 507.0 ], [ 21.0, 617.0 ], [ 22.0, 783.0 ], [ 23.0, 1026.0 ], [ 24.0, 1228.0 ], [ 25.0, 1797.0 ], [ 26.0, 2523.0 ], [ 27.0, 3854.0 ], [ 28.0, 6023.0 ], [ 29.0, 8600.0 ], [ 30.0, 10690.0 ], [ 31.0, 12483.0 ], [ 32.0, 16861.0 ], [ 33.0, 24339.0 ], [ 34.0, 144.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPFS1_R2", "pairs": [ [ 14.0, 125.0 ], [ 15.0, 411.0 ], [ 16.0, 670.0 ], [ 17.0, 1015.0 ], [ 18.0, 1271.0 ], [ 19.0, 858.0 ], [ 20.0, 932.0 ], [ 21.0, 1098.0 ], [ 22.0, 1214.0 ], [ 23.0, 1521.0 ], [ 24.0, 1982.0 ], [ 25.0, 2743.0 ], [ 26.0, 3949.0 ], [ 27.0, 6265.0 ], [ 28.0, 9747.0 ], [ 29.0, 13605.0 ], [ 30.0, 16682.0 ], [ 31.0, 18565.0 ], [ 32.0, 26366.0 ], [ 33.0, 32899.0 ], [ 34.0, 40.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPFS2_R2", "pairs": [ [ 13.0, 1.0 ], [ 14.0, 70.0 ], [ 15.0, 373.0 ], [ 16.0, 574.0 ], [ 17.0, 1026.0 ], [ 18.0, 1169.0 ], [ 19.0, 827.0 ], [ 20.0, 897.0 ], [ 21.0, 1036.0 ], [ 22.0, 1184.0 ], [ 23.0, 1490.0 ], [ 24.0, 1988.0 ], [ 25.0, 2774.0 ], [ 26.0, 4014.0 ], [ 27.0, 6228.0 ], [ 28.0, 9633.0 ], [ 29.0, 12962.0 ], [ 30.0, 15536.0 ], [ 31.0, 16755.0 ], [ 32.0, 24727.0 ], [ 33.0, 28731.0 ], [ 34.0, 112.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPMS1_R2", "pairs": [ [ 13.0, 1.0 ], [ 14.0, 26.0 ], [ 15.0, 105.0 ], [ 16.0, 130.0 ], [ 17.0, 187.0 ], [ 18.0, 215.0 ], [ 19.0, 250.0 ], [ 20.0, 245.0 ], [ 21.0, 319.0 ], [ 22.0, 426.0 ], [ 23.0, 495.0 ], [ 24.0, 680.0 ], [ 25.0, 913.0 ], [ 26.0, 1313.0 ], [ 27.0, 1979.0 ], [ 28.0, 3347.0 ], [ 29.0, 5138.0 ], [ 30.0, 8234.0 ], [ 31.0, 12779.0 ], [ 32.0, 15354.0 ], [ 33.0, 29755.0 ], [ 34.0, 112.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPMS2_R2", "pairs": [ [ 13.0, 2.0 ], [ 14.0, 52.0 ], [ 15.0, 210.0 ], [ 16.0, 440.0 ], [ 17.0, 649.0 ], [ 18.0, 725.0 ], [ 19.0, 548.0 ], [ 20.0, 552.0 ], [ 21.0, 655.0 ], [ 22.0, 804.0 ], [ 23.0, 1067.0 ], [ 24.0, 1408.0 ], [ 25.0, 1944.0 ], [ 26.0, 2917.0 ], [ 27.0, 4427.0 ], [ 28.0, 6487.0 ], [ 29.0, 8720.0 ], [ 30.0, 10081.0 ], [ 31.0, 10966.0 ], [ 32.0, 16694.0 ], [ 33.0, 17399.0 ], [ 34.0, 43.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVFS1_R2", "pairs": [ [ 14.0, 58.0 ], [ 15.0, 187.0 ], [ 16.0, 331.0 ], [ 17.0, 512.0 ], [ 18.0, 616.0 ], [ 19.0, 506.0 ], [ 20.0, 478.0 ], [ 21.0, 527.0 ], [ 22.0, 596.0 ], [ 23.0, 821.0 ], [ 24.0, 1055.0 ], [ 25.0, 1389.0 ], [ 26.0, 2194.0 ], [ 27.0, 3360.0 ], [ 28.0, 5100.0 ], [ 29.0, 7055.0 ], [ 30.0, 8493.0 ], [ 31.0, 9282.0 ], [ 32.0, 13241.0 ], [ 33.0, 16131.0 ], [ 34.0, 28.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVFS2_R2", "pairs": [ [ 13.0, 2.0 ], [ 14.0, 66.0 ], [ 15.0, 262.0 ], [ 16.0, 475.0 ], [ 17.0, 798.0 ], [ 18.0, 931.0 ], [ 19.0, 618.0 ], [ 20.0, 643.0 ], [ 21.0, 717.0 ], [ 22.0, 857.0 ], [ 23.0, 1144.0 ], [ 24.0, 1481.0 ], [ 25.0, 2006.0 ], [ 26.0, 2971.0 ], [ 27.0, 4518.0 ], [ 28.0, 6912.0 ], [ 29.0, 9575.0 ], [ 30.0, 11660.0 ], [ 31.0, 13271.0 ], [ 32.0, 18216.0 ], [ 33.0, 24289.0 ], [ 34.0, 72.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVMS1_R2", "pairs": [ [ 13.0, 4.0 ], [ 14.0, 125.0 ], [ 15.0, 452.0 ], [ 16.0, 771.0 ], [ 17.0, 1165.0 ], [ 18.0, 1408.0 ], [ 19.0, 1042.0 ], [ 20.0, 1060.0 ], [ 21.0, 1202.0 ], [ 22.0, 1510.0 ], [ 23.0, 1980.0 ], [ 24.0, 2440.0 ], [ 25.0, 3542.0 ], [ 26.0, 5037.0 ], [ 27.0, 7771.0 ], [ 28.0, 11537.0 ], [ 29.0, 15931.0 ], [ 30.0, 19249.0 ], [ 31.0, 21454.0 ], [ 32.0, 30878.0 ], [ 33.0, 37245.0 ], [ 34.0, 56.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVMS2_R2", "pairs": [ [ 2.0, 1.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 122.0 ], [ 15.0, 449.0 ], [ 16.0, 723.0 ], [ 17.0, 1148.0 ], [ 18.0, 1320.0 ], [ 19.0, 927.0 ], [ 20.0, 1013.0 ], [ 21.0, 1163.0 ], [ 22.0, 1335.0 ], [ 23.0, 1733.0 ], [ 24.0, 2235.0 ], [ 25.0, 3114.0 ], [ 26.0, 4474.0 ], [ 27.0, 6892.0 ], [ 28.0, 10697.0 ], [ 29.0, 14813.0 ], [ 30.0, 18502.0 ], [ 31.0, 21502.0 ], [ 32.0, 29477.0 ], [ 33.0, 39347.0 ], [ 34.0, 72.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAFS1_R2", "pairs": [ [ 14.0, 1.0 ], [ 15.0, 38.0 ], [ 16.0, 279.0 ], [ 17.0, 301.0 ], [ 18.0, 253.0 ], [ 19.0, 232.0 ], [ 20.0, 196.0 ], [ 21.0, 219.0 ], [ 22.0, 209.0 ], [ 23.0, 235.0 ], [ 24.0, 305.0 ], [ 25.0, 348.0 ], [ 26.0, 386.0 ], [ 27.0, 500.0 ], [ 28.0, 542.0 ], [ 29.0, 654.0 ], [ 30.0, 792.0 ], [ 31.0, 883.0 ], [ 32.0, 1061.0 ], [ 33.0, 1403.0 ], [ 34.0, 1867.0 ], [ 35.0, 2633.0 ], [ 36.0, 4062.0 ], [ 37.0, 7419.0 ], [ 38.0, 23784.0 ], [ 39.0, 115307.0 ], [ 40.0, 573.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAFS2_R2", "pairs": [ [ 15.0, 33.0 ], [ 16.0, 206.0 ], [ 17.0, 197.0 ], [ 18.0, 161.0 ], [ 19.0, 158.0 ], [ 20.0, 146.0 ], [ 21.0, 157.0 ], [ 22.0, 148.0 ], [ 23.0, 197.0 ], [ 24.0, 222.0 ], [ 25.0, 221.0 ], [ 26.0, 270.0 ], [ 27.0, 285.0 ], [ 28.0, 377.0 ], [ 29.0, 412.0 ], [ 30.0, 522.0 ], [ 31.0, 529.0 ], [ 32.0, 736.0 ], [ 33.0, 946.0 ], [ 34.0, 1340.0 ], [ 35.0, 1821.0 ], [ 36.0, 2864.0 ], [ 37.0, 5150.0 ], [ 38.0, 15991.0 ], [ 39.0, 94193.0 ], [ 40.0, 503.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAMS1_R2", "pairs": [ [ 15.0, 31.0 ], [ 16.0, 261.0 ], [ 17.0, 271.0 ], [ 18.0, 246.0 ], [ 19.0, 176.0 ], [ 20.0, 194.0 ], [ 21.0, 206.0 ], [ 22.0, 208.0 ], [ 23.0, 216.0 ], [ 24.0, 257.0 ], [ 25.0, 310.0 ], [ 26.0, 377.0 ], [ 27.0, 437.0 ], [ 28.0, 472.0 ], [ 29.0, 572.0 ], [ 30.0, 697.0 ], [ 31.0, 847.0 ], [ 32.0, 1062.0 ], [ 33.0, 1316.0 ], [ 34.0, 1761.0 ], [ 35.0, 2555.0 ], [ 36.0, 3941.0 ], [ 37.0, 7197.0 ], [ 38.0, 22822.0 ], [ 39.0, 104916.0 ], [ 40.0, 382.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAMS2_R2", "pairs": [ [ 15.0, 21.0 ], [ 16.0, 221.0 ], [ 17.0, 252.0 ], [ 18.0, 212.0 ], [ 19.0, 194.0 ], [ 20.0, 183.0 ], [ 21.0, 185.0 ], [ 22.0, 204.0 ], [ 23.0, 269.0 ], [ 24.0, 269.0 ], [ 25.0, 289.0 ], [ 26.0, 352.0 ], [ 27.0, 438.0 ], [ 28.0, 464.0 ], [ 29.0, 620.0 ], [ 30.0, 634.0 ], [ 31.0, 806.0 ], [ 32.0, 941.0 ], [ 33.0, 1217.0 ], [ 34.0, 1646.0 ], [ 35.0, 2301.0 ], [ 36.0, 3581.0 ], [ 37.0, 6397.0 ], [ 38.0, 20160.0 ], [ 39.0, 109176.0 ], [ 40.0, 641.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICFS1_R2", "pairs": [ [ 14.0, 136.0 ], [ 15.0, 474.0 ], [ 16.0, 684.0 ], [ 17.0, 1032.0 ], [ 18.0, 1150.0 ], [ 19.0, 890.0 ], [ 20.0, 976.0 ], [ 21.0, 1068.0 ], [ 22.0, 1262.0 ], [ 23.0, 1664.0 ], [ 24.0, 2127.0 ], [ 25.0, 2897.0 ], [ 26.0, 4241.0 ], [ 27.0, 6575.0 ], [ 28.0, 9732.0 ], [ 29.0, 13369.0 ], [ 30.0, 16494.0 ], [ 31.0, 18176.0 ], [ 32.0, 25846.0 ], [ 33.0, 31072.0 ], [ 34.0, 44.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICFS2_R2", "pairs": [ [ 13.0, 4.0 ], [ 14.0, 115.0 ], [ 15.0, 421.0 ], [ 16.0, 861.0 ], [ 17.0, 1158.0 ], [ 18.0, 1422.0 ], [ 19.0, 1114.0 ], [ 20.0, 1140.0 ], [ 21.0, 1258.0 ], [ 22.0, 1516.0 ], [ 23.0, 1983.0 ], [ 24.0, 2796.0 ], [ 25.0, 3959.0 ], [ 26.0, 5612.0 ], [ 27.0, 8780.0 ], [ 28.0, 12837.0 ], [ 29.0, 17040.0 ], [ 30.0, 20524.0 ], [ 31.0, 22239.0 ], [ 32.0, 33548.0 ], [ 33.0, 34467.0 ], [ 34.0, 22.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICMS1_R2", "pairs": [ [ 13.0, 4.0 ], [ 14.0, 142.0 ], [ 15.0, 573.0 ], [ 16.0, 979.0 ], [ 17.0, 1377.0 ], [ 18.0, 1616.0 ], [ 19.0, 1298.0 ], [ 20.0, 1252.0 ], [ 21.0, 1462.0 ], [ 22.0, 1745.0 ], [ 23.0, 2332.0 ], [ 24.0, 3158.0 ], [ 25.0, 4205.0 ], [ 26.0, 6089.0 ], [ 27.0, 9502.0 ], [ 28.0, 14134.0 ], [ 29.0, 19033.0 ], [ 30.0, 22845.0 ], [ 31.0, 25222.0 ], [ 32.0, 36714.0 ], [ 33.0, 41182.0 ], [ 34.0, 13.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICMS2_R2", "pairs": [ [ 13.0, 2.0 ], [ 14.0, 65.0 ], [ 15.0, 354.0 ], [ 16.0, 708.0 ], [ 17.0, 1029.0 ], [ 18.0, 1182.0 ], [ 19.0, 871.0 ], [ 20.0, 861.0 ], [ 21.0, 1044.0 ], [ 22.0, 1385.0 ], [ 23.0, 1927.0 ], [ 24.0, 2528.0 ], [ 25.0, 3590.0 ], [ 26.0, 5275.0 ], [ 27.0, 7950.0 ], [ 28.0, 10761.0 ], [ 29.0, 13021.0 ], [ 30.0, 13752.0 ], [ 31.0, 14805.0 ], [ 32.0, 25444.0 ], [ 33.0, 19110.0 ], [ 34.0, 1.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPFS1_R2", "pairs": [ [ 13.0, 3.0 ], [ 14.0, 130.0 ], [ 15.0, 443.0 ], [ 16.0, 776.0 ], [ 17.0, 1217.0 ], [ 18.0, 1486.0 ], [ 19.0, 1036.0 ], [ 20.0, 1117.0 ], [ 21.0, 1267.0 ], [ 22.0, 1507.0 ], [ 23.0, 1934.0 ], [ 24.0, 2569.0 ], [ 25.0, 3524.0 ], [ 26.0, 5053.0 ], [ 27.0, 7976.0 ], [ 28.0, 11676.0 ], [ 29.0, 16004.0 ], [ 30.0, 18892.0 ], [ 31.0, 20346.0 ], [ 32.0, 28695.0 ], [ 33.0, 35290.0 ], [ 34.0, 21.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPFS2_R2", "pairs": [ [ 13.0, 2.0 ], [ 14.0, 98.0 ], [ 15.0, 572.0 ], [ 16.0, 1027.0 ], [ 17.0, 1502.0 ], [ 18.0, 1745.0 ], [ 19.0, 1320.0 ], [ 20.0, 1346.0 ], [ 21.0, 1468.0 ], [ 22.0, 1916.0 ], [ 23.0, 2403.0 ], [ 24.0, 3152.0 ], [ 25.0, 4497.0 ], [ 26.0, 6380.0 ], [ 27.0, 9615.0 ], [ 28.0, 14694.0 ], [ 29.0, 20590.0 ], [ 30.0, 26613.0 ], [ 31.0, 30826.0 ], [ 32.0, 42106.0 ], [ 33.0, 52533.0 ], [ 34.0, 23.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPMS1_R2", "pairs": [ [ 13.0, 10.0 ], [ 14.0, 240.0 ], [ 15.0, 1014.0 ], [ 16.0, 1900.0 ], [ 17.0, 2712.0 ], [ 18.0, 3140.0 ], [ 19.0, 2375.0 ], [ 20.0, 2411.0 ], [ 21.0, 2848.0 ], [ 22.0, 3642.0 ], [ 23.0, 4687.0 ], [ 24.0, 6573.0 ], [ 25.0, 8764.0 ], [ 26.0, 13412.0 ], [ 27.0, 20338.0 ], [ 28.0, 28556.0 ], [ 29.0, 35306.0 ], [ 30.0, 38490.0 ], [ 31.0, 40820.0 ], [ 32.0, 67512.0 ], [ 33.0, 60977.0 ], [ 34.0, 32.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPMS2_R2", "pairs": [ [ 13.0, 3.0 ], [ 14.0, 150.0 ], [ 15.0, 685.0 ], [ 16.0, 1310.0 ], [ 17.0, 1769.0 ], [ 18.0, 2064.0 ], [ 19.0, 1612.0 ], [ 20.0, 1564.0 ], [ 21.0, 1796.0 ], [ 22.0, 2231.0 ], [ 23.0, 2885.0 ], [ 24.0, 3738.0 ], [ 25.0, 5038.0 ], [ 26.0, 7361.0 ], [ 27.0, 11160.0 ], [ 28.0, 16645.0 ], [ 29.0, 22531.0 ], [ 30.0, 28370.0 ], [ 31.0, 32211.0 ], [ 32.0, 44576.0 ], [ 33.0, 56353.0 ], [ 34.0, 37.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVFS1_R2", "pairs": [ [ 13.0, 5.0 ], [ 14.0, 177.0 ], [ 15.0, 700.0 ], [ 16.0, 1129.0 ], [ 17.0, 1685.0 ], [ 18.0, 2102.0 ], [ 19.0, 1429.0 ], [ 20.0, 1502.0 ], [ 21.0, 1647.0 ], [ 22.0, 2130.0 ], [ 23.0, 2893.0 ], [ 24.0, 3857.0 ], [ 25.0, 5330.0 ], [ 26.0, 8077.0 ], [ 27.0, 12657.0 ], [ 28.0, 18767.0 ], [ 29.0, 23772.0 ], [ 30.0, 26570.0 ], [ 31.0, 28340.0 ], [ 32.0, 43875.0 ], [ 33.0, 42284.0 ], [ 34.0, 15.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVFS2_R2", "pairs": [ [ 14.0, 100.0 ], [ 15.0, 327.0 ], [ 16.0, 543.0 ], [ 17.0, 873.0 ], [ 18.0, 1110.0 ], [ 19.0, 746.0 ], [ 20.0, 770.0 ], [ 21.0, 886.0 ], [ 22.0, 1101.0 ], [ 23.0, 1397.0 ], [ 24.0, 1869.0 ], [ 25.0, 2500.0 ], [ 26.0, 3580.0 ], [ 27.0, 5337.0 ], [ 28.0, 8321.0 ], [ 29.0, 11720.0 ], [ 30.0, 14812.0 ], [ 31.0, 16751.0 ], [ 32.0, 22670.0 ], [ 33.0, 31962.0 ], [ 34.0, 45.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVMS1_R2", "pairs": [ [ 13.0, 3.0 ], [ 14.0, 137.0 ], [ 15.0, 560.0 ], [ 16.0, 930.0 ], [ 17.0, 1337.0 ], [ 18.0, 1555.0 ], [ 19.0, 1045.0 ], [ 20.0, 1154.0 ], [ 21.0, 1363.0 ], [ 22.0, 1794.0 ], [ 23.0, 2230.0 ], [ 24.0, 3189.0 ], [ 25.0, 4362.0 ], [ 26.0, 6308.0 ], [ 27.0, 9495.0 ], [ 28.0, 13290.0 ], [ 29.0, 15777.0 ], [ 30.0, 17231.0 ], [ 31.0, 18206.0 ], [ 32.0, 29905.0 ], [ 33.0, 26223.0 ], [ 34.0, 25.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVMS2_R2", "pairs": [ [ 13.0, 3.0 ], [ 14.0, 76.0 ], [ 15.0, 319.0 ], [ 16.0, 550.0 ], [ 17.0, 832.0 ], [ 18.0, 1021.0 ], [ 19.0, 710.0 ], [ 20.0, 715.0 ], [ 21.0, 822.0 ], [ 22.0, 1056.0 ], [ 23.0, 1286.0 ], [ 24.0, 1684.0 ], [ 25.0, 2269.0 ], [ 26.0, 3344.0 ], [ 27.0, 5093.0 ], [ 28.0, 7590.0 ], [ 29.0, 10282.0 ], [ 30.0, 12496.0 ], [ 31.0, 13996.0 ], [ 32.0, 19507.0 ], [ 33.0, 26065.0 ], [ 34.0, 21.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAFS1_R2", "pairs": [ [ 15.0, 30.0 ], [ 16.0, 257.0 ], [ 17.0, 237.0 ], [ 18.0, 172.0 ], [ 19.0, 161.0 ], [ 20.0, 140.0 ], [ 21.0, 154.0 ], [ 22.0, 188.0 ], [ 23.0, 192.0 ], [ 24.0, 197.0 ], [ 25.0, 226.0 ], [ 26.0, 269.0 ], [ 27.0, 312.0 ], [ 28.0, 403.0 ], [ 29.0, 439.0 ], [ 30.0, 495.0 ], [ 31.0, 656.0 ], [ 32.0, 740.0 ], [ 33.0, 969.0 ], [ 34.0, 1360.0 ], [ 35.0, 1925.0 ], [ 36.0, 3038.0 ], [ 37.0, 5515.0 ], [ 38.0, 16307.0 ], [ 39.0, 97293.0 ], [ 40.0, 695.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAFS2_R2", "pairs": [ [ 15.0, 19.0 ], [ 16.0, 134.0 ], [ 17.0, 124.0 ], [ 18.0, 95.0 ], [ 19.0, 89.0 ], [ 20.0, 72.0 ], [ 21.0, 99.0 ], [ 22.0, 103.0 ], [ 23.0, 101.0 ], [ 24.0, 140.0 ], [ 25.0, 146.0 ], [ 26.0, 151.0 ], [ 27.0, 194.0 ], [ 28.0, 220.0 ], [ 29.0, 250.0 ], [ 30.0, 311.0 ], [ 31.0, 407.0 ], [ 32.0, 460.0 ], [ 33.0, 559.0 ], [ 34.0, 843.0 ], [ 35.0, 1158.0 ], [ 36.0, 1836.0 ], [ 37.0, 3260.0 ], [ 38.0, 9577.0 ], [ 39.0, 63354.0 ], [ 40.0, 447.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAMS1_R2", "pairs": [ [ 15.0, 46.0 ], [ 16.0, 276.0 ], [ 17.0, 284.0 ], [ 18.0, 189.0 ], [ 19.0, 182.0 ], [ 20.0, 164.0 ], [ 21.0, 164.0 ], [ 22.0, 217.0 ], [ 23.0, 181.0 ], [ 24.0, 204.0 ], [ 25.0, 281.0 ], [ 26.0, 326.0 ], [ 27.0, 327.0 ], [ 28.0, 421.0 ], [ 29.0, 534.0 ], [ 30.0, 585.0 ], [ 31.0, 675.0 ], [ 32.0, 883.0 ], [ 33.0, 1055.0 ], [ 34.0, 1515.0 ], [ 35.0, 2060.0 ], [ 36.0, 3162.0 ], [ 37.0, 5447.0 ], [ 38.0, 15022.0 ], [ 39.0, 126724.0 ], [ 40.0, 2519.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAMS2_R2", "pairs": [ [ 14.0, 2.0 ], [ 15.0, 59.0 ], [ 16.0, 271.0 ], [ 17.0, 278.0 ], [ 18.0, 192.0 ], [ 19.0, 157.0 ], [ 20.0, 188.0 ], [ 21.0, 164.0 ], [ 22.0, 182.0 ], [ 23.0, 194.0 ], [ 24.0, 244.0 ], [ 25.0, 282.0 ], [ 26.0, 300.0 ], [ 27.0, 319.0 ], [ 28.0, 377.0 ], [ 29.0, 434.0 ], [ 30.0, 560.0 ], [ 31.0, 676.0 ], [ 32.0, 810.0 ], [ 33.0, 1090.0 ], [ 34.0, 1371.0 ], [ 35.0, 2001.0 ], [ 36.0, 2910.0 ], [ 37.0, 5076.0 ], [ 38.0, 14030.0 ], [ 39.0, 113635.0 ], [ 40.0, 1943.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCFS1_R2", "pairs": [ [ 13.0, 1.0 ], [ 14.0, 135.0 ], [ 15.0, 457.0 ], [ 16.0, 875.0 ], [ 17.0, 1425.0 ], [ 18.0, 1681.0 ], [ 19.0, 1202.0 ], [ 20.0, 1271.0 ], [ 21.0, 1441.0 ], [ 22.0, 1713.0 ], [ 23.0, 2102.0 ], [ 24.0, 2782.0 ], [ 25.0, 3844.0 ], [ 26.0, 5442.0 ], [ 27.0, 8206.0 ], [ 28.0, 12275.0 ], [ 29.0, 17524.0 ], [ 30.0, 21762.0 ], [ 31.0, 24549.0 ], [ 32.0, 32604.0 ], [ 33.0, 46917.0 ], [ 34.0, 36.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCFS2_R2", "pairs": [ [ 14.0, 120.0 ], [ 15.0, 397.0 ], [ 16.0, 733.0 ], [ 17.0, 1160.0 ], [ 18.0, 1404.0 ], [ 19.0, 891.0 ], [ 20.0, 1043.0 ], [ 21.0, 1065.0 ], [ 22.0, 1296.0 ], [ 23.0, 1608.0 ], [ 24.0, 2152.0 ], [ 25.0, 2943.0 ], [ 26.0, 4155.0 ], [ 27.0, 6403.0 ], [ 28.0, 9654.0 ], [ 29.0, 13708.0 ], [ 30.0, 17583.0 ], [ 31.0, 20403.0 ], [ 32.0, 26371.0 ], [ 33.0, 39083.0 ], [ 34.0, 32.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCMS1_R2", "pairs": [ [ 13.0, 2.0 ], [ 14.0, 103.0 ], [ 15.0, 372.0 ], [ 16.0, 785.0 ], [ 17.0, 1193.0 ], [ 18.0, 1361.0 ], [ 19.0, 950.0 ], [ 20.0, 987.0 ], [ 21.0, 1200.0 ], [ 22.0, 1416.0 ], [ 23.0, 1686.0 ], [ 24.0, 2241.0 ], [ 25.0, 3201.0 ], [ 26.0, 4538.0 ], [ 27.0, 7100.0 ], [ 28.0, 10635.0 ], [ 29.0, 14919.0 ], [ 30.0, 18915.0 ], [ 31.0, 20798.0 ], [ 32.0, 28393.0 ], [ 33.0, 40558.0 ], [ 34.0, 34.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCMS2_R2", "pairs": [ [ 13.0, 4.0 ], [ 14.0, 68.0 ], [ 15.0, 344.0 ], [ 16.0, 607.0 ], [ 17.0, 868.0 ], [ 18.0, 1071.0 ], [ 19.0, 787.0 ], [ 20.0, 775.0 ], [ 21.0, 878.0 ], [ 22.0, 1054.0 ], [ 23.0, 1286.0 ], [ 24.0, 1822.0 ], [ 25.0, 2363.0 ], [ 26.0, 3446.0 ], [ 27.0, 5271.0 ], [ 28.0, 8292.0 ], [ 29.0, 11870.0 ], [ 30.0, 15068.0 ], [ 31.0, 17346.0 ], [ 32.0, 22427.0 ], [ 33.0, 31782.0 ], [ 34.0, 23.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPFS1_R2", "pairs": [ [ 13.0, 4.0 ], [ 14.0, 135.0 ], [ 15.0, 606.0 ], [ 16.0, 1025.0 ], [ 17.0, 1607.0 ], [ 18.0, 2126.0 ], [ 19.0, 1325.0 ], [ 20.0, 1501.0 ], [ 21.0, 1738.0 ], [ 22.0, 2060.0 ], [ 23.0, 2594.0 ], [ 24.0, 3349.0 ], [ 25.0, 4693.0 ], [ 26.0, 6648.0 ], [ 27.0, 10066.0 ], [ 28.0, 15173.0 ], [ 29.0, 21765.0 ], [ 30.0, 27762.0 ], [ 31.0, 30853.0 ], [ 32.0, 41248.0 ], [ 33.0, 57309.0 ], [ 34.0, 36.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPFS2_R2", "pairs": [ [ 13.0, 2.0 ], [ 14.0, 105.0 ], [ 15.0, 485.0 ], [ 16.0, 886.0 ], [ 17.0, 1363.0 ], [ 18.0, 1624.0 ], [ 19.0, 1103.0 ], [ 20.0, 1230.0 ], [ 21.0, 1349.0 ], [ 22.0, 1648.0 ], [ 23.0, 2145.0 ], [ 24.0, 2750.0 ], [ 25.0, 3707.0 ], [ 26.0, 5346.0 ], [ 27.0, 8414.0 ], [ 28.0, 12902.0 ], [ 29.0, 18347.0 ], [ 30.0, 23824.0 ], [ 31.0, 27313.0 ], [ 32.0, 35950.0 ], [ 33.0, 51246.0 ], [ 34.0, 33.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPMS1_R2", "pairs": [ [ 13.0, 2.0 ], [ 14.0, 131.0 ], [ 15.0, 537.0 ], [ 16.0, 988.0 ], [ 17.0, 1440.0 ], [ 18.0, 1806.0 ], [ 19.0, 1229.0 ], [ 20.0, 1338.0 ], [ 21.0, 1531.0 ], [ 22.0, 1855.0 ], [ 23.0, 2276.0 ], [ 24.0, 3017.0 ], [ 25.0, 4007.0 ], [ 26.0, 5958.0 ], [ 27.0, 9247.0 ], [ 28.0, 14151.0 ], [ 29.0, 19930.0 ], [ 30.0, 25021.0 ], [ 31.0, 27902.0 ], [ 32.0, 38550.0 ], [ 33.0, 50358.0 ], [ 34.0, 29.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPMS2_R2", "pairs": [ [ 13.0, 3.0 ], [ 14.0, 78.0 ], [ 15.0, 294.0 ], [ 16.0, 557.0 ], [ 17.0, 866.0 ], [ 18.0, 1149.0 ], [ 19.0, 743.0 ], [ 20.0, 797.0 ], [ 21.0, 893.0 ], [ 22.0, 1085.0 ], [ 23.0, 1481.0 ], [ 24.0, 1899.0 ], [ 25.0, 2503.0 ], [ 26.0, 3718.0 ], [ 27.0, 5774.0 ], [ 28.0, 8720.0 ], [ 29.0, 12513.0 ], [ 30.0, 15894.0 ], [ 31.0, 17654.0 ], [ 32.0, 24346.0 ], [ 33.0, 33199.0 ], [ 34.0, 25.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVFS1_R2", "pairs": [ [ 13.0, 7.0 ], [ 14.0, 80.0 ], [ 15.0, 304.0 ], [ 16.0, 536.0 ], [ 17.0, 867.0 ], [ 18.0, 967.0 ], [ 19.0, 691.0 ], [ 20.0, 728.0 ], [ 21.0, 813.0 ], [ 22.0, 1014.0 ], [ 23.0, 1210.0 ], [ 24.0, 1607.0 ], [ 25.0, 2100.0 ], [ 26.0, 3018.0 ], [ 27.0, 4557.0 ], [ 28.0, 7110.0 ], [ 29.0, 10163.0 ], [ 30.0, 12870.0 ], [ 31.0, 14707.0 ], [ 32.0, 19193.0 ], [ 33.0, 27213.0 ], [ 34.0, 40.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVFS2_R2", "pairs": [ [ 13.0, 6.0 ], [ 14.0, 124.0 ], [ 15.0, 573.0 ], [ 16.0, 1067.0 ], [ 17.0, 1691.0 ], [ 18.0, 1851.0 ], [ 19.0, 1407.0 ], [ 20.0, 1490.0 ], [ 21.0, 1809.0 ], [ 22.0, 2267.0 ], [ 23.0, 3040.0 ], [ 24.0, 4222.0 ], [ 25.0, 6138.0 ], [ 26.0, 8815.0 ], [ 27.0, 12001.0 ], [ 28.0, 14284.0 ], [ 29.0, 14610.0 ], [ 30.0, 13523.0 ], [ 31.0, 15108.0 ], [ 32.0, 29078.0 ], [ 33.0, 16948.0 ], [ 34.0, 3.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVMS1_R2", "pairs": [ [ 13.0, 2.0 ], [ 14.0, 244.0 ], [ 15.0, 865.0 ], [ 16.0, 1573.0 ], [ 17.0, 2462.0 ], [ 18.0, 2990.0 ], [ 19.0, 2029.0 ], [ 20.0, 2152.0 ], [ 21.0, 2451.0 ], [ 22.0, 3070.0 ], [ 23.0, 3813.0 ], [ 24.0, 4893.0 ], [ 25.0, 6721.0 ], [ 26.0, 9792.0 ], [ 27.0, 14833.0 ], [ 28.0, 22698.0 ], [ 29.0, 32048.0 ], [ 30.0, 40492.0 ], [ 31.0, 45881.0 ], [ 32.0, 61706.0 ], [ 33.0, 86519.0 ], [ 34.0, 77.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVMS2_R2", "pairs": [ [ 13.0, 4.0 ], [ 14.0, 91.0 ], [ 15.0, 445.0 ], [ 16.0, 743.0 ], [ 17.0, 1148.0 ], [ 18.0, 1362.0 ], [ 19.0, 1030.0 ], [ 20.0, 1080.0 ], [ 21.0, 1301.0 ], [ 22.0, 1597.0 ], [ 23.0, 2119.0 ], [ 24.0, 2856.0 ], [ 25.0, 3961.0 ], [ 26.0, 5666.0 ], [ 27.0, 8014.0 ], [ 28.0, 10288.0 ], [ 29.0, 11775.0 ], [ 30.0, 11640.0 ], [ 31.0, 12080.0 ], [ 32.0, 21758.0 ], [ 33.0, 18354.0 ], [ 34.0, 12.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null } ] } ], "pconfig": { "id": "fastqc_per_sequence_quality_scores_plot", "title": "FastQC: Per Sequence Quality Scores", "anchor": null, "table_title": null, "height": null, "width": null, "square": false, "logswitch": false, "logswitch_active": false, "logswitch_label": "Log10", "cpswitch": true, "cpswitch_c_active": true, "cpswitch_counts_label": "Counts", "cpswitch_percent_label": "Percentages", "xLog": null, "yLog": null, "xlog": false, "ylog": false, "data_labels": [], "xTitle": null, "yTitle": null, "xlab": "Mean Sequence Quality (Phred Score)", "ylab": "Count", "xsuffix": null, "ysuffix": null, "tt_suffix": null, "xLabFormat": null, "yLabFormat": null, "xLabelFormat": null, "yLabelFormat": null, "xlab_format": null, "ylab_format": null, "tt_label": "Phred {point.x}: {point.y} reads", "xDecimals": null, "yDecimals": null, "decimalPlaces": null, "x_decimals": 0, "y_decimals": null, "tt_decimals": null, "xmin": 0, "xmax": null, "ymin": 0, "ymax": null, "xFloor": null, "xCeiling": null, "yFloor": null, "yCeiling": null, "x_clipmin": null, "x_clipmax": null, "y_clipmin": null, "y_clipmax": null, "save_data_file": true, "showlegend": false, "xMinRange": null, "yMinRange": null, "x_minrange": null, "y_minrange": null, "xPlotBands": null, "yPlotBands": null, "xPlotLines": null, "yPlotLines": null, "x_bands": [ { "from_": 28, "to": 100, "color": "#c3e6c3" }, { "from_": 20, "to": 28, "color": "#e6dcc3" }, { "from_": 0, "to": 20, "color": "#e6c3c3" } ], "y_bands": null, "x_lines": null, "y_lines": null, "categories": false, "smooth_points": 500, "smooth_points_sumcounts": null, "extra_series": null, "style": null, "hide_zero_cats": false, "hide_empty": false, "colors": { "CAFS1_R2": "#5cb85c", "CAFS2_R2": "#5cb85c", "CAMS1_R2": "#5cb85c", "CAMS2_R2": "#5cb85c", "CCFS1_R2": "#5cb85c", "CCFS2_R2": "#5cb85c", "CCMS1_R2": "#5cb85c", "CCMS2_R2": "#5cb85c", "CPFS1_R2": "#5cb85c", "CPFS2_R2": "#5cb85c", "CPMS1_R2": "#5cb85c", "CPMS2_R2": "#5cb85c", "CVFS1_R2": "#5cb85c", "CVFS2_R2": "#5cb85c", "CVMS1_R2": "#5cb85c", "CVMS2_R2": "#5cb85c", "DAFS1_R2": "#5cb85c", "DAFS2_R2": "#5cb85c", "DAMS1_R2": "#5cb85c", "DAMS2_R2": "#5cb85c", "DCFS1_R2": "#5cb85c", "DCFS2_R2": "#5cb85c", "DCMS1_R2": "#5cb85c", "DCMS2_R2": "#5cb85c", "DPFS1_R2": "#5cb85c", "DPFS2_R2": "#5cb85c", "DPMS1_R2": "#5cb85c", "DPMS2_R2": "#5cb85c", "DVFS1_R2": "#5cb85c", "DVFS2_R2": "#5cb85c", "DVMS1_R2": "#5cb85c", "DVMS2_R2": "#5cb85c", "IAFS1_R2": "#5cb85c", "IAFS2_R2": "#5cb85c", "IAMS1_R2": "#5cb85c", "IAMS2_R2": "#5cb85c", "ICFS1_R2": "#5cb85c", "ICFS2_R2": "#5cb85c", "ICMS1_R2": "#5cb85c", "ICMS2_R2": "#5cb85c", "IPFS1_R2": "#5cb85c", "IPFS2_R2": "#5cb85c", "IPMS1_R2": "#5cb85c", "IPMS2_R2": "#5cb85c", "IVFS1_R2": "#5cb85c", "IVFS2_R2": "#5cb85c", "IVMS1_R2": "#5cb85c", "IVMS2_R2": "#5cb85c", "JAFS1_R2": "#5cb85c", "JAFS2_R2": "#5cb85c", "JAMS1_R2": "#5cb85c", "JAMS2_R2": "#5cb85c", "JCFS1_R2": "#5cb85c", "JCFS2_R2": "#5cb85c", "JCMS1_R2": "#5cb85c", "JCMS2_R2": "#5cb85c", "JPFS1_R2": "#5cb85c", "JPFS2_R2": "#5cb85c", "JPMS1_R2": "#5cb85c", "JPMS2_R2": "#5cb85c", "JVFS1_R2": "#5cb85c", "JVFS2_R2": "#5cb85c", "JVMS1_R2": "#5cb85c", "JVMS2_R2": "#5cb85c" } }, "add_log_tab": false, "add_pct_tab": false, "l_active": false, "p_active": false, "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "yaxis" ], "square": false, "flat": false, "defer_render": false }, "fastqc_per_sequence_gc_content_plot": { "id": "fastqc_per_sequence_gc_content_plot", "anchor": "fastqc_per_sequence_gc_content_plot", "plot_type": "xy_line", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 500, "hoverlabel": { "namelength": -1 }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "white", "plot_bgcolor": "white", "showlegend": false, "title": { "font": { "size": 20 }, "text": "FastQC: Per Sequence GC Content", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "hoverdistance": -1 }, "datasets": [ { "plot_id": "fastqc_per_sequence_gc_content_plot", "label": "Percentages", "uid": "fastqc_per_sequence_gc_content_plot_Percentages", "dconfig": { "name": "Percentages", "ylab": "Percentage", "tt_suffix": "%", "title": "FastQC: Per Sequence GC Content
Percentages, 64 samples" }, "layout": { "title": { "text": "FastQC: Per Sequence GC Content
Percentages, 64 samples" }, "xaxis": { "hoverformat": null, "ticksuffix": "%", "title": { "text": "% GC" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": 100 } }, "yaxis": { "hoverformat": null, "ticksuffix": "%", "title": { "text": "Percentage" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": null } } }, "trace_params": { "hovertemplate": "%{text}
%{x} GC: %{y}", "mode": "lines", "line": { "width": 2 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "n_samples": 64, "lines": [ { "name": "CAFS1_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0004625325507282571 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0004625325507282571 ], [ 43.0, 0.0 ], [ 44.0, 0.0010792426183659331 ], [ 45.0, 0.00154177516909419 ], [ 46.0, 0.008942295980746305 ], [ 47.0, 0.2206280266973786 ], [ 48.0, 1.2909283490825658 ], [ 49.0, 2.086638513852077 ], [ 50.0, 2.0715291171949546 ], [ 51.0, 3.77873676193295 ], [ 52.0, 13.828489846639599 ], [ 53.0, 22.82783150864243 ], [ 54.0, 22.573901138292594 ], [ 55.0, 13.208233696113018 ], [ 56.0, 13.580572399449261 ], [ 57.0, 3.896836739885565 ], [ 58.0, 0.1921051860691361 ], [ 59.0, 0.04995351547865177 ], [ 60.0, 0.03114385841570265 ], [ 61.0, 0.02759777552678601 ], [ 62.0, 0.02050560974895273 ], [ 63.0, 0.045790722522097455 ], [ 64.0, 0.024514225188597628 ], [ 65.0, 0.011717491285115848 ], [ 66.0, 0.014338509072575972 ], [ 67.0, 0.013567621488028874 ], [ 68.0, 0.010638248666749915 ], [ 69.0, 0.009713183565293399 ], [ 70.0, 0.00801723087928979 ], [ 71.0, 0.0075546983285615325 ], [ 72.0, 0.008325585913108629 ], [ 73.0, 0.004625325507282571 ], [ 74.0, 0.005242035574920248 ], [ 75.0, 0.003546082888916638 ], [ 76.0, 0.004316970473463733 ], [ 77.0, 0.004162792956554314 ], [ 78.0, 0.0043169704734637325 ], [ 79.0, 0.003546082888916638 ], [ 80.0, 0.0047795030241919905 ], [ 81.0, 0.005087858058010829 ], [ 82.0, 0.0037002604058260567 ], [ 83.0, 0.002775195304369543 ], [ 84.0, 0.0032377278550977996 ], [ 85.0, 0.0023126627536412857 ], [ 86.0, 0.002929372821278962 ], [ 87.0, 0.0020043077198224476 ], [ 88.0, 0.00154177516909419 ], [ 89.0, 0.005087858058010829 ], [ 90.0, 0.006012923159467343 ], [ 91.0, 0.00477950302419199 ], [ 92.0, 0.0038544379227354753 ], [ 93.0, 0.004162792956554314 ], [ 94.0, 0.002775195304369543 ], [ 95.0, 0.0018501302029130284 ], [ 96.0, 0.002775195304369543 ], [ 97.0, 0.0032377278550977996 ], [ 98.0, 0.005242035574920248 ], [ 99.0, 0.025130935256235304 ], [ 100.0, 0.024668402705507058 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAFS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.0 ], [ 46.0, 0.007823514822231432 ], [ 47.0, 0.2794825826920546 ], [ 48.0, 1.5438957441743941 ], [ 49.0, 2.3583735744973384 ], [ 50.0, 2.268153467398414 ], [ 51.0, 3.6299444197532074 ], [ 52.0, 13.93085011643719 ], [ 53.0, 22.758771075633415 ], [ 54.0, 22.00505032850439 ], [ 55.0, 12.726195291575731 ], [ 56.0, 13.827979219412962 ], [ 57.0, 4.093695745173138 ], [ 58.0, 0.17860917881392183 ], [ 59.0, 0.047107546695563725 ], [ 60.0, 0.0361213343920047 ], [ 61.0, 0.018976184887965597 ], [ 62.0, 0.0221388823692932 ], [ 63.0, 0.04411130697641125 ], [ 64.0, 0.01947555817449101 ], [ 65.0, 0.014981198595762312 ], [ 66.0, 0.006491852724830336 ], [ 67.0, 0.012484332163135263 ], [ 68.0, 0.012317874400960124 ], [ 69.0, 0.00782351482223143 ], [ 70.0, 0.005160190627429241 ], [ 71.0, 0.006491852724830336 ], [ 72.0, 0.006491852724830336 ], [ 73.0, 0.0059924794383049255 ], [ 74.0, 0.004993732865254104 ], [ 75.0, 0.0059924794383049255 ], [ 76.0, 0.006158937200480062 ], [ 77.0, 0.0076570570600562925 ], [ 78.0, 0.005493106151779515 ], [ 79.0, 0.004660817340903831 ], [ 80.0, 0.004993732865254104 ], [ 81.0, 0.000998746573050821 ], [ 82.0, 0.000998746573050821 ], [ 83.0, 0.0014981198595762314 ], [ 84.0, 0.001997493146101642 ], [ 85.0, 0.0004993732865254105 ], [ 86.0, 0.000998746573050821 ], [ 87.0, 0.002496866432627052 ], [ 88.0, 0.0014981198595762314 ], [ 89.0, 0.0014981198595762314 ], [ 90.0, 0.000998746573050821 ], [ 91.0, 0.0031626974813275996 ], [ 92.0, 0.002663324194802189 ], [ 93.0, 0.0029962397191524628 ], [ 94.0, 0.002496866432627052 ], [ 95.0, 0.002663324194802189 ], [ 96.0, 0.0011652043352259576 ], [ 97.0, 0.000998746573050821 ], [ 98.0, 0.005493106151779515 ], [ 99.0, 0.019974931461016417 ], [ 100.0, 0.02996239719152465 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAMS1_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.001029110094197877 ], [ 46.0, 0.0048025137729234245 ], [ 47.0, 0.29072360161090016 ], [ 48.0, 1.56922137530273 ], [ 49.0, 2.944627016198192 ], [ 50.0, 3.979054179216088 ], [ 51.0, 4.255884794555317 ], [ 52.0, 13.413935522822213 ], [ 53.0, 22.1895003327456 ], [ 54.0, 22.773177274504825 ], [ 55.0, 15.27971212360297 ], [ 56.0, 9.838978573927836 ], [ 57.0, 2.793347832351104 ], [ 58.0, 0.17752149124913377 ], [ 59.0, 0.05454283499248747 ], [ 60.0, 0.0535137248982896 ], [ 61.0, 0.02264042207235329 ], [ 62.0, 0.02264042207235329 ], [ 63.0, 0.06294723409510347 ], [ 64.0, 0.023841050515584147 ], [ 65.0, 0.012349321130374522 ], [ 66.0, 0.01595120646006709 ], [ 67.0, 0.013892986271671338 ], [ 68.0, 0.010805655989077708 ], [ 69.0, 0.012006284432308563 ], [ 70.0, 0.012349321130374522 ], [ 71.0, 0.00686073396131918 ], [ 72.0, 0.008918954149714935 ], [ 73.0, 0.0072037706593851385 ], [ 74.0, 0.004116440376791508 ], [ 75.0, 0.007889844055517055 ], [ 76.0, 0.007375289008418117 ], [ 77.0, 0.004287958725824488 ], [ 78.0, 0.007375289008418117 ], [ 79.0, 0.005660105518088323 ], [ 80.0, 0.0037734036787255482 ], [ 81.0, 0.00651769726325322 ], [ 82.0, 0.006174660565187261 ], [ 83.0, 0.00651769726325322 ], [ 84.0, 0.003944922027758527 ], [ 85.0, 0.001715183490329795 ], [ 86.0, 0.0012006284432308561 ], [ 87.0, 0.001029110094197877 ], [ 88.0, 0.002572775235494692 ], [ 89.0, 0.002572775235494692 ], [ 90.0, 0.001029110094197877 ], [ 91.0, 0.0036018853296925692 ], [ 92.0, 0.001029110094197877 ], [ 93.0, 0.002572775235494692 ], [ 94.0, 0.0015436651412968152 ], [ 95.0, 0.0030873302825936305 ], [ 96.0, 0.0036018853296925692 ], [ 97.0, 0.002572775235494692 ], [ 98.0, 0.0027442935845276716 ], [ 99.0, 0.020582201883957537 ], [ 100.0, 0.03293152301433208 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAMS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0004516371847948814 ], [ 45.0, 0.0009032743695897628 ], [ 46.0, 0.008430560782837784 ], [ 47.0, 0.3205118554761009 ], [ 48.0, 1.4943168987579984 ], [ 49.0, 2.893338351524273 ], [ 50.0, 4.169665035754609 ], [ 51.0, 4.051185547610083 ], [ 52.0, 12.776815957847171 ], [ 53.0, 21.967030485509987 ], [ 54.0, 22.766127211140393 ], [ 55.0, 14.469401580730137 ], [ 56.0, 11.31305984192698 ], [ 57.0, 3.200451637184794 ], [ 58.0, 0.16996612721114035 ], [ 59.0, 0.042754986827248764 ], [ 60.0, 0.02754986827248776 ], [ 61.0, 0.019420398946179897 ], [ 62.0, 0.022130222054949186 ], [ 63.0, 0.048325178773052306 ], [ 64.0, 0.017613850207000372 ], [ 65.0, 0.009634926608957468 ], [ 66.0, 0.00677455777192322 ], [ 67.0, 0.009484380880692507 ], [ 68.0, 0.008581106511102747 ], [ 69.0, 0.008581106511102747 ], [ 70.0, 0.009183289424162588 ], [ 71.0, 0.008280015054572825 ], [ 72.0, 0.007828377869777945 ], [ 73.0, 0.009484380880692507 ], [ 74.0, 0.00677455777192322 ], [ 75.0, 0.002709823108769288 ], [ 76.0, 0.0027098231087692875 ], [ 77.0, 0.004968009032743695 ], [ 78.0, 0.004968009032743695 ], [ 79.0, 0.002709823108769288 ], [ 80.0, 0.003613097478359051 ], [ 81.0, 0.0009032743695897628 ], [ 82.0, 0.0034625517500940896 ], [ 83.0, 0.0022581859239744068 ], [ 84.0, 0.0018065487391795256 ], [ 85.0, 0.0018065487391795256 ], [ 86.0, 0.002408731652239367 ], [ 87.0, 0.0028603688370342486 ], [ 88.0, 0.003161460293564169 ], [ 89.0, 0.0018065487391795256 ], [ 90.0, 0.0022581859239744068 ], [ 91.0, 0.002709823108769288 ], [ 92.0, 0.0022581859239744068 ], [ 93.0, 0.0018065487391795256 ], [ 94.0, 0.001354911554384644 ], [ 95.0, 0.0018065487391795256 ], [ 96.0, 0.0022581859239744068 ], [ 97.0, 0.0022581859239744068 ], [ 98.0, 0.0018065487391795256 ], [ 99.0, 0.021678584870154304 ], [ 100.0, 0.05359427926232586 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCFS1_R2", "pairs": [ [ 0.0, 0.0006919744799811776 ], [ 1.0, 0.0003459872399905888 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0003459872399905888 ], [ 8.0, 0.0003459872399905888 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0003459872399905888 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0003459872399905888 ], [ 15.0, 0.0006919744799811776 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0010379617199717665 ], [ 19.0, 0.0010379617199717665 ], [ 20.0, 0.0 ], [ 21.0, 0.0003459872399905888 ], [ 22.0, 0.0010379617199717665 ], [ 23.0, 0.0 ], [ 24.0, 0.0006919744799811776 ], [ 25.0, 0.0010379617199717665 ], [ 26.0, 0.0021912525199403957 ], [ 27.0, 0.0008073035599780404 ], [ 28.0, 0.0010379617199717665 ], [ 29.0, 0.0013839489599623551 ], [ 30.0, 0.003459872399905888 ], [ 31.0, 0.003805859639896477 ], [ 32.0, 0.0010379617199717665 ], [ 33.0, 0.004959150439865105 ], [ 34.0, 0.005420466759852558 ], [ 35.0, 0.006919744799811776 ], [ 36.0, 0.010725604439708254 ], [ 37.0, 0.01845265279949807 ], [ 38.0, 0.021912525199403957 ], [ 39.0, 0.024219106799341215 ], [ 40.0, 0.02629503023928475 ], [ 41.0, 0.03090819343915927 ], [ 42.0, 0.03436806583906516 ], [ 43.0, 0.04474768303878282 ], [ 44.0, 0.057203223678444014 ], [ 45.0, 0.06758284087816167 ], [ 46.0, 0.06988942247809893 ], [ 47.0, 0.15869281407568334 ], [ 48.0, 0.7928874249784325 ], [ 49.0, 4.463927370358578 ], [ 50.0, 5.979928126917348 ], [ 51.0, 7.530296949315169 ], [ 52.0, 16.37672935955456 ], [ 53.0, 23.123249881211073 ], [ 54.0, 21.38293406405838 ], [ 55.0, 10.941039161142385 ], [ 56.0, 5.542946242809228 ], [ 57.0, 2.774587006564528 ], [ 58.0, 0.23896185375350001 ], [ 59.0, 0.04278708867883615 ], [ 60.0, 0.015569425799576495 ], [ 61.0, 0.00991830087973021 ], [ 62.0, 0.011417578919689428 ], [ 63.0, 0.023642461399356905 ], [ 64.0, 0.009341655479745898 ], [ 65.0, 0.003113885159915299 ], [ 66.0, 0.004151846879887066 ], [ 67.0, 0.003113885159915299 ], [ 68.0, 0.0013839489599623551 ], [ 69.0, 0.003459872399905888 ], [ 70.0, 0.0027678979199247103 ], [ 71.0, 0.0013839489599623551 ], [ 72.0, 0.002075923439943533 ], [ 73.0, 0.0013839489599623551 ], [ 74.0, 0.0018452652799498066 ], [ 75.0, 0.001729936199952944 ], [ 76.0, 0.0013839489599623551 ], [ 77.0, 0.0006919744799811776 ], [ 78.0, 0.0013839489599623551 ], [ 79.0, 0.0013839489599623551 ], [ 80.0, 0.0010379617199717665 ], [ 81.0, 0.0003459872399905888 ], [ 82.0, 0.0010379617199717665 ], [ 83.0, 0.0006919744799811776 ], [ 84.0, 0.0010379617199717665 ], [ 85.0, 0.0024219106799341214 ], [ 86.0, 0.0024219106799341214 ], [ 87.0, 0.0013839489599623551 ], [ 88.0, 0.001729936199952944 ], [ 89.0, 0.0026525688399278474 ], [ 90.0, 0.0006919744799811776 ], [ 91.0, 0.003113885159915299 ], [ 92.0, 0.003459872399905888 ], [ 93.0, 0.0013839489599623551 ], [ 94.0, 0.0006919744799811776 ], [ 95.0, 0.0024219106799341214 ], [ 96.0, 0.006573757559821187 ], [ 97.0, 0.0055357958398494205 ], [ 98.0, 0.0055357958398494205 ], [ 99.0, 0.009110997319752172 ], [ 100.0, 0.0509754533586134 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCFS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.00036905680153232373 ], [ 6.0, 0.00036905680153232373 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.00036905680153232373 ], [ 14.0, 0.00036905680153232373 ], [ 15.0, 0.001476227206129295 ], [ 16.0, 0.00036905680153232373 ], [ 17.0, 0.0007381136030646475 ], [ 18.0, 0.001476227206129295 ], [ 19.0, 0.00036905680153232373 ], [ 20.0, 0.00036905680153232373 ], [ 21.0, 0.0007381136030646475 ], [ 22.0, 0.00036905680153232373 ], [ 23.0, 0.0011071704045969714 ], [ 24.0, 0.0015992461399734028 ], [ 25.0, 0.0008611325369087553 ], [ 26.0, 0.0008611325369087553 ], [ 27.0, 0.001476227206129295 ], [ 28.0, 0.001476227206129295 ], [ 29.0, 0.001230189338441079 ], [ 30.0, 0.0038135869491673457 ], [ 31.0, 0.0022143408091939427 ], [ 32.0, 0.0025833976107262663 ], [ 33.0, 0.0044286816183878855 ], [ 34.0, 0.005658870956828965 ], [ 35.0, 0.009349438972152202 ], [ 36.0, 0.014393215259760625 ], [ 37.0, 0.01734566967201922 ], [ 38.0, 0.01956001048121316 ], [ 39.0, 0.024357748901133368 ], [ 40.0, 0.024357748901133368 ], [ 41.0, 0.0295245441225859 ], [ 42.0, 0.047608327397669764 ], [ 43.0, 0.05043776287608425 ], [ 44.0, 0.04945361140533138 ], [ 45.0, 0.04699323272844923 ], [ 46.0, 0.07381136030646476 ], [ 47.0, 0.16373820094650754 ], [ 48.0, 0.7730509802763733 ], [ 49.0, 3.9267643683039264 ], [ 50.0, 5.254384702349549 ], [ 51.0, 7.895724230916372 ], [ 52.0, 16.672264028156576 ], [ 53.0, 23.6031507609337 ], [ 54.0, 21.524745873637443 ], [ 55.0, 10.60472417309747 ], [ 56.0, 5.646938120246089 ], [ 57.0, 2.9595895104215475 ], [ 58.0, 0.27285599526623144 ], [ 59.0, 0.05179097114836943 ], [ 60.0, 0.019683029415057268 ], [ 61.0, 0.010948685112125604 ], [ 62.0, 0.008119249633711122 ], [ 63.0, 0.018083783275083865 ], [ 64.0, 0.010333590442905065 ], [ 65.0, 0.003321511213790914 ], [ 66.0, 0.0023373597430380506 ], [ 67.0, 0.0038135869491673453 ], [ 68.0, 0.0030754733461026977 ], [ 69.0, 0.0038135869491673457 ], [ 70.0, 0.004305662684543777 ], [ 71.0, 0.0025833976107262663 ], [ 72.0, 0.001476227206129295 ], [ 73.0, 0.00295245441225859 ], [ 74.0, 0.0018452840076616187 ], [ 75.0, 0.0023373597430380506 ], [ 76.0, 0.0011071704045969714 ], [ 77.0, 0.0007381136030646475 ], [ 78.0, 0.0011071704045969714 ], [ 79.0, 0.0011071704045969714 ], [ 80.0, 0.00036905680153232373 ], [ 81.0, 0.0011071704045969714 ], [ 82.0, 0.0008611325369087553 ], [ 83.0, 0.0011071704045969714 ], [ 84.0, 0.001476227206129295 ], [ 85.0, 0.001476227206129295 ], [ 86.0, 0.001476227206129295 ], [ 87.0, 0.00295245441225859 ], [ 88.0, 0.0022143408091939427 ], [ 89.0, 0.0007381136030646475 ], [ 90.0, 0.001476227206129295 ], [ 91.0, 0.001476227206129295 ], [ 92.0, 0.0015992461399734028 ], [ 93.0, 0.001230189338441079 ], [ 94.0, 0.0034445301476350213 ], [ 95.0, 0.0034445301476350213 ], [ 96.0, 0.00295245441225859 ], [ 97.0, 0.005535852022984857 ], [ 98.0, 0.008857363236775771 ], [ 99.0, 0.011563779781346144 ], [ 100.0, 0.04994568714070777 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCMS1_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0010696305733695266 ], [ 16.0, 0.0007130870489130178 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0010696305733695266 ], [ 20.0, 0.0003565435244565089 ], [ 21.0, 0.0 ], [ 22.0, 0.0003565435244565089 ], [ 23.0, 0.0 ], [ 24.0, 0.0017827176222825444 ], [ 25.0, 0.0010696305733695266 ], [ 26.0, 0.0007130870489130178 ], [ 27.0, 0.0007130870489130178 ], [ 28.0, 0.0014261740978260356 ], [ 29.0, 0.0010696305733695266 ], [ 30.0, 0.0010696305733695266 ], [ 31.0, 0.00320889172010858 ], [ 32.0, 0.005348152866847633 ], [ 33.0, 0.003921978769021598 ], [ 34.0, 0.006180087757246155 ], [ 35.0, 0.010815153575180769 ], [ 36.0, 0.016044458600542898 ], [ 37.0, 0.020085285211049998 ], [ 38.0, 0.027097307858694672 ], [ 39.0, 0.03101928662771627 ], [ 40.0, 0.032802004249998816 ], [ 41.0, 0.03137583015217278 ], [ 42.0, 0.03743707006793343 ], [ 43.0, 0.05003494126539675 ], [ 44.0, 0.05490770276630237 ], [ 45.0, 0.06916944374456273 ], [ 46.0, 0.08545159802807661 ], [ 47.0, 0.28059975374727264 ], [ 48.0, 0.9699172343631898 ], [ 49.0, 4.97936801471812 ], [ 50.0, 6.997760906666415 ], [ 51.0, 5.743678483311392 ], [ 52.0, 13.061853170622712 ], [ 53.0, 21.530831507038208 ], [ 54.0, 20.93005566832898 ], [ 55.0, 12.160392292955173 ], [ 56.0, 7.43001050614919 ], [ 57.0, 4.764134573787872 ], [ 58.0, 0.4044392045751665 ], [ 59.0, 0.05181765888767928 ], [ 60.0, 0.025076894553441125 ], [ 61.0, 0.014380588819745856 ], [ 62.0, 0.008913588111412723 ], [ 63.0, 0.02103606794293402 ], [ 64.0, 0.010339762209238757 ], [ 65.0, 0.0035654352445650887 ], [ 66.0, 0.0010696305733695266 ], [ 67.0, 0.002852348195652071 ], [ 68.0, 0.002139261146739053 ], [ 69.0, 0.0017827176222825444 ], [ 70.0, 0.002139261146739053 ], [ 71.0, 0.0015450219393115382 ], [ 72.0, 0.0014261740978260356 ], [ 73.0, 0.0017827176222825444 ], [ 74.0, 0.0014261740978260356 ], [ 75.0, 0.002852348195652071 ], [ 76.0, 0.0010696305733695266 ], [ 77.0, 0.0014261740978260356 ], [ 78.0, 0.0019015654637680472 ], [ 79.0, 0.0007130870489130178 ], [ 80.0, 0.0014261740978260356 ], [ 81.0, 0.0015450219393115382 ], [ 82.0, 0.0010696305733695266 ], [ 83.0, 0.0010696305733695266 ], [ 84.0, 0.0003565435244565089 ], [ 85.0, 0.0014261740978260356 ], [ 86.0, 0.0008319348903985206 ], [ 87.0, 0.0014261740978260356 ], [ 88.0, 0.0014261740978260356 ], [ 89.0, 0.002852348195652071 ], [ 90.0, 0.002852348195652071 ], [ 91.0, 0.0015450219393115382 ], [ 92.0, 0.0011884784148550294 ], [ 93.0, 0.0011884784148550294 ], [ 94.0, 0.002614652512681065 ], [ 95.0, 0.002495804671195562 ], [ 96.0, 0.00320889172010858 ], [ 97.0, 0.002733500354166568 ], [ 98.0, 0.006536631281702663 ], [ 99.0, 0.012003631990035799 ], [ 100.0, 0.04159674451992598 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCMS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0003803529929343093 ], [ 7.0, 0.0 ], [ 8.0, 0.0003803529929343093 ], [ 9.0, 0.0003803529929343093 ], [ 10.0, 0.0005071373239124124 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0011410589788029277 ], [ 17.0, 0.0003803529929343093 ], [ 18.0, 0.0007607059858686186 ], [ 19.0, 0.0003803529929343093 ], [ 20.0, 0.0 ], [ 21.0, 0.0003803529929343093 ], [ 22.0, 0.0015214119717372372 ], [ 23.0, 0.0011410589788029277 ], [ 24.0, 0.0015214119717372372 ], [ 25.0, 0.0011410589788029277 ], [ 26.0, 0.0015214119717372372 ], [ 27.0, 0.0015214119717372372 ], [ 28.0, 0.002789255281518268 ], [ 29.0, 0.0022821179576058555 ], [ 30.0, 0.0011410589788029277 ], [ 31.0, 0.0022821179576058555 ], [ 32.0, 0.002662470950540165 ], [ 33.0, 0.003423176936408784 ], [ 34.0, 0.006085647886948949 ], [ 35.0, 0.007987412851620496 ], [ 36.0, 0.008367765844554806 ], [ 37.0, 0.021553336266277527 ], [ 38.0, 0.029921102110832334 ], [ 39.0, 0.0327103573923506 ], [ 40.0, 0.029667533448876123 ], [ 41.0, 0.04031741725103679 ], [ 42.0, 0.04716377112385435 ], [ 43.0, 0.05616545862329967 ], [ 44.0, 0.0533762033417814 ], [ 45.0, 0.06516714612274499 ], [ 46.0, 0.08849546302271596 ], [ 47.0, 0.2749952138915057 ], [ 48.0, 0.8808975316358605 ], [ 49.0, 4.708770052526751 ], [ 50.0, 6.652247062090096 ], [ 51.0, 5.724692896654294 ], [ 52.0, 12.96369784251102 ], [ 53.0, 22.271189148275585 ], [ 54.0, 21.54598277508081 ], [ 55.0, 12.525150841657776 ], [ 56.0, 6.981252400978269 ], [ 57.0, 4.3262617259658125 ], [ 58.0, 0.3845368758565867 ], [ 59.0, 0.04716377112385435 ], [ 60.0, 0.027131846829314063 ], [ 61.0, 0.013312354752700825 ], [ 62.0, 0.01103023679509497 ], [ 63.0, 0.019398002639649775 ], [ 64.0, 0.01103023679509497 ], [ 65.0, 0.003549961267386886 ], [ 66.0, 0.004817804577167918 ], [ 67.0, 0.0031696082744525774 ], [ 68.0, 0.0031696082744525774 ], [ 69.0, 0.00329639260543068 ], [ 70.0, 0.002662470950540165 ], [ 71.0, 0.0015214119717372372 ], [ 72.0, 0.0019017649646715467 ], [ 73.0, 0.0007607059858686186 ], [ 74.0, 0.0007607059858686186 ], [ 75.0, 0.001267843309781031 ], [ 76.0, 0.001774980633693443 ], [ 77.0, 0.0021553336266277525 ], [ 78.0, 0.0011410589788029277 ], [ 79.0, 0.0003803529929343093 ], [ 80.0, 0.0007607059858686186 ], [ 81.0, 0.00164819630271534 ], [ 82.0, 0.002408902288583959 ], [ 83.0, 0.0008874903168467215 ], [ 84.0, 0.001267843309781031 ], [ 85.0, 0.002408902288583959 ], [ 86.0, 0.0019017649646715467 ], [ 87.0, 0.0015214119717372372 ], [ 88.0, 0.0019017649646715467 ], [ 89.0, 0.0015214119717372372 ], [ 90.0, 0.0011410589788029277 ], [ 91.0, 0.0011410589788029277 ], [ 92.0, 0.0015214119717372372 ], [ 93.0, 0.0003803529929343093 ], [ 94.0, 0.0015214119717372372 ], [ 95.0, 0.0015214119717372372 ], [ 96.0, 0.0022821179576058555 ], [ 97.0, 0.004183882922277403 ], [ 98.0, 0.00570529489401464 ], [ 99.0, 0.008114197182598598 ], [ 100.0, 0.04057098591299295 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPFS1_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0014954761845417598 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0004984920615139199 ], [ 8.0, 0.0 ], [ 9.0, 0.0004984920615139199 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0009969841230278399 ], [ 20.0, 0.0004984920615139199 ], [ 21.0, 0.0004984920615139199 ], [ 22.0, 0.0014954761845417598 ], [ 23.0, 0.0019939682460556798 ], [ 24.0, 0.0014954761845417598 ], [ 25.0, 0.0 ], [ 26.0, 0.0009969841230278399 ], [ 27.0, 0.0009969841230278399 ], [ 28.0, 0.0029909523690835197 ], [ 29.0, 0.004486428553625279 ], [ 30.0, 0.0021601322665603193 ], [ 31.0, 0.0024924603075695993 ], [ 32.0, 0.004486428553625279 ], [ 33.0, 0.004984920615139199 ], [ 34.0, 0.006480396799680959 ], [ 35.0, 0.010136005250783037 ], [ 36.0, 0.008972857107250558 ], [ 37.0, 0.010966825353306238 ], [ 38.0, 0.009969841230278397 ], [ 39.0, 0.018111878235005756 ], [ 40.0, 0.027084735342256312 ], [ 41.0, 0.028580211526798075 ], [ 42.0, 0.02741706338326559 ], [ 43.0, 0.05167701037694303 ], [ 44.0, 0.05732658707410077 ], [ 45.0, 0.08640529066241283 ], [ 46.0, 0.1885961632727663 ], [ 47.0, 1.9291642780588703 ], [ 48.0, 2.631871920772992 ], [ 49.0, 0.49300864883726697 ], [ 50.0, 0.24359645405980204 ], [ 51.0, 0.6468765318245631 ], [ 52.0, 4.539102548125248 ], [ 53.0, 6.081769314490333 ], [ 54.0, 9.146166180636902 ], [ 55.0, 14.016599785648372 ], [ 56.0, 37.179698079974756 ], [ 57.0, 20.714172960128955 ], [ 58.0, 1.3695238569992452 ], [ 59.0, 0.14821830629013882 ], [ 60.0, 0.055332618828045105 ], [ 61.0, 0.026420079260237754 ], [ 62.0, 0.014788597824912956 ], [ 63.0, 0.008972857107250558 ], [ 64.0, 0.008142037004727357 ], [ 65.0, 0.004320264533120639 ], [ 66.0, 0.0039879364921113596 ], [ 67.0, 0.004652592574129919 ], [ 68.0, 0.004154100512615998 ], [ 69.0, 0.0024924603075695993 ], [ 70.0, 0.0024924603075695993 ], [ 71.0, 0.004984920615139199 ], [ 72.0, 0.0029909523690835197 ], [ 73.0, 0.0024924603075695993 ], [ 74.0, 0.0019939682460556798 ], [ 75.0, 0.0039879364921113596 ], [ 76.0, 0.003489444430597439 ], [ 77.0, 0.0029909523690835197 ], [ 78.0, 0.0024924603075695993 ], [ 79.0, 0.0019939682460556798 ], [ 80.0, 0.0019939682460556798 ], [ 81.0, 0.0024924603075695993 ], [ 82.0, 0.0031571163895881592 ], [ 83.0, 0.0019939682460556798 ], [ 84.0, 0.0024924603075695993 ], [ 85.0, 0.0024924603075695993 ], [ 86.0, 0.0014954761845417598 ], [ 87.0, 0.0024924603075695993 ], [ 88.0, 0.0024924603075695993 ], [ 89.0, 0.0004984920615139199 ], [ 90.0, 0.0021601322665603193 ], [ 91.0, 0.004818756594634559 ], [ 92.0, 0.004154100512615999 ], [ 93.0, 0.004652592574129919 ], [ 94.0, 0.004818756594634558 ], [ 95.0, 0.0026586243280742393 ], [ 96.0, 0.0036556084511020787 ], [ 97.0, 0.006646560820185599 ], [ 98.0, 0.008972857107250558 ], [ 99.0, 0.011963809476334079 ], [ 100.0, 0.05616343893056825 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPFS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.00041891893778914094 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.00041891893778914094 ], [ 8.0, 0.00041891893778914094 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.00041891893778914094 ], [ 17.0, 0.00041891893778914094 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0008378378755782819 ], [ 21.0, 0.00041891893778914094 ], [ 22.0, 0.0 ], [ 23.0, 0.0008378378755782819 ], [ 24.0, 0.0025135136267348457 ], [ 25.0, 0.0016756757511565638 ], [ 26.0, 0.0012567568133674228 ], [ 27.0, 0.001815315397086277 ], [ 28.0, 0.0012567568133674228 ], [ 29.0, 0.0012567568133674228 ], [ 30.0, 0.002932432564523986 ], [ 31.0, 0.00460810831568055 ], [ 32.0, 0.003770270440102268 ], [ 33.0, 0.0033513515023131275 ], [ 34.0, 0.0033513515023131275 ], [ 35.0, 0.005864865129047972 ], [ 36.0, 0.005445946191258832 ], [ 37.0, 0.012986487071463368 ], [ 38.0, 0.018153153970862774 ], [ 39.0, 0.022621622640613608 ], [ 40.0, 0.02890540670745072 ], [ 41.0, 0.039657659444038665 ], [ 42.0, 0.040774776611476375 ], [ 43.0, 0.04636036244866493 ], [ 44.0, 0.061441444209074006 ], [ 45.0, 0.06716666969219226 ], [ 46.0, 0.09146396808396244 ], [ 47.0, 0.2284504607410114 ], [ 48.0, 1.2596892459319475 ], [ 49.0, 2.718783906251523 ], [ 50.0, 3.3225857352516006 ], [ 51.0, 4.178018206217034 ], [ 52.0, 14.61929345131949 ], [ 53.0, 25.188757891385528 ], [ 54.0, 24.54739299763032 ], [ 55.0, 12.850059137390026 ], [ 56.0, 6.635117415996277 ], [ 57.0, 3.2530451915786083 ], [ 58.0, 0.4024414595694348 ], [ 59.0, 0.07317117446716995 ], [ 60.0, 0.029882884228958722 ], [ 61.0, 0.015220721406338789 ], [ 62.0, 0.010193694152869094 ], [ 63.0, 0.015918919635987353 ], [ 64.0, 0.012148649195885087 ], [ 65.0, 0.005027027253469691 ], [ 66.0, 0.0030720722104536995 ], [ 67.0, 0.002653153272664559 ], [ 68.0, 0.0041891893778914085 ], [ 69.0, 0.002932432564523986 ], [ 70.0, 0.0012567568133674228 ], [ 71.0, 0.0016756757511565638 ], [ 72.0, 0.0025135136267348457 ], [ 73.0, 0.0016756757511565638 ], [ 74.0, 0.0020945946889457043 ], [ 75.0, 0.002653153272664559 ], [ 76.0, 0.0016756757511565638 ], [ 77.0, 0.0020945946889457043 ], [ 78.0, 0.0016756757511565638 ], [ 79.0, 0.001815315397086277 ], [ 80.0, 0.0005585585837188545 ], [ 81.0, 0.0025135136267348457 ], [ 82.0, 0.0041891893778914085 ], [ 83.0, 0.002932432564523986 ], [ 84.0, 0.0033513515023131275 ], [ 85.0, 0.0020945946889457043 ], [ 86.0, 0.00349099114824284 ], [ 87.0, 0.0025135136267348457 ], [ 88.0, 0.0008378378755782819 ], [ 89.0, 0.0020945946889457043 ], [ 90.0, 0.0025135136267348457 ], [ 91.0, 0.0008378378755782819 ], [ 92.0, 0.002932432564523986 ], [ 93.0, 0.003770270440102268 ], [ 94.0, 0.002932432564523986 ], [ 95.0, 0.00460810831568055 ], [ 96.0, 0.003770270440102268 ], [ 97.0, 0.005585585837188545 ], [ 98.0, 0.00879729769357196 ], [ 99.0, 0.011031532028447377 ], [ 100.0, 0.05864865129047968 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPMS1_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0006645254180972418 ], [ 3.0, 0.0006645254180972418 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0003322627090486209 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0003322627090486209 ], [ 12.0, 0.0004430169453981612 ], [ 13.0, 0.0003322627090486209 ], [ 14.0, 0.0003322627090486209 ], [ 15.0, 0.0003322627090486209 ], [ 16.0, 0.0006645254180972418 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0003322627090486209 ], [ 22.0, 0.0006645254180972418 ], [ 23.0, 0.0006645254180972418 ], [ 24.0, 0.0006645254180972418 ], [ 25.0, 0.0013290508361944837 ], [ 26.0, 0.002325838963340346 ], [ 27.0, 0.0016613135452431046 ], [ 28.0, 0.0016613135452431046 ], [ 29.0, 0.0007752796544467821 ], [ 30.0, 0.001993576254291725 ], [ 31.0, 0.0034333813268357487 ], [ 32.0, 0.0034333813268357495 ], [ 33.0, 0.003322627090486209 ], [ 34.0, 0.0034333813268357487 ], [ 35.0, 0.00775279654446782 ], [ 36.0, 0.012625982943847595 ], [ 37.0, 0.016059364270683343 ], [ 38.0, 0.02192933879720898 ], [ 39.0, 0.029682135341676796 ], [ 40.0, 0.02536272012404473 ], [ 41.0, 0.035219847159153814 ], [ 42.0, 0.03787794883154279 ], [ 43.0, 0.044633957248864736 ], [ 44.0, 0.044966219957913355 ], [ 45.0, 0.05127921142983715 ], [ 46.0, 0.07221176209990027 ], [ 47.0, 0.2040093033558532 ], [ 48.0, 1.1707830324509914 ], [ 49.0, 3.5133458854801196 ], [ 50.0, 4.175877727323074 ], [ 51.0, 4.754790120722123 ], [ 52.0, 14.966441466386108 ], [ 53.0, 23.383320412005784 ], [ 54.0, 24.26891128585668 ], [ 55.0, 14.076309668844825 ], [ 56.0, 5.863329272344665 ], [ 57.0, 2.6451434267360705 ], [ 58.0, 0.29527079410787443 ], [ 59.0, 0.04164359286742715 ], [ 60.0, 0.01849595747037323 ], [ 61.0, 0.012182965998449431 ], [ 62.0, 0.008971093144312763 ], [ 63.0, 0.0142872964890907 ], [ 64.0, 0.008638830435264144 ], [ 65.0, 0.004651677926680692 ], [ 66.0, 0.002768855908738507 ], [ 67.0, 0.0034333813268357487 ], [ 68.0, 0.004651677926680692 ], [ 69.0, 0.002325838963340346 ], [ 70.0, 0.001993576254291725 ], [ 71.0, 0.0031011186177871282 ], [ 72.0, 0.0014398050725440237 ], [ 73.0, 0.0025473474360394265 ], [ 74.0, 0.002325838963340346 ], [ 75.0, 0.0013290508361944837 ], [ 76.0, 0.0013290508361944837 ], [ 77.0, 0.0013290508361944837 ], [ 78.0, 0.0016613135452431046 ], [ 79.0, 0.0013290508361944837 ], [ 80.0, 0.0016613135452431046 ], [ 81.0, 0.0016613135452431046 ], [ 82.0, 0.0024365931996898865 ], [ 83.0, 0.0009967881271458626 ], [ 84.0, 0.0013290508361944837 ], [ 85.0, 0.0029903643814375882 ], [ 86.0, 0.0009967881271458626 ], [ 87.0, 0.0006645254180972418 ], [ 88.0, 0.0006645254180972418 ], [ 89.0, 0.0006645254180972418 ], [ 90.0, 0.0021043304906412656 ], [ 91.0, 0.0026581016723889674 ], [ 92.0, 0.002325838963340346 ], [ 93.0, 0.0026581016723889674 ], [ 94.0, 0.0009967881271458626 ], [ 95.0, 0.0026581016723889674 ], [ 96.0, 0.0017720677815926448 ], [ 97.0, 0.0014398050725440237 ], [ 98.0, 0.005426957581127475 ], [ 99.0, 0.006977516890021039 ], [ 100.0, 0.06955366042751143 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPMS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0003673976246518905 ], [ 6.0, 0.0 ], [ 7.0, 0.000734795249303781 ], [ 8.0, 0.000734795249303781 ], [ 9.0, 0.000734795249303781 ], [ 10.0, 0.0003673976246518905 ], [ 11.0, 0.0 ], [ 12.0, 0.0003673976246518905 ], [ 13.0, 0.0003673976246518905 ], [ 14.0, 0.0 ], [ 15.0, 0.0003673976246518905 ], [ 16.0, 0.0 ], [ 17.0, 0.000734795249303781 ], [ 18.0, 0.000734795249303781 ], [ 19.0, 0.0011021928739556714 ], [ 20.0, 0.0003673976246518905 ], [ 21.0, 0.0003673976246518905 ], [ 22.0, 0.000734795249303781 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.000734795249303781 ], [ 26.0, 0.000734795249303781 ], [ 27.0, 0.0011021928739556714 ], [ 28.0, 0.0011021928739556714 ], [ 29.0, 0.0018369881232594525 ], [ 30.0, 0.0011021928739556714 ], [ 31.0, 0.0023268516227953062 ], [ 32.0, 0.002571783372563233 ], [ 33.0, 0.0018369881232594525 ], [ 34.0, 0.00526603262001043 ], [ 35.0, 0.009919735865601043 ], [ 36.0, 0.012124121613512387 ], [ 37.0, 0.013593712112119948 ], [ 38.0, 0.022166323353997392 ], [ 39.0, 0.027064958349355926 ], [ 40.0, 0.03024907109633898 ], [ 41.0, 0.033065786218670144 ], [ 42.0, 0.040413738711707954 ], [ 43.0, 0.053762519074059975 ], [ 44.0, 0.07127513918246675 ], [ 45.0, 0.06870335580990351 ], [ 46.0, 0.09221680378762451 ], [ 47.0, 0.27701780898752554 ], [ 48.0, 1.4496285610014767 ], [ 49.0, 4.187598125782248 ], [ 50.0, 4.890184849991551 ], [ 51.0, 6.030832008660793 ], [ 52.0, 16.640295681608333 ], [ 53.0, 22.17979460023467 ], [ 54.0, 20.842467246501766 ], [ 55.0, 13.448957448007098 ], [ 56.0, 6.280294995799417 ], [ 57.0, 2.60350203415818 ], [ 58.0, 0.3437617107992855 ], [ 59.0, 0.061722800941517615 ], [ 60.0, 0.03453537671727771 ], [ 61.0, 0.01751262010840678 ], [ 62.0, 0.011634258113976531 ], [ 63.0, 0.02241125510376532 ], [ 64.0, 0.012124121613512387 ], [ 65.0, 0.0069805548683859195 ], [ 66.0, 0.005510964369778357 ], [ 67.0, 0.003061646872099087 ], [ 68.0, 0.0018369881232594525 ], [ 69.0, 0.0033065786218670146 ], [ 70.0, 0.004041373871170795 ], [ 71.0, 0.0022043857479113428 ], [ 72.0, 0.0033065786218670146 ], [ 73.0, 0.0022043857479113428 ], [ 74.0, 0.0011021928739556714 ], [ 75.0, 0.0022043857479113428 ], [ 76.0, 0.0018369881232594525 ], [ 77.0, 0.0018369881232594525 ], [ 78.0, 0.0022043857479113428 ], [ 79.0, 0.000734795249303781 ], [ 80.0, 0.001469590498607562 ], [ 81.0, 0.002571783372563233 ], [ 82.0, 0.0022043857479113428 ], [ 83.0, 0.0018369881232594525 ], [ 84.0, 0.001469590498607562 ], [ 85.0, 0.0 ], [ 86.0, 0.002571783372563233 ], [ 87.0, 0.001959453998143416 ], [ 88.0, 0.0022043857479113428 ], [ 89.0, 0.000734795249303781 ], [ 90.0, 0.0018369881232594525 ], [ 91.0, 0.002571783372563233 ], [ 92.0, 0.0022043857479113428 ], [ 93.0, 0.001469590498607562 ], [ 94.0, 0.003796442121402869 ], [ 95.0, 0.002939180997215124 ], [ 96.0, 0.005143566745126466 ], [ 97.0, 0.0069805548683859195 ], [ 98.0, 0.012246587488396347 ], [ 99.0, 0.010776996989788788 ], [ 100.0, 0.05510964369778356 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVFS1_R2", "pairs": [ [ 0.0, 0.0013648383519576897 ], [ 1.0, 0.0006824191759788449 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.00034120958798942243 ], [ 7.0, 0.0 ], [ 8.0, 0.00034120958798942243 ], [ 9.0, 0.00034120958798942243 ], [ 10.0, 0.00034120958798942243 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.00034120958798942243 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.00034120958798942243 ], [ 19.0, 0.00034120958798942243 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0006824191759788449 ], [ 23.0, 0.00034120958798942243 ], [ 24.0, 0.0 ], [ 25.0, 0.00034120958798942243 ], [ 26.0, 0.0006824191759788449 ], [ 27.0, 0.0010236287639682673 ], [ 28.0, 0.0023884671159259572 ], [ 29.0, 0.0023884671159259572 ], [ 30.0, 0.0013648383519576897 ], [ 31.0, 0.0013648383519576897 ], [ 32.0, 0.0034120958798942243 ], [ 33.0, 0.004094515055873069 ], [ 34.0, 0.0030708862919048016 ], [ 35.0, 0.0037533054678836465 ], [ 36.0, 0.009212658875714406 ], [ 37.0, 0.015354431459524007 ], [ 38.0, 0.0228610423952913 ], [ 39.0, 0.025249509511217263 ], [ 40.0, 0.025931928687196105 ], [ 41.0, 0.03105007250703744 ], [ 42.0, 0.03548579715089993 ], [ 43.0, 0.04776934231851914 ], [ 44.0, 0.04799681537717875 ], [ 45.0, 0.07267764224174698 ], [ 46.0, 0.08154909152947197 ], [ 47.0, 0.23634450794734002 ], [ 48.0, 1.196963234666895 ], [ 49.0, 3.245016918308738 ], [ 50.0, 4.217464244078594 ], [ 51.0, 5.709005089709698 ], [ 52.0, 15.986692826068438 ], [ 53.0, 26.91415735448831 ], [ 54.0, 23.494896073246327 ], [ 55.0, 12.035827006738879 ], [ 56.0, 4.321760641474025 ], [ 57.0, 1.7425573658619804 ], [ 58.0, 0.21098126190679284 ], [ 59.0, 0.04788307884784895 ], [ 60.0, 0.02331598851261053 ], [ 61.0, 0.012283545167619207 ], [ 62.0, 0.009553868463703829 ], [ 63.0, 0.01808410816343939 ], [ 64.0, 0.006482982171799026 ], [ 65.0, 0.0046631977025221065 ], [ 66.0, 0.0010236287639682673 ], [ 67.0, 0.002615940174585572 ], [ 68.0, 0.0006824191759788449 ], [ 69.0, 0.0010236287639682673 ], [ 70.0, 0.0010236287639682673 ], [ 71.0, 0.0017060479399471121 ], [ 72.0, 0.0013648383519576897 ], [ 73.0, 0.0013648383519576897 ], [ 74.0, 0.0006824191759788449 ], [ 75.0, 0.0013648383519576897 ], [ 76.0, 0.0020472575279365346 ], [ 77.0, 0.0013648383519576897 ], [ 78.0, 0.0027296767039153794 ], [ 79.0, 0.0023884671159259572 ], [ 80.0, 0.0010236287639682673 ], [ 81.0, 0.0023884671159259572 ], [ 82.0, 0.0018197844692769197 ], [ 83.0, 0.0020472575279365346 ], [ 84.0, 0.0017060479399471121 ], [ 85.0, 0.0010236287639682673 ], [ 86.0, 0.0013648383519576897 ], [ 87.0, 0.00034120958798942243 ], [ 88.0, 0.0006824191759788449 ], [ 89.0, 0.0006824191759788449 ], [ 90.0, 0.0013648383519576897 ], [ 91.0, 0.0020472575279365346 ], [ 92.0, 0.0028434132332451865 ], [ 93.0, 0.0 ], [ 94.0, 0.0013648383519576897 ], [ 95.0, 0.0037533054678836465 ], [ 96.0, 0.006824191759788449 ], [ 97.0, 0.005118143819841337 ], [ 98.0, 0.005459353407830759 ], [ 99.0, 0.010577497227672096 ], [ 100.0, 0.04776934231851911 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVFS2_R2", "pairs": [ [ 0.0, 0.0007246228036380897 ], [ 1.0, 0.0007246228036380897 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.00036231140181904487 ], [ 6.0, 0.00036231140181904487 ], [ 7.0, 0.00036231140181904487 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.00036231140181904487 ], [ 12.0, 0.00036231140181904487 ], [ 13.0, 0.0 ], [ 14.0, 0.0007246228036380897 ], [ 15.0, 0.0 ], [ 16.0, 0.00036231140181904487 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0007246228036380897 ], [ 21.0, 0.00036231140181904487 ], [ 22.0, 0.00036231140181904487 ], [ 23.0, 0.00036231140181904487 ], [ 24.0, 0.00036231140181904487 ], [ 25.0, 0.002294638878187284 ], [ 26.0, 0.0019323274763682395 ], [ 27.0, 0.0014492456072761795 ], [ 28.0, 0.0021738684109142694 ], [ 29.0, 0.003260802616371404 ], [ 30.0, 0.003623114018190449 ], [ 31.0, 0.005193130092739643 ], [ 32.0, 0.0044685072891015535 ], [ 33.0, 0.004951589158193614 ], [ 34.0, 0.005434671027285674 ], [ 35.0, 0.006159293830923763 ], [ 36.0, 0.011593964858209436 ], [ 37.0, 0.019685586165501437 ], [ 38.0, 0.021014061305504605 ], [ 39.0, 0.030071846350980726 ], [ 40.0, 0.031521091958256905 ], [ 41.0, 0.03731807438736163 ], [ 42.0, 0.040699647471006045 ], [ 43.0, 0.050240514385574225 ], [ 44.0, 0.05036128485284725 ], [ 45.0, 0.06751069120561537 ], [ 46.0, 0.08574703176384064 ], [ 47.0, 0.26702350314063616 ], [ 48.0, 1.4064928618615329 ], [ 49.0, 4.022985035331403 ], [ 50.0, 5.0659587907011625 ], [ 51.0, 5.287693368614422 ], [ 52.0, 15.12360253473058 ], [ 53.0, 26.346922828879144 ], [ 54.0, 22.788662551614312 ], [ 55.0, 11.713648391276989 ], [ 56.0, 4.810287711484188 ], [ 57.0, 2.183288507361564 ], [ 58.0, 0.24552635996603944 ], [ 59.0, 0.038042697190999716 ], [ 60.0, 0.02065174990368556 ], [ 61.0, 0.010144719250933259 ], [ 62.0, 0.009782407849114213 ], [ 63.0, 0.01340552186730466 ], [ 64.0, 0.007970850840018988 ], [ 65.0, 0.005072359625466629 ], [ 66.0, 0.0033815730836444188 ], [ 67.0, 0.002294638878187284 ], [ 68.0, 0.0018115570090952245 ], [ 69.0, 0.0026569502800063293 ], [ 70.0, 0.0007246228036380897 ], [ 71.0, 0.0030192616818253745 ], [ 72.0, 0.0018115570090952245 ], [ 73.0, 0.0018115570090952245 ], [ 74.0, 0.0021738684109142694 ], [ 75.0, 0.0021738684109142694 ], [ 76.0, 0.002898491214552359 ], [ 77.0, 0.002898491214552359 ], [ 78.0, 0.0014492456072761795 ], [ 79.0, 0.003623114018190449 ], [ 80.0, 0.003260802616371404 ], [ 81.0, 0.0018115570090952245 ], [ 82.0, 0.0021738684109142694 ], [ 83.0, 0.0026569502800063293 ], [ 84.0, 0.002294638878187284 ], [ 85.0, 0.0015700160745491945 ], [ 86.0, 0.0007246228036380897 ], [ 87.0, 0.0004830818690920599 ], [ 88.0, 0.0010869342054571347 ], [ 89.0, 0.0025361798127333146 ], [ 90.0, 0.0021738684109142694 ], [ 91.0, 0.002294638878187284 ], [ 92.0, 0.0010869342054571347 ], [ 93.0, 0.0026569502800063293 ], [ 94.0, 0.004106195887282509 ], [ 95.0, 0.003019261681825374 ], [ 96.0, 0.004347736821828539 ], [ 97.0, 0.005917752896377734 ], [ 98.0, 0.006642375700015825 ], [ 99.0, 0.008695473643657078 ], [ 100.0, 0.047342023171021805 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVMS1_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.000407184913527497 ], [ 4.0, 0.000407184913527497 ], [ 5.0, 0.000407184913527497 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.000407184913527497 ], [ 9.0, 0.000407184913527497 ], [ 10.0, 0.000407184913527497 ], [ 11.0, 0.000814369827054994 ], [ 12.0, 0.000407184913527497 ], [ 13.0, 0.000407184913527497 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.000407184913527497 ], [ 17.0, 0.000407184913527497 ], [ 18.0, 0.0 ], [ 19.0, 0.000407184913527497 ], [ 20.0, 0.000407184913527497 ], [ 21.0, 0.000814369827054994 ], [ 22.0, 0.000407184913527497 ], [ 23.0, 0.001221554740582491 ], [ 24.0, 0.000814369827054994 ], [ 25.0, 0.0020359245676374853 ], [ 26.0, 0.0020359245676374853 ], [ 27.0, 0.001221554740582491 ], [ 28.0, 0.001221554740582491 ], [ 29.0, 0.002443109481164982 ], [ 30.0, 0.002850294394692479 ], [ 31.0, 0.004071849135274971 ], [ 32.0, 0.006107773702912455 ], [ 33.0, 0.007329328443494946 ], [ 34.0, 0.005836317093894123 ], [ 35.0, 0.005700588789384958 ], [ 36.0, 0.007736513357022443 ], [ 37.0, 0.013437102146407403 ], [ 38.0, 0.016287396541099883 ], [ 39.0, 0.022395170244012337 ], [ 40.0, 0.029724498687507282 ], [ 41.0, 0.03759674034903889 ], [ 42.0, 0.0514410274089738 ], [ 43.0, 0.06542104277341784 ], [ 44.0, 0.06609968429596368 ], [ 45.0, 0.08062261287844442 ], [ 46.0, 0.10939701343438755 ], [ 47.0, 0.38655421124210415 ], [ 48.0, 2.160115966263371 ], [ 49.0, 11.055884772098597 ], [ 50.0, 13.221158413933315 ], [ 51.0, 4.528846336557333 ], [ 52.0, 10.300963942418614 ], [ 53.0, 18.215960019870625 ], [ 54.0, 20.87840644112242 ], [ 55.0, 12.814244957014836 ], [ 56.0, 4.150978736803814 ], [ 57.0, 1.3446603127723045 ], [ 58.0, 0.15568036527201304 ], [ 59.0, 0.04166858948431386 ], [ 60.0, 0.018730506022264864 ], [ 61.0, 0.010179622838187425 ], [ 62.0, 0.006107773702912455 ], [ 63.0, 0.007329328443494946 ], [ 64.0, 0.002850294394692479 ], [ 65.0, 0.0029860226992016446 ], [ 66.0, 0.0033932076127291414 ], [ 67.0, 0.002171652872146651 ], [ 68.0, 0.002443109481164982 ], [ 69.0, 0.002850294394692479 ], [ 70.0, 0.001221554740582491 ], [ 71.0, 0.0020359245676374853 ], [ 72.0, 0.001628739654109988 ], [ 73.0, 0.001221554740582491 ], [ 74.0, 0.002443109481164982 ], [ 75.0, 0.001221554740582491 ], [ 76.0, 0.002443109481164982 ], [ 77.0, 0.0025788377856741473 ], [ 78.0, 0.002171652872146651 ], [ 79.0, 0.001221554740582491 ], [ 80.0, 0.001628739654109988 ], [ 81.0, 0.0020359245676374853 ], [ 82.0, 0.002443109481164982 ], [ 83.0, 0.004614762353311632 ], [ 84.0, 0.001221554740582491 ], [ 85.0, 0.001221554740582491 ], [ 86.0, 0.002850294394692479 ], [ 87.0, 0.002443109481164982 ], [ 88.0, 0.002850294394692479 ], [ 89.0, 0.002443109481164982 ], [ 90.0, 0.001628739654109988 ], [ 91.0, 0.000407184913527497 ], [ 92.0, 0.001628739654109988 ], [ 93.0, 0.003664664221747473 ], [ 94.0, 0.003664664221747473 ], [ 95.0, 0.003936120830765804 ], [ 96.0, 0.0025788377856741473 ], [ 97.0, 0.004614762353311632 ], [ 98.0, 0.005700588789384958 ], [ 99.0, 0.012622732319352408 ], [ 100.0, 0.05347695197661122 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVMS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0006550461480011267 ], [ 4.0, 0.00032752307400056336 ], [ 5.0, 0.0006550461480011267 ], [ 6.0, 0.0006550461480011267 ], [ 7.0, 0.00032752307400056336 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.00032752307400056336 ], [ 13.0, 0.00032752307400056336 ], [ 14.0, 0.0 ], [ 15.0, 0.0006550461480011267 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.00032752307400056336 ], [ 20.0, 0.0 ], [ 21.0, 0.00032752307400056336 ], [ 22.0, 0.0006550461480011267 ], [ 23.0, 0.00032752307400056336 ], [ 24.0, 0.00032752307400056336 ], [ 25.0, 0.0010917435800018777 ], [ 26.0, 0.00043669743200075114 ], [ 27.0, 0.00098256922200169 ], [ 28.0, 0.00098256922200169 ], [ 29.0, 0.00294770766600507 ], [ 30.0, 0.002620184592004507 ], [ 31.0, 0.0016376153700028166 ], [ 32.0, 0.004694497394008075 ], [ 33.0, 0.0056770666160097655 ], [ 34.0, 0.00589541533201014 ], [ 35.0, 0.008624774282014835 ], [ 36.0, 0.01419266654002441 ], [ 37.0, 0.01943303572403342 ], [ 38.0, 0.029258727944050326 ], [ 39.0, 0.031988086894055016 ], [ 40.0, 0.037337630436064216 ], [ 41.0, 0.04115873296607079 ], [ 42.0, 0.04399726627407567 ], [ 43.0, 0.05436883028409351 ], [ 44.0, 0.05644314308609708 ], [ 45.0, 0.08111654799413953 ], [ 46.0, 0.10262389652017652 ], [ 47.0, 0.33745794057858086 ], [ 48.0, 1.9926503822194253 ], [ 49.0, 10.080941869021334 ], [ 50.0, 12.028284892670682 ], [ 51.0, 4.495690888089739 ], [ 52.0, 10.201907057685531 ], [ 53.0, 18.157115002085266 ], [ 54.0, 22.095034095152027 ], [ 55.0, 13.777148933475697 ], [ 56.0, 4.38891836596555 ], [ 57.0, 1.4812776893465478 ], [ 58.0, 0.15808447038427192 ], [ 59.0, 0.03428074841205896 ], [ 60.0, 0.020633953662035492 ], [ 61.0, 0.013100922960022533 ], [ 62.0, 0.0098256922200169 ], [ 63.0, 0.011900005022020467 ], [ 64.0, 0.00589541533201014 ], [ 65.0, 0.004366974320007512 ], [ 66.0, 0.003602753814006197 ], [ 67.0, 0.002292661518003943 ], [ 68.0, 0.0021834871600037555 ], [ 69.0, 0.002620184592004507 ], [ 70.0, 0.002620184592004507 ], [ 71.0, 0.003602753814006197 ], [ 72.0, 0.0013100922960022534 ], [ 73.0, 0.002292661518003943 ], [ 74.0, 0.00098256922200169 ], [ 75.0, 0.002620184592004507 ], [ 76.0, 0.0013100922960022534 ], [ 77.0, 0.00196513844400338 ], [ 78.0, 0.00196513844400338 ], [ 79.0, 0.00098256922200169 ], [ 80.0, 0.0006550461480011267 ], [ 81.0, 0.001419266654002441 ], [ 82.0, 0.0013100922960022534 ], [ 83.0, 0.002292661518003943 ], [ 84.0, 0.002729358950004694 ], [ 85.0, 0.0017467897280030046 ], [ 86.0, 0.00294770766600507 ], [ 87.0, 0.0010917435800018777 ], [ 88.0, 0.0006550461480011267 ], [ 89.0, 0.0020743128020035678 ], [ 90.0, 0.0025110102340043187 ], [ 91.0, 0.002401835876004131 ], [ 92.0, 0.0017467897280030046 ], [ 93.0, 0.00098256922200169 ], [ 94.0, 0.001419266654002441 ], [ 95.0, 0.002620184592004507 ], [ 96.0, 0.004039451246006949 ], [ 97.0, 0.008188076850014084 ], [ 98.0, 0.005567892258009577 ], [ 99.0, 0.012445876812021407 ], [ 100.0, 0.06288443020810824 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAFS1_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0016905884938547104 ], [ 37.0, 0.005071765481564131 ], [ 38.0, 0.0025358827407820656 ], [ 39.0, 0.007607648222346196 ], [ 40.0, 0.010707060461079831 ], [ 41.0, 0.010425295712104047 ], [ 42.0, 0.030994122387336346 ], [ 43.0, 0.3065600468856535 ], [ 44.0, 0.3324824037914254 ], [ 45.0, 0.05071765481564133 ], [ 46.0, 0.034657064124021565 ], [ 47.0, 0.11918648881675709 ], [ 48.0, 0.5257730215888151 ], [ 49.0, 0.8836142527880622 ], [ 50.0, 0.9980107408722312 ], [ 51.0, 1.8266808676100132 ], [ 52.0, 10.163818025054523 ], [ 53.0, 11.649563546403838 ], [ 54.0, 9.044366677373725 ], [ 55.0, 9.640017356708535 ], [ 56.0, 39.39916484928405 ], [ 57.0, 13.889311536012364 ], [ 58.0, 0.48576242723425345 ], [ 59.0, 0.12454001904729699 ], [ 60.0, 0.07015942249497048 ], [ 61.0, 0.03972882960558569 ], [ 62.0, 0.025640592156796444 ], [ 63.0, 0.049027066321786605 ], [ 64.0, 0.024513533160893303 ], [ 65.0, 0.0188782381813776 ], [ 66.0, 0.016624120189571316 ], [ 67.0, 0.013242943201861897 ], [ 68.0, 0.011270589959031402 ], [ 69.0, 0.012961178452886114 ], [ 70.0, 0.011834119456982973 ], [ 71.0, 0.008734707218249335 ], [ 72.0, 0.011270589959031402 ], [ 73.0, 0.0059170597284914864 ], [ 74.0, 0.003381176987709421 ], [ 75.0, 0.006480589226443055 ], [ 76.0, 0.009861766214152476 ], [ 77.0, 0.006198824477467272 ], [ 78.0, 0.007607648222346196 ], [ 79.0, 0.0059170597284914864 ], [ 80.0, 0.005071765481564131 ], [ 81.0, 0.0025358827407820656 ], [ 82.0, 0.0028176474897578505 ], [ 83.0, 0.0 ], [ 84.0, 0.006480589226443055 ], [ 85.0, 0.0025358827407820656 ], [ 86.0, 0.0016905884938547104 ], [ 87.0, 0.0016905884938547104 ], [ 88.0, 0.0008452942469273552 ], [ 89.0, 0.003381176987709421 ], [ 90.0, 0.0059170597284914864 ], [ 91.0, 0.0025358827407820656 ], [ 92.0, 0.0016905884938547104 ], [ 93.0, 0.0008452942469273552 ], [ 94.0, 0.0025358827407820656 ], [ 95.0, 0.005071765481564131 ], [ 96.0, 0.0036629417366852053 ], [ 97.0, 0.0028176474897578505 ], [ 98.0, 0.0016905884938547104 ], [ 99.0, 0.014370002197765038 ], [ 100.0, 0.02930353389348164 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAFS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0026938203760573237 ], [ 39.0, 0.0026938203760573237 ], [ 40.0, 0.0 ], [ 41.0, 0.016162922256343942 ], [ 42.0, 0.02963202413663056 ], [ 43.0, 0.23436237271698684 ], [ 44.0, 0.30844243305856356 ], [ 45.0, 0.05859059317924678 ], [ 46.0, 0.03501966488874521 ], [ 47.0, 0.11381391088842191 ], [ 48.0, 0.5589677280318948 ], [ 49.0, 1.3341145412423896 ], [ 50.0, 1.8930822692742846 ], [ 51.0, 2.7840633586552435 ], [ 52.0, 9.584612898011958 ], [ 53.0, 10.812321534400082 ], [ 54.0, 12.996336404288556 ], [ 55.0, 14.760115295512085 ], [ 56.0, 32.48477991487529 ], [ 57.0, 10.95509401433112 ], [ 58.0, 0.4148483379128279 ], [ 59.0, 0.11718118635849357 ], [ 60.0, 0.11785464145250792 ], [ 61.0, 0.04242767092290285 ], [ 62.0, 0.016162922256343942 ], [ 63.0, 0.05118258714508915 ], [ 64.0, 0.032325844512687885 ], [ 65.0, 0.03165238941867356 ], [ 66.0, 0.023570928290501583 ], [ 67.0, 0.012122191692257957 ], [ 68.0, 0.010101826410214964 ], [ 69.0, 0.016162922256343942 ], [ 70.0, 0.004040730564085986 ], [ 71.0, 0.010101826410214964 ], [ 72.0, 0.006061095846128978 ], [ 73.0, 0.008081461128171971 ], [ 74.0, 0.002020365282042993 ], [ 75.0, 0.004040730564085986 ], [ 76.0, 0.004040730564085986 ], [ 77.0, 0.006061095846128978 ], [ 78.0, 0.002020365282042993 ], [ 79.0, 0.0 ], [ 80.0, 0.004040730564085986 ], [ 81.0, 0.004040730564085986 ], [ 82.0, 0.006061095846128978 ], [ 83.0, 0.002020365282042993 ], [ 84.0, 0.004040730564085986 ], [ 85.0, 0.002020365282042993 ], [ 86.0, 0.002020365282042993 ], [ 87.0, 0.002020365282042993 ], [ 88.0, 0.006061095846128978 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.004040730564085986 ], [ 93.0, 0.004040730564085986 ], [ 94.0, 0.0 ], [ 95.0, 0.002020365282042993 ], [ 96.0, 0.006061095846128978 ], [ 97.0, 0.002020365282042993 ], [ 98.0, 0.006061095846128978 ], [ 99.0, 0.02222401810247292 ], [ 100.0, 0.024244383384515913 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAMS1_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0011981691974662719 ], [ 36.0, 0.002795728127421301 ], [ 37.0, 0.0031951178599100584 ], [ 38.0, 0.0023963383949325437 ], [ 39.0, 0.006390235719820117 ], [ 40.0, 0.003993897324887572 ], [ 41.0, 0.008387184382263903 ], [ 42.0, 0.030353619669145546 ], [ 43.0, 0.6182553058925929 ], [ 44.0, 0.7396697845691785 ], [ 45.0, 0.11462485322427327 ], [ 46.0, 0.033948127261544364 ], [ 47.0, 0.040338362981364485 ], [ 48.0, 0.26679234130248985 ], [ 49.0, 0.88384947799762 ], [ 50.0, 0.9122061490043217 ], [ 51.0, 5.2883194478836355 ], [ 52.0, 55.97007772124199 ], [ 53.0, 22.778794002763785 ], [ 54.0, 4.36133587877723 ], [ 55.0, 3.7199159684002856 ], [ 56.0, 2.5656796415077765 ], [ 57.0, 0.7296850412569595 ], [ 58.0, 0.11981691974662718 ], [ 59.0, 0.08427123355512779 ], [ 60.0, 0.09185963847241417 ], [ 61.0, 0.042335311643808264 ], [ 62.0, 0.01957009689194911 ], [ 63.0, 0.02316460448434792 ], [ 64.0, 0.015576199567061536 ], [ 65.0, 0.01797253796199408 ], [ 66.0, 0.010783522777196446 ], [ 67.0, 0.011981691974662718 ], [ 68.0, 0.123411427339026 ], [ 69.0, 0.1785272104224745 ], [ 70.0, 0.014378030369595262 ], [ 71.0, 0.007189015184797631 ], [ 72.0, 0.008387184382263903 ], [ 73.0, 0.008786574114752659 ], [ 74.0, 0.0047926767898650875 ], [ 75.0, 0.008786574114752659 ], [ 76.0, 0.009585353579730175 ], [ 77.0, 0.003993897324887572 ], [ 78.0, 0.0035945075923988156 ], [ 79.0, 0.0035945075923988156 ], [ 80.0, 0.0023963383949325437 ], [ 81.0, 0.0035945075923988156 ], [ 82.0, 0.003993897324887572 ], [ 83.0, 0.003993897324887572 ], [ 84.0, 0.0023963383949325437 ], [ 85.0, 0.0047926767898650875 ], [ 86.0, 0.005990845987331359 ], [ 87.0, 0.0 ], [ 88.0, 0.0047926767898650875 ], [ 89.0, 0.0035945075923988156 ], [ 90.0, 0.0035945075923988156 ], [ 91.0, 0.0 ], [ 92.0, 0.0035945075923988156 ], [ 93.0, 0.0023963383949325437 ], [ 94.0, 0.0047926767898650875 ], [ 95.0, 0.0047926767898650875 ], [ 96.0, 0.0011981691974662719 ], [ 97.0, 0.0011981691974662719 ], [ 98.0, 0.0047926767898650875 ], [ 99.0, 0.01957009689194911 ], [ 100.0, 0.023963383949325436 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAMS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0009432627458378529 ], [ 34.0, 0.0018865254916757058 ], [ 35.0, 0.0018865254916757058 ], [ 36.0, 0.009118206543099245 ], [ 37.0, 0.007546101966702823 ], [ 38.0, 0.00880378562781996 ], [ 39.0, 0.011319152950054236 ], [ 40.0, 0.005973997390306402 ], [ 41.0, 0.0031442091527928433 ], [ 42.0, 0.0361584052571177 ], [ 43.0, 0.5914257416403341 ], [ 44.0, 0.6436196135766968 ], [ 45.0, 0.1006146928893709 ], [ 46.0, 0.02358156864594632 ], [ 47.0, 0.03301419610432486 ], [ 48.0, 0.07074470593783896 ], [ 49.0, 0.13771636089232653 ], [ 50.0, 0.33202848653492417 ], [ 51.0, 5.16090490339417 ], [ 52.0, 62.41223726202275 ], [ 53.0, 24.890817337169256 ], [ 54.0, 2.12202675721989 ], [ 55.0, 1.2067474728418934 ], [ 56.0, 1.0039459824867547 ], [ 57.0, 0.6417330880850193 ], [ 58.0, 0.15689603672436286 ], [ 59.0, 0.045591032715496235 ], [ 60.0, 0.03427187976544199 ], [ 61.0, 0.025782515052901314 ], [ 62.0, 0.02263830590010847 ], [ 63.0, 0.02829788237513559 ], [ 64.0, 0.017921992170919207 ], [ 65.0, 0.01226241569589209 ], [ 66.0, 0.02263830590010847 ], [ 67.0, 0.015092203933405646 ], [ 68.0, 0.01226241569589209 ], [ 69.0, 0.0037730509833514116 ], [ 70.0, 0.012576836611171373 ], [ 71.0, 0.004716313729189265 ], [ 72.0, 0.0009432627458378529 ], [ 73.0, 0.002829788237513559 ], [ 74.0, 0.00943262745837853 ], [ 75.0, 0.00880378562781996 ], [ 76.0, 0.0018865254916757058 ], [ 77.0, 0.004716313729189265 ], [ 78.0, 0.007860522881982107 ], [ 79.0, 0.002829788237513559 ], [ 80.0, 0.002829788237513559 ], [ 81.0, 0.002829788237513559 ], [ 82.0, 0.004716313729189265 ], [ 83.0, 0.0018865254916757058 ], [ 84.0, 0.0009432627458378529 ], [ 85.0, 0.005659576475027118 ], [ 86.0, 0.0018865254916757058 ], [ 87.0, 0.0018865254916757058 ], [ 88.0, 0.0012576836611171373 ], [ 89.0, 0.0031442091527928433 ], [ 90.0, 0.00220094640695499 ], [ 91.0, 0.0009432627458378529 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.002829788237513559 ], [ 95.0, 0.0018865254916757058 ], [ 96.0, 0.0009432627458378529 ], [ 97.0, 0.0 ], [ 98.0, 0.0037730509833514116 ], [ 99.0, 0.020751780408432764 ], [ 100.0, 0.02766904054457701 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCFS1_R2", "pairs": [ [ 0.0, 0.007305091039697075 ], [ 1.0, 0.0036525455198485376 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.000608757586641423 ], [ 14.0, 0.000608757586641423 ], [ 15.0, 0.000608757586641423 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.000608757586641423 ], [ 19.0, 0.000608757586641423 ], [ 20.0, 0.000608757586641423 ], [ 21.0, 0.0 ], [ 22.0, 0.000608757586641423 ], [ 23.0, 0.000608757586641423 ], [ 24.0, 0.001217515173282846 ], [ 25.0, 0.0 ], [ 26.0, 0.000608757586641423 ], [ 27.0, 0.0018262727599242688 ], [ 28.0, 0.003246707128754256 ], [ 29.0, 0.004261303106489961 ], [ 30.0, 0.004261303106489961 ], [ 31.0, 0.008725525408527064 ], [ 32.0, 0.013798505297205586 ], [ 33.0, 0.009131363799621345 ], [ 34.0, 0.015421858861582717 ], [ 35.0, 0.024959061052298347 ], [ 36.0, 0.025364899443392624 ], [ 37.0, 0.027597010594411178 ], [ 38.0, 0.037134212785126804 ], [ 39.0, 0.05641153636210517 ], [ 40.0, 0.07508010235244215 ], [ 41.0, 0.094966183516062 ], [ 42.0, 0.14042008331862163 ], [ 43.0, 0.8118797013841076 ], [ 44.0, 0.9991741188741099 ], [ 45.0, 0.3618049256605524 ], [ 46.0, 0.2033250339382352 ], [ 47.0, 0.14792809355386582 ], [ 48.0, 0.2443147114387576 ], [ 49.0, 0.3591669761184395 ], [ 50.0, 0.6028729299705562 ], [ 51.0, 3.017814276177077 ], [ 52.0, 28.72585007923998 ], [ 53.0, 36.450780934524055 ], [ 54.0, 14.003656603903735 ], [ 55.0, 10.03719508854379 ], [ 56.0, 2.3400641630496315 ], [ 57.0, 0.6239765263074588 ], [ 58.0, 0.1282449315857931 ], [ 59.0, 0.057831970730935184 ], [ 60.0, 0.04139551589161676 ], [ 61.0, 0.0237415458790155 ], [ 62.0, 0.021103596336902664 ], [ 63.0, 0.0237415458790155 ], [ 64.0, 0.035510859220749674 ], [ 65.0, 0.0326699904830897 ], [ 66.0, 0.015421858861582717 ], [ 67.0, 0.004464222302037101 ], [ 68.0, 0.004464222302037101 ], [ 69.0, 0.003043787933207115 ], [ 70.0, 0.001217515173282846 ], [ 71.0, 0.000608757586641423 ], [ 72.0, 0.003043787933207115 ], [ 73.0, 0.003043787933207115 ], [ 74.0, 0.002637949542112833 ], [ 75.0, 0.002435030346565692 ], [ 76.0, 0.000608757586641423 ], [ 77.0, 0.001217515173282846 ], [ 78.0, 0.0014204343688299867 ], [ 79.0, 0.000811676782188564 ], [ 80.0, 0.00202919195547141 ], [ 81.0, 0.0036525455198485376 ], [ 82.0, 0.002435030346565692 ], [ 83.0, 0.001217515173282846 ], [ 84.0, 0.002435030346565692 ], [ 85.0, 0.000608757586641423 ], [ 86.0, 0.001217515173282846 ], [ 87.0, 0.0018262727599242688 ], [ 88.0, 0.002435030346565692 ], [ 89.0, 0.002435030346565692 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.000608757586641423 ], [ 93.0, 0.001217515173282846 ], [ 94.0, 0.001217515173282846 ], [ 95.0, 0.002435030346565692 ], [ 96.0, 0.004261303106489961 ], [ 97.0, 0.002435030346565692 ], [ 98.0, 0.00608757586641423 ], [ 99.0, 0.0066963334530556525 ], [ 100.0, 0.056005697971010876 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCFS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0010203179310673204 ], [ 9.0, 0.0010203179310673204 ], [ 10.0, 0.0010203179310673204 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0010203179310673204 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0037411657472468415 ], [ 20.0, 0.0027208478161795213 ], [ 21.0, 0.0010203179310673204 ], [ 22.0, 0.0 ], [ 23.0, 0.0010203179310673204 ], [ 24.0, 0.0010203179310673204 ], [ 25.0, 0.0 ], [ 26.0, 0.002040635862134641 ], [ 27.0, 0.0010203179310673204 ], [ 28.0, 0.002040635862134641 ], [ 29.0, 0.004081271724269282 ], [ 30.0, 0.002040635862134641 ], [ 31.0, 0.009182861379605885 ], [ 32.0, 0.012243815172807848 ], [ 33.0, 0.010543285287695645 ], [ 34.0, 0.013264133103875166 ], [ 35.0, 0.012924027126852726 ], [ 36.0, 0.020746464598368854 ], [ 37.0, 0.04285335310482746 ], [ 38.0, 0.05407685034656799 ], [ 39.0, 0.1139355023025174 ], [ 40.0, 0.12753974138341503 ], [ 41.0, 0.15712896138436738 ], [ 42.0, 0.31289749886064483 ], [ 43.0, 2.6154149633025767 ], [ 44.0, 3.1663866460789807 ], [ 45.0, 0.8706713011774508 ], [ 46.0, 0.4530211613938899 ], [ 47.0, 0.23161217035228185 ], [ 48.0, 0.3016740016189045 ], [ 49.0, 0.4349955446117007 ], [ 50.0, 0.6479018862277487 ], [ 51.0, 2.6548672566371714 ], [ 52.0, 24.969560515056443 ], [ 53.0, 37.425261711549304 ], [ 54.0, 13.290661370082935 ], [ 55.0, 8.614884397978404 ], [ 56.0, 1.9943814492595882 ], [ 57.0, 0.5186616149592213 ], [ 58.0, 0.1717535183963323 ], [ 59.0, 0.12073762184296626 ], [ 60.0, 0.09761041540544034 ], [ 61.0, 0.07482331494493685 ], [ 62.0, 0.03231006781713181 ], [ 63.0, 0.04795494276016407 ], [ 64.0, 0.0812853285083632 ], [ 65.0, 0.06632066551937583 ], [ 66.0, 0.029929325977974736 ], [ 67.0, 0.006121907586403924 ], [ 68.0, 0.006121907586403924 ], [ 69.0, 0.008162543448538563 ], [ 70.0, 0.005101589655336603 ], [ 71.0, 0.0010203179310673204 ], [ 72.0, 0.003060953793201962 ], [ 73.0, 0.006121907586403924 ], [ 74.0, 0.005101589655336603 ], [ 75.0, 0.003060953793201962 ], [ 76.0, 0.002040635862134641 ], [ 77.0, 0.0 ], [ 78.0, 0.005441695632359043 ], [ 79.0, 0.004421377701291722 ], [ 80.0, 0.002040635862134641 ], [ 81.0, 0.002040635862134641 ], [ 82.0, 0.002040635862134641 ], [ 83.0, 0.002040635862134641 ], [ 84.0, 0.002040635862134641 ], [ 85.0, 0.0010203179310673204 ], [ 86.0, 0.003060953793201962 ], [ 87.0, 0.004081271724269282 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.004081271724269282 ], [ 91.0, 0.006462013563426363 ], [ 92.0, 0.007482331494493684 ], [ 93.0, 0.0 ], [ 94.0, 0.0010203179310673204 ], [ 95.0, 0.006121907586403924 ], [ 96.0, 0.004081271724269282 ], [ 97.0, 0.007142225517471243 ], [ 98.0, 0.008162543448538563 ], [ 99.0, 0.006121907586403924 ], [ 100.0, 0.05033568459932116 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCMS1_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.00031070567472844346 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.00031070567472844346 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0009321170241853303 ], [ 11.0, 0.00031070567472844346 ], [ 12.0, 0.00031070567472844346 ], [ 13.0, 0.00031070567472844346 ], [ 14.0, 0.00031070567472844346 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.00031070567472844346 ], [ 18.0, 0.00031070567472844346 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0006214113494568869 ], [ 22.0, 0.0 ], [ 23.0, 0.0009321170241853303 ], [ 24.0, 0.0013463912571565883 ], [ 25.0, 0.0009321170241853303 ], [ 26.0, 0.0012428226989137738 ], [ 27.0, 0.0018642340483706605 ], [ 28.0, 0.0024856453978275477 ], [ 29.0, 0.0032106253055272493 ], [ 30.0, 0.00414274232971258 ], [ 31.0, 0.003107056747284435 ], [ 32.0, 0.004971290795655095 ], [ 33.0, 0.006317682052811684 ], [ 34.0, 0.009114033125367675 ], [ 35.0, 0.014706735270479656 ], [ 36.0, 0.018331634808978165 ], [ 37.0, 0.017399517784792835 ], [ 38.0, 0.02278508281341919 ], [ 39.0, 0.03231339017175812 ], [ 40.0, 0.03707754385092759 ], [ 41.0, 0.051887847679650066 ], [ 42.0, 0.07995492696345281 ], [ 43.0, 0.3595900342190525 ], [ 44.0, 0.43685217866818815 ], [ 45.0, 0.15690636573786365 ], [ 46.0, 0.10750416345604143 ], [ 47.0, 0.13836759381240016 ], [ 48.0, 0.23768984116725933 ], [ 49.0, 0.44917683709908623 ], [ 50.0, 0.7543933782406608 ], [ 51.0, 3.02461617492316 ], [ 52.0, 26.873140944379493 ], [ 53.0, 32.9426727316414 ], [ 54.0, 17.157478064179422 ], [ 55.0, 13.463291160216428 ], [ 56.0, 2.460685375291028 ], [ 57.0, 0.655899679351744 ], [ 58.0, 0.13391414580795907 ], [ 59.0, 0.06038046945556085 ], [ 60.0, 0.044845185719138675 ], [ 61.0, 0.022888651371662 ], [ 62.0, 0.011288972848466779 ], [ 63.0, 0.017399517784792835 ], [ 64.0, 0.0142924610375084 ], [ 65.0, 0.008389053217667973 ], [ 66.0, 0.004971290795655095 ], [ 67.0, 0.0045570165626838376 ], [ 68.0, 0.0024856453978275477 ], [ 69.0, 0.003417762422012878 ], [ 70.0, 0.0018642340483706605 ], [ 71.0, 0.0009321170241853303 ], [ 72.0, 0.003417762422012878 ], [ 73.0, 0.0046605851209266524 ], [ 74.0, 0.0021749397230991043 ], [ 75.0, 0.003107056747284435 ], [ 76.0, 0.0009321170241853303 ], [ 77.0, 0.0021749397230991043 ], [ 78.0, 0.0021749397230991043 ], [ 79.0, 0.0012428226989137738 ], [ 80.0, 0.0006214113494568869 ], [ 81.0, 0.0021749397230991043 ], [ 82.0, 0.003728468096741321 ], [ 83.0, 0.0024856453978275477 ], [ 84.0, 0.0016570969318850316 ], [ 85.0, 0.002899919630798806 ], [ 86.0, 0.0024856453978275477 ], [ 87.0, 0.0015535283736422174 ], [ 88.0, 0.003107056747284435 ], [ 89.0, 0.0021749397230991043 ], [ 90.0, 0.0006214113494568869 ], [ 91.0, 0.0015535283736422174 ], [ 92.0, 0.0015535283736422174 ], [ 93.0, 0.0024856453978275477 ], [ 94.0, 0.0012428226989137738 ], [ 95.0, 0.0027963510725559915 ], [ 96.0, 0.0032106253055272493 ], [ 97.0, 0.005074859353897909 ], [ 98.0, 0.008389053217667973 ], [ 99.0, 0.011081835731981151 ], [ 100.0, 0.05116286777195037 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCMS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0007690059828665459 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0007690059828665459 ], [ 7.0, 0.0007690059828665459 ], [ 8.0, 0.0007690059828665459 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0015380119657330917 ], [ 16.0, 0.0007690059828665459 ], [ 17.0, 0.0023070179485996374 ], [ 18.0, 0.0015380119657330917 ], [ 19.0, 0.0007690059828665459 ], [ 20.0, 0.0007690059828665459 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0007690059828665459 ], [ 26.0, 0.0007690059828665459 ], [ 27.0, 0.0015380119657330917 ], [ 28.0, 0.0015380119657330917 ], [ 29.0, 0.0007690059828665459 ], [ 30.0, 0.0030760239314661835 ], [ 31.0, 0.0015380119657330917 ], [ 32.0, 0.01179142507062037 ], [ 33.0, 0.0156364549849531 ], [ 34.0, 0.017174466950686185 ], [ 35.0, 0.012816766381109094 ], [ 36.0, 0.027940550710817837 ], [ 37.0, 0.05408675412828039 ], [ 38.0, 0.06972320911323349 ], [ 39.0, 0.0879230173744084 ], [ 40.0, 0.1020214603936284 ], [ 41.0, 0.17840938802503875 ], [ 42.0, 0.3388753031165239 ], [ 43.0, 2.4672275283635607 ], [ 44.0, 2.947343596999957 ], [ 45.0, 0.658269121333766 ], [ 46.0, 0.3363119498403025 ], [ 47.0, 0.2704337706414017 ], [ 48.0, 0.43628272761295367 ], [ 49.0, 0.6631394925585848 ], [ 50.0, 0.9002496706091033 ], [ 51.0, 2.5541252044274274 ], [ 52.0, 22.915609283440126 ], [ 53.0, 31.585382734277662 ], [ 54.0, 16.550290427926164 ], [ 55.0, 12.639382334394558 ], [ 56.0, 2.406219720389422 ], [ 57.0, 0.7046658156333783 ], [ 58.0, 0.2588986808984038 ], [ 59.0, 0.16841231024777356 ], [ 60.0, 0.12816766381109096 ], [ 61.0, 0.06408383190554548 ], [ 62.0, 0.03588694586710547 ], [ 63.0, 0.05511209543876912 ], [ 64.0, 0.07279923304469968 ], [ 65.0, 0.05024172421394765 ], [ 66.0, 0.024608191451729468 ], [ 67.0, 0.01307310170873128 ], [ 68.0, 0.003845029914332729 ], [ 69.0, 0.0030760239314661835 ], [ 70.0, 0.0007690059828665459 ], [ 71.0, 0.0030760239314661835 ], [ 72.0, 0.004614035897199275 ], [ 73.0, 0.003845029914332729 ], [ 74.0, 0.0030760239314661835 ], [ 75.0, 0.0030760239314661835 ], [ 76.0, 0.0025633532762218193 ], [ 77.0, 0.0 ], [ 78.0, 0.0015380119657330917 ], [ 79.0, 0.0015380119657330917 ], [ 80.0, 0.0015380119657330917 ], [ 81.0, 0.0030760239314661835 ], [ 82.0, 0.0007690059828665459 ], [ 83.0, 0.0007690059828665459 ], [ 84.0, 0.0 ], [ 85.0, 0.0015380119657330917 ], [ 86.0, 0.0030760239314661835 ], [ 87.0, 0.0007690059828665459 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0007690059828665459 ], [ 91.0, 0.003845029914332729 ], [ 92.0, 0.0053830418800658204 ], [ 93.0, 0.0015380119657330917 ], [ 94.0, 0.003332359259088365 ], [ 95.0, 0.003332359259088365 ], [ 96.0, 0.0023070179485996374 ], [ 97.0, 0.004614035897199275 ], [ 98.0, 0.008715401139154186 ], [ 99.0, 0.014611113674464372 ], [ 100.0, 0.06562184387127856 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPFS1_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0005288673424416034 ], [ 2.0, 0.0005288673424416034 ], [ 3.0, 0.0005288673424416034 ], [ 4.0, 0.0 ], [ 5.0, 0.0005288673424416034 ], [ 6.0, 0.0005288673424416034 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0005288673424416034 ], [ 15.0, 0.0005288673424416034 ], [ 16.0, 0.0010577346848832068 ], [ 17.0, 0.0005288673424416034 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.002644336712208017 ], [ 21.0, 0.0010577346848832068 ], [ 22.0, 0.0010577346848832068 ], [ 23.0, 0.003173204054649621 ], [ 24.0, 0.0015866020273248105 ], [ 25.0, 0.0010577346848832068 ], [ 26.0, 0.002291758483913615 ], [ 27.0, 0.002291758483913615 ], [ 28.0, 0.0015866020273248105 ], [ 29.0, 0.0037020713970912244 ], [ 30.0, 0.006875275451740845 ], [ 31.0, 0.0037020713970912244 ], [ 32.0, 0.003173204054649621 ], [ 33.0, 0.010577346848832068 ], [ 34.0, 0.011458792419568075 ], [ 35.0, 0.01092992507712647 ], [ 36.0, 0.023446452181577756 ], [ 37.0, 0.031203173204054607 ], [ 38.0, 0.03702071397091224 ], [ 39.0, 0.03314235345967381 ], [ 40.0, 0.03966505068312026 ], [ 41.0, 0.05588364918466277 ], [ 42.0, 0.07827236668135731 ], [ 43.0, 0.34182459233142365 ], [ 44.0, 0.40881445570736175 ], [ 45.0, 0.17434993389158188 ], [ 46.0, 0.1149405024239752 ], [ 47.0, 0.12093433230498 ], [ 48.0, 0.19744380784486515 ], [ 49.0, 0.33459673865138806 ], [ 50.0, 0.5357426178933447 ], [ 51.0, 2.401410312913175 ], [ 52.0, 24.56024680475982 ], [ 53.0, 33.52772146319964 ], [ 54.0, 14.145614808285547 ], [ 55.0, 10.053768179814881 ], [ 56.0, 8.066637285147634 ], [ 57.0, 4.014455707360063 ], [ 58.0, 0.3037461436756276 ], [ 59.0, 0.063111502864698 ], [ 60.0, 0.03349493168796822 ], [ 61.0, 0.017628911414720113 ], [ 62.0, 0.011811370647862477 ], [ 63.0, 0.014808285588364898 ], [ 64.0, 0.023270163067430554 ], [ 65.0, 0.015866020273248103 ], [ 66.0, 0.004759806081974432 ], [ 67.0, 0.004407227853680028 ], [ 68.0, 0.003349493168796822 ], [ 69.0, 0.002644336712208017 ], [ 70.0, 0.004230938739532827 ], [ 71.0, 0.0021154693697664137 ], [ 72.0, 0.002644336712208017 ], [ 73.0, 0.003173204054649621 ], [ 74.0, 0.0017628911414720113 ], [ 75.0, 0.002291758483913615 ], [ 76.0, 0.002644336712208017 ], [ 77.0, 0.0021154693697664137 ], [ 78.0, 0.0015866020273248105 ], [ 79.0, 0.0010577346848832068 ], [ 80.0, 0.0005288673424416034 ], [ 81.0, 0.0 ], [ 82.0, 0.0005288673424416034 ], [ 83.0, 0.0005288673424416034 ], [ 84.0, 0.0010577346848832068 ], [ 85.0, 0.0028206258263552184 ], [ 86.0, 0.0021154693697664137 ], [ 87.0, 0.002291758483913615 ], [ 88.0, 0.002468047598060816 ], [ 89.0, 0.0017628911414720113 ], [ 90.0, 0.0010577346848832068 ], [ 91.0, 0.0007051564565888046 ], [ 92.0, 0.0017628911414720113 ], [ 93.0, 0.0010577346848832068 ], [ 94.0, 0.004759806081974432 ], [ 95.0, 0.003173204054649621 ], [ 96.0, 0.004759806081974432 ], [ 97.0, 0.007404142794182449 ], [ 98.0, 0.006875275451740845 ], [ 99.0, 0.01075363596297927 ], [ 100.0, 0.051476421330982694 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPFS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0011138586290627976 ], [ 8.0, 0.0011138586290627976 ], [ 9.0, 0.0005569293145313988 ], [ 10.0, 0.0 ], [ 11.0, 0.0005569293145313988 ], [ 12.0, 0.0011138586290627976 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0005569293145313988 ], [ 18.0, 0.0011138586290627976 ], [ 19.0, 0.0011138586290627976 ], [ 20.0, 0.0005569293145313988 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0005569293145313988 ], [ 24.0, 0.0022277172581255953 ], [ 25.0, 0.0022277172581255953 ], [ 26.0, 0.002413360362969395 ], [ 27.0, 0.0038985052017197924 ], [ 28.0, 0.0027846465726569943 ], [ 29.0, 0.0044554345162511905 ], [ 30.0, 0.005383650040470188 ], [ 31.0, 0.0040841483065635915 ], [ 32.0, 0.0035272189920321924 ], [ 33.0, 0.011324229395471775 ], [ 34.0, 0.013180660443909772 ], [ 35.0, 0.018007381169848565 ], [ 36.0, 0.037685550283291326 ], [ 37.0, 0.061633510808141466 ], [ 38.0, 0.07165823846970665 ], [ 39.0, 0.09319283863158748 ], [ 40.0, 0.10915814564815424 ], [ 41.0, 0.0883661179056486 ], [ 42.0, 0.1553832787542603 ], [ 43.0, 1.2673854767686117 ], [ 44.0, 1.614166796616864 ], [ 45.0, 0.484528503642319 ], [ 46.0, 0.2613854916200697 ], [ 47.0, 0.19046982556973832 ], [ 48.0, 0.27178150549132246 ], [ 49.0, 0.4054445409788585 ], [ 50.0, 0.6842804844542452 ], [ 51.0, 2.6977655995900944 ], [ 52.0, 24.67828049930569 ], [ 53.0, 32.29651659278072 ], [ 54.0, 13.666302806181147 ], [ 55.0, 9.509196759413953 ], [ 56.0, 6.781171333734315 ], [ 57.0, 3.3222690042846357 ], [ 58.0, 0.39300645295432396 ], [ 59.0, 0.16113821500441805 ], [ 60.0, 0.09467798347033783 ], [ 61.0, 0.06070529528392247 ], [ 62.0, 0.045482560686730907 ], [ 63.0, 0.05272264177563909 ], [ 64.0, 0.0946779834703378 ], [ 65.0, 0.08372504028455363 ], [ 66.0, 0.02636132088781955 ], [ 67.0, 0.01392323286328497 ], [ 68.0, 0.00464107762109499 ], [ 69.0, 0.0044554345162511905 ], [ 70.0, 0.006126222459845387 ], [ 71.0, 0.005012363830782589 ], [ 72.0, 0.006868794879220585 ], [ 73.0, 0.002970289677500794 ], [ 74.0, 0.0035272189920321924 ], [ 75.0, 0.0011138586290627976 ], [ 76.0, 0.002413360362969395 ], [ 77.0, 0.003712862096875992 ], [ 78.0, 0.0022277172581255953 ], [ 79.0, 0.0016707879435941965 ], [ 80.0, 0.0022277172581255953 ], [ 81.0, 0.0016707879435941965 ], [ 82.0, 0.0012995017339065972 ], [ 83.0, 0.0005569293145313988 ], [ 84.0, 0.0011138586290627976 ], [ 85.0, 0.001856431048437996 ], [ 86.0, 0.0011138586290627976 ], [ 87.0, 0.0011138586290627976 ], [ 88.0, 0.003341575887188393 ], [ 89.0, 0.0005569293145313988 ], [ 90.0, 0.0038985052017197924 ], [ 91.0, 0.0016707879435941965 ], [ 92.0, 0.0022277172581255953 ], [ 93.0, 0.0038985052017197924 ], [ 94.0, 0.0 ], [ 95.0, 0.0016707879435941965 ], [ 96.0, 0.005198006935626389 ], [ 97.0, 0.005198006935626389 ], [ 98.0, 0.004641077621094991 ], [ 99.0, 0.008539582822814782 ], [ 100.0, 0.047153348630325095 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPMS1_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0009164530821844581 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0009164530821844581 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0009164530821844581 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0009164530821844581 ], [ 14.0, 0.0 ], [ 15.0, 0.0009164530821844581 ], [ 16.0, 0.0 ], [ 17.0, 0.0018329061643689163 ], [ 18.0, 0.0018329061643689163 ], [ 19.0, 0.0027493592465533743 ], [ 20.0, 0.0 ], [ 21.0, 0.0027493592465533743 ], [ 22.0, 0.0027493592465533743 ], [ 23.0, 0.00458226541092229 ], [ 24.0, 0.0018329061643689163 ], [ 25.0, 0.0009164530821844581 ], [ 26.0, 0.0 ], [ 27.0, 0.0048877497716504435 ], [ 28.0, 0.014357764954223175 ], [ 29.0, 0.02077293652951438 ], [ 30.0, 0.030853920433543423 ], [ 31.0, 0.02993746735135896 ], [ 32.0, 0.050710403880873355 ], [ 33.0, 0.09164530821844581 ], [ 34.0, 0.08248077739660123 ], [ 35.0, 0.08736852716825168 ], [ 36.0, 0.07606560582131001 ], [ 37.0, 0.06384623139218391 ], [ 38.0, 0.05345976312742673 ], [ 39.0, 0.05712557545616456 ], [ 40.0, 0.061402356506358696 ], [ 41.0, 0.1032537139261156 ], [ 42.0, 0.1310527907523775 ], [ 43.0, 0.16954382020412473 ], [ 44.0, 0.15793541449645496 ], [ 45.0, 0.1270814940629115 ], [ 46.0, 0.1674054296790277 ], [ 47.0, 0.14632700878878516 ], [ 48.0, 0.7087237168893143 ], [ 49.0, 2.039413592221147 ], [ 50.0, 2.27708042486765 ], [ 51.0, 2.5590424898197357 ], [ 52.0, 22.339460331328347 ], [ 53.0, 30.724395064594667 ], [ 54.0, 18.53312519665556 ], [ 55.0, 13.616354410735953 ], [ 56.0, 3.470302337871815 ], [ 57.0, 1.3511573275006195 ], [ 58.0, 0.17412608561504703 ], [ 59.0, 0.0723997934925722 ], [ 60.0, 0.04948846643796073 ], [ 61.0, 0.024133264497524065 ], [ 62.0, 0.016190671118592095 ], [ 63.0, 0.04551716974849475 ], [ 64.0, 0.04246232614121323 ], [ 65.0, 0.025660686301164824 ], [ 66.0, 0.01466324931495133 ], [ 67.0, 0.007331624657475665 ], [ 68.0, 0.005498718493106749 ], [ 69.0, 0.0027493592465533743 ], [ 70.0, 0.0036658123287378326 ], [ 71.0, 0.003971296689465984 ], [ 72.0, 0.0076371090182038165 ], [ 73.0, 0.0036658123287378326 ], [ 74.0, 0.0036658123287378326 ], [ 75.0, 0.0027493592465533743 ], [ 76.0, 0.005498718493106749 ], [ 77.0, 0.0036658123287378326 ], [ 78.0, 0.00458226541092229 ], [ 79.0, 0.005498718493106749 ], [ 80.0, 0.0009164530821844581 ], [ 81.0, 0.0021383905250970687 ], [ 82.0, 0.0027493592465533743 ], [ 83.0, 0.003054843607281527 ], [ 84.0, 0.0 ], [ 85.0, 0.0018329061643689163 ], [ 86.0, 0.0009164530821844581 ], [ 87.0, 0.0036658123287378326 ], [ 88.0, 0.0009164530821844581 ], [ 89.0, 0.0027493592465533743 ], [ 90.0, 0.0027493592465533743 ], [ 91.0, 0.003054843607281527 ], [ 92.0, 0.0027493592465533743 ], [ 93.0, 0.0027493592465533743 ], [ 94.0, 0.0018329061643689163 ], [ 95.0, 0.0018329061643689163 ], [ 96.0, 0.006720655936019359 ], [ 97.0, 0.003971296689465984 ], [ 98.0, 0.0027493592465533743 ], [ 99.0, 0.007331624657475665 ], [ 100.0, 0.050099435159417074 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPMS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0008618856909737593 ], [ 3.0, 0.0 ], [ 4.0, 0.0017237713819475186 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0008618856909737593 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.002585657072921278 ], [ 23.0, 0.0017237713819475186 ], [ 24.0, 0.002585657072921278 ], [ 25.0, 0.002585657072921278 ], [ 26.0, 0.002585657072921278 ], [ 27.0, 0.0008618856909737593 ], [ 28.0, 0.0008618856909737593 ], [ 29.0, 0.0008618856909737593 ], [ 30.0, 0.003447542763895037 ], [ 31.0, 0.004309428454868796 ], [ 32.0, 0.0060331998368163145 ], [ 33.0, 0.01120451398265887 ], [ 34.0, 0.012353694903957218 ], [ 35.0, 0.009480742600711353 ], [ 36.0, 0.021547142274343983 ], [ 37.0, 0.028442227802134054 ], [ 38.0, 0.03217706579635368 ], [ 39.0, 0.038210265633169996 ], [ 40.0, 0.047403713003556766 ], [ 41.0, 0.06636519820497945 ], [ 42.0, 0.11807833966340497 ], [ 43.0, 0.428931778874606 ], [ 44.0, 0.5185678907358783 ], [ 45.0, 0.18846567109292883 ], [ 46.0, 0.14221113901067028 ], [ 47.0, 0.2355820888661609 ], [ 48.0, 0.815631158891501 ], [ 49.0, 3.4719628584726285 ], [ 50.0, 4.43928589897551 ], [ 51.0, 3.9520331883450126 ], [ 52.0, 26.11053971281967 ], [ 53.0, 28.50658193372674 ], [ 54.0, 15.31771979521598 ], [ 55.0, 9.960238340123086 ], [ 56.0, 3.507012876572227 ], [ 57.0, 1.3726966104908738 ], [ 58.0, 0.2036923183001318 ], [ 59.0, 0.06665249343530405 ], [ 60.0, 0.043956170239661724 ], [ 61.0, 0.024420094577589847 ], [ 62.0, 0.014939351976878498 ], [ 63.0, 0.022696323195642326 ], [ 64.0, 0.052575027149399316 ], [ 65.0, 0.03878485609381917 ], [ 66.0, 0.010342628291685111 ], [ 67.0, 0.005171314145842556 ], [ 68.0, 0.009480742600711353 ], [ 69.0, 0.0017237713819475186 ], [ 70.0, 0.0017237713819475186 ], [ 71.0, 0.0008618856909737593 ], [ 72.0, 0.002585657072921278 ], [ 73.0, 0.0017237713819475186 ], [ 74.0, 0.003447542763895037 ], [ 75.0, 0.0008618856909737593 ], [ 76.0, 0.0017237713819475186 ], [ 77.0, 0.002585657072921278 ], [ 78.0, 0.003447542763895037 ], [ 79.0, 0.002872952303245864 ], [ 80.0, 0.0008618856909737593 ], [ 81.0, 0.0017237713819475186 ], [ 82.0, 0.002585657072921278 ], [ 83.0, 0.0017237713819475186 ], [ 84.0, 0.003447542763895037 ], [ 85.0, 0.0017237713819475186 ], [ 86.0, 0.0 ], [ 87.0, 0.003734837994219623 ], [ 88.0, 0.0020110666122721047 ], [ 89.0, 0.0017237713819475186 ], [ 90.0, 0.0008618856909737593 ], [ 91.0, 0.0008618856909737593 ], [ 92.0, 0.0017237713819475186 ], [ 93.0, 0.0008618856909737593 ], [ 94.0, 0.0017237713819475186 ], [ 95.0, 0.0017237713819475186 ], [ 96.0, 0.004309428454868796 ], [ 97.0, 0.005458609376167141 ], [ 98.0, 0.0060331998368163145 ], [ 99.0, 0.004309428454868796 ], [ 100.0, 0.05171314145842559 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVFS1_R2", "pairs": [ [ 0.0, 0.002090417526060541 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0010452087630302704 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0010452087630302704 ], [ 12.0, 0.0 ], [ 13.0, 0.0010452087630302704 ], [ 14.0, 0.002090417526060541 ], [ 15.0, 0.0010452087630302704 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0010452087630302704 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.002090417526060541 ], [ 24.0, 0.0031356262890908106 ], [ 25.0, 0.004180835052121082 ], [ 26.0, 0.002090417526060541 ], [ 27.0, 0.0052260438151513515 ], [ 28.0, 0.0052260438151513515 ], [ 29.0, 0.007316461341211892 ], [ 30.0, 0.0031356262890908106 ], [ 31.0, 0.0031356262890908106 ], [ 32.0, 0.004180835052121082 ], [ 33.0, 0.006271252578181621 ], [ 34.0, 0.010452087630302703 ], [ 35.0, 0.017768548971514593 ], [ 36.0, 0.026130219075756755 ], [ 37.0, 0.02403980154969622 ], [ 38.0, 0.018813757734544866 ], [ 39.0, 0.03379508333797873 ], [ 40.0, 0.04703439433636216 ], [ 41.0, 0.06724176375494739 ], [ 42.0, 0.10068844417191601 ], [ 43.0, 0.42435475779028864 ], [ 44.0, 0.4727827638106906 ], [ 45.0, 0.1560845086125204 ], [ 46.0, 0.13761915379898562 ], [ 47.0, 0.17350465466302487 ], [ 48.0, 0.3487513239311002 ], [ 49.0, 0.8863370310496691 ], [ 50.0, 1.46921511789955 ], [ 51.0, 4.993659066837619 ], [ 52.0, 35.371258152628336 ], [ 53.0, 30.43055632978427 ], [ 54.0, 12.264131222476186 ], [ 55.0, 7.938360555214899 ], [ 56.0, 2.660056301912039 ], [ 57.0, 1.1950220190646093 ], [ 58.0, 0.25224371481130525 ], [ 59.0, 0.0982496237248454 ], [ 60.0, 0.04598918557333189 ], [ 61.0, 0.025781816154746662 ], [ 62.0, 0.025781816154746662 ], [ 63.0, 0.03449188917999892 ], [ 64.0, 0.015678131445454054 ], [ 65.0, 0.008361670104242163 ], [ 66.0, 0.011497296393332973 ], [ 67.0, 0.010800490551312792 ], [ 68.0, 0.006271252578181621 ], [ 69.0, 0.004180835052121082 ], [ 70.0, 0.0010452087630302704 ], [ 71.0, 0.0031356262890908106 ], [ 72.0, 0.002090417526060541 ], [ 73.0, 0.0076648642622219815 ], [ 74.0, 0.002090417526060541 ], [ 75.0, 0.0031356262890908106 ], [ 76.0, 0.002090417526060541 ], [ 77.0, 0.0 ], [ 78.0, 0.002090417526060541 ], [ 79.0, 0.0010452087630302704 ], [ 80.0, 0.0010452087630302704 ], [ 81.0, 0.0 ], [ 82.0, 0.002090417526060541 ], [ 83.0, 0.002090417526060541 ], [ 84.0, 0.004180835052121082 ], [ 85.0, 0.0010452087630302704 ], [ 86.0, 0.0031356262890908106 ], [ 87.0, 0.0010452087630302704 ], [ 88.0, 0.0010452087630302704 ], [ 89.0, 0.0010452087630302704 ], [ 90.0, 0.0010452087630302704 ], [ 91.0, 0.0 ], [ 92.0, 0.0010452087630302704 ], [ 93.0, 0.0024388204470706305 ], [ 94.0, 0.0010452087630302704 ], [ 95.0, 0.002090417526060541 ], [ 96.0, 0.0024388204470706305 ], [ 97.0, 0.004180835052121082 ], [ 98.0, 0.0034840292101009007 ], [ 99.0, 0.015329728524443963 ], [ 100.0, 0.06340933162383644 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVFS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.000732470157944981 ], [ 8.0, 0.001464940315889962 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.000732470157944981 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.000732470157944981 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.001464940315889962 ], [ 27.0, 0.0021974104738349434 ], [ 28.0, 0.004394820947669887 ], [ 29.0, 0.004394820947669887 ], [ 30.0, 0.0046389776669848795 ], [ 31.0, 0.002929880631779924 ], [ 32.0, 0.008301328456709785 ], [ 33.0, 0.010742895649859722 ], [ 34.0, 0.007813015018079798 ], [ 35.0, 0.022462418176979415 ], [ 36.0, 0.037600134774509034 ], [ 37.0, 0.03979754524834398 ], [ 38.0, 0.06006255295148844 ], [ 39.0, 0.07031713516271816 ], [ 40.0, 0.08569900847956276 ], [ 41.0, 0.12183420293818184 ], [ 42.0, 0.1779902483806305 ], [ 43.0, 1.0679414902837745 ], [ 44.0, 1.1983211783979757 ], [ 45.0, 0.30959072009141164 ], [ 46.0, 0.19239549482021504 ], [ 47.0, 0.19068639778501018 ], [ 48.0, 0.36135194458619035 ], [ 49.0, 0.7334467848222418 ], [ 50.0, 1.074777878424602 ], [ 51.0, 4.12844596689722 ], [ 52.0, 32.59467787183239 ], [ 53.0, 34.63387479155121 ], [ 54.0, 10.98876146620993 ], [ 55.0, 7.669695023841901 ], [ 56.0, 2.6971992782727403 ], [ 57.0, 0.8833590104816473 ], [ 58.0, 0.18433832308282022 ], [ 59.0, 0.05664435888107854 ], [ 60.0, 0.038576761651769 ], [ 61.0, 0.030275433195059216 ], [ 62.0, 0.025880612247389325 ], [ 63.0, 0.03613519445861907 ], [ 64.0, 0.04126248556423393 ], [ 65.0, 0.024171515212184375 ], [ 66.0, 0.008057171737394791 ], [ 67.0, 0.006348074702189835 ], [ 68.0, 0.004394820947669887 ], [ 69.0, 0.002929880631779924 ], [ 70.0, 0.004394820947669887 ], [ 71.0, 0.001464940315889962 ], [ 72.0, 0.0021974104738349434 ], [ 73.0, 0.005859761263559848 ], [ 74.0, 0.0021974104738349434 ], [ 75.0, 0.002929880631779924 ], [ 76.0, 0.0021974104738349434 ], [ 77.0, 0.001464940315889962 ], [ 78.0, 0.002929880631779924 ], [ 79.0, 0.003662350789724905 ], [ 80.0, 0.001464940315889962 ], [ 81.0, 0.0046389776669848795 ], [ 82.0, 0.0021974104738349434 ], [ 83.0, 0.0009766268772599747 ], [ 84.0, 0.003906507509039899 ], [ 85.0, 0.0021974104738349434 ], [ 86.0, 0.000732470157944981 ], [ 87.0, 0.000732470157944981 ], [ 88.0, 0.000732470157944981 ], [ 89.0, 0.001464940315889962 ], [ 90.0, 0.001464940315889962 ], [ 91.0, 0.001464940315889962 ], [ 92.0, 0.000732470157944981 ], [ 93.0, 0.0051272911056148675 ], [ 94.0, 0.002929880631779924 ], [ 95.0, 0.005859761263559848 ], [ 96.0, 0.0051272911056148675 ], [ 97.0, 0.0051272911056148675 ], [ 98.0, 0.005859761263559848 ], [ 99.0, 0.010987052369174716 ], [ 100.0, 0.05713267231970852 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVMS1_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0004487236057035759 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0008974472114071518 ], [ 19.0, 0.0008974472114071518 ], [ 20.0, 0.0 ], [ 21.0, 0.0004487236057035759 ], [ 22.0, 0.0017948944228143035 ], [ 23.0, 0.001495745352345253 ], [ 24.0, 0.001047021746641677 ], [ 25.0, 0.0026923416342214557 ], [ 26.0, 0.003141065239925032 ], [ 27.0, 0.003141065239925032 ], [ 28.0, 0.0022436180285178796 ], [ 29.0, 0.0022436180285178796 ], [ 30.0, 0.003589788845628607 ], [ 31.0, 0.004038512451332184 ], [ 32.0, 0.005534257803677435 ], [ 33.0, 0.011367664677823923 ], [ 34.0, 0.010769366536885823 ], [ 35.0, 0.010918941072120348 ], [ 36.0, 0.018547242369081136 ], [ 37.0, 0.026325118201276455 ], [ 38.0, 0.03978682637238373 ], [ 39.0, 0.042479168006605186 ], [ 40.0, 0.03948767730191467 ], [ 41.0, 0.04801342581028261 ], [ 42.0, 0.08271471798469252 ], [ 43.0, 0.9095627487611299 ], [ 44.0, 1.0742443120543592 ], [ 45.0, 0.26355033108323356 ], [ 46.0, 0.16602773411032304 ], [ 47.0, 0.2556228807158037 ], [ 48.0, 0.8458439967512403 ], [ 49.0, 3.1676895071967754 ], [ 50.0, 3.865155564995367 ], [ 51.0, 4.164005486393946 ], [ 52.0, 21.114240542776088 ], [ 53.0, 25.284079436044195 ], [ 54.0, 18.280550972757975 ], [ 55.0, 12.440562819061164 ], [ 56.0, 4.87523240143412 ], [ 57.0, 2.179300978367034 ], [ 58.0, 0.32367929424751274 ], [ 59.0, 0.07000088248975785 ], [ 60.0, 0.05982981409381012 ], [ 61.0, 0.037393633808631324 ], [ 62.0, 0.01735064608720494 ], [ 63.0, 0.03380384496300272 ], [ 64.0, 0.03230809961065747 ], [ 65.0, 0.021538733073771646 ], [ 66.0, 0.011367664677823923 ], [ 67.0, 0.003589788845628607 ], [ 68.0, 0.004038512451332184 ], [ 69.0, 0.003141065239925032 ], [ 70.0, 0.0017948944228143035 ], [ 71.0, 0.0017948944228143035 ], [ 72.0, 0.003141065239925032 ], [ 73.0, 0.002841916169455981 ], [ 74.0, 0.004487236057035759 ], [ 75.0, 0.005833406874146487 ], [ 76.0, 0.004188086986566708 ], [ 77.0, 0.0013461708171107279 ], [ 78.0, 0.0008974472114071518 ], [ 79.0, 0.0008974472114071518 ], [ 80.0, 0.0019444689580488288 ], [ 81.0, 0.002094043493283354 ], [ 82.0, 0.0013461708171107279 ], [ 83.0, 0.0008974472114071518 ], [ 84.0, 0.0017948944228143035 ], [ 85.0, 0.0017948944228143035 ], [ 86.0, 0.0008974472114071518 ], [ 87.0, 0.0017948944228143035 ], [ 88.0, 0.0008974472114071518 ], [ 89.0, 0.0016453198875797785 ], [ 90.0, 0.001047021746641677 ], [ 91.0, 0.0026923416342214557 ], [ 92.0, 0.0026923416342214557 ], [ 93.0, 0.0017948944228143035 ], [ 94.0, 0.0008974472114071518 ], [ 95.0, 0.0008974472114071518 ], [ 96.0, 0.0017948944228143035 ], [ 97.0, 0.0050855341979738605 ], [ 98.0, 0.007179577691257214 ], [ 99.0, 0.00987191932547867 ], [ 100.0, 0.05594087617771239 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVMS2_R2", "pairs": [ [ 0.0, 0.00371197545146901 ], [ 1.0, 0.0013919907943008788 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.00046399693143362624 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.00046399693143362624 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.00046399693143362624 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0013919907943008788 ], [ 25.0, 0.0013919907943008788 ], [ 26.0, 0.0023199846571681313 ], [ 27.0, 0.0009279938628672525 ], [ 28.0, 0.0020106533695457133 ], [ 29.0, 0.0015466564381120872 ], [ 30.0, 0.00371197545146901 ], [ 31.0, 0.005258631889581097 ], [ 32.0, 0.006805288327693186 ], [ 33.0, 0.010826595066784612 ], [ 34.0, 0.016858555175421754 ], [ 35.0, 0.0159305613125545 ], [ 36.0, 0.02227185270881406 ], [ 37.0, 0.022735849640247687 ], [ 38.0, 0.034026441638465924 ], [ 39.0, 0.04206905511664877 ], [ 40.0, 0.04670902443098503 ], [ 41.0, 0.05815428207301448 ], [ 42.0, 0.09388204579340376 ], [ 43.0, 0.6871794554531937 ], [ 44.0, 0.8058080042563858 ], [ 45.0, 0.1843614474229606 ], [ 46.0, 0.14012707329295512 ], [ 47.0, 0.18637210079250646 ], [ 48.0, 0.6922834216989702 ], [ 49.0, 1.4725715947265188 ], [ 50.0, 1.8095880325911435 ], [ 51.0, 3.9645444478127003 ], [ 52.0, 27.620036006161946 ], [ 53.0, 28.21642672869793 ], [ 54.0, 15.434703258495736 ], [ 55.0, 11.46644683523157 ], [ 56.0, 4.276041054448488 ], [ 57.0, 1.8259825908351308 ], [ 58.0, 0.29463805146035266 ], [ 59.0, 0.09202605806766921 ], [ 60.0, 0.06449557346927405 ], [ 61.0, 0.023973174790737354 ], [ 62.0, 0.0159305613125545 ], [ 63.0, 0.047791683937663504 ], [ 64.0, 0.05722628821014723 ], [ 65.0, 0.0388210765966134 ], [ 66.0, 0.021189193202135602 ], [ 67.0, 0.0038666410952802183 ], [ 68.0, 0.004021306739091427 ], [ 69.0, 0.003402644163846593 ], [ 70.0, 0.0051039662457698885 ], [ 71.0, 0.0020106533695457133 ], [ 72.0, 0.0024746503009793397 ], [ 73.0, 0.003402644163846593 ], [ 74.0, 0.0023199846571681313 ], [ 75.0, 0.004639969314336263 ], [ 76.0, 0.004639969314336263 ], [ 77.0, 0.004175972382902637 ], [ 78.0, 0.0023199846571681313 ], [ 79.0, 0.003247978520035384 ], [ 80.0, 0.0013919907943008788 ], [ 81.0, 0.002938647232412966 ], [ 82.0, 0.0030933128762241744 ], [ 83.0, 0.0024746503009793397 ], [ 84.0, 0.0013919907943008788 ], [ 85.0, 0.0027839815886017577 ], [ 86.0, 0.0030933128762241744 ], [ 87.0, 0.003247978520035383 ], [ 88.0, 0.002165319013356922 ], [ 89.0, 0.0015466564381120872 ], [ 90.0, 0.0013919907943008788 ], [ 91.0, 0.003247978520035384 ], [ 92.0, 0.00371197545146901 ], [ 93.0, 0.003247978520035384 ], [ 94.0, 0.0027839815886017577 ], [ 95.0, 0.0023199846571681313 ], [ 96.0, 0.00371197545146901 ], [ 97.0, 0.005258631889581098 ], [ 98.0, 0.0051039662457698885 ], [ 99.0, 0.009898601203917359 ], [ 100.0, 0.05567963177203508 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAFS1_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0012509460279336243 ], [ 44.0, 0.0012509460279336243 ], [ 45.0, 0.0006254730139668122 ], [ 46.0, 0.008912990449027075 ], [ 47.0, 0.3951425765735337 ], [ 48.0, 0.4087466146273118 ], [ 49.0, 0.07724591722490132 ], [ 50.0, 0.3449483672026977 ], [ 51.0, 5.27101745695182 ], [ 52.0, 30.608147411479937 ], [ 53.0, 10.809268259120957 ], [ 54.0, 1.265019170747878 ], [ 55.0, 3.4330650054103398 ], [ 56.0, 35.13657203259965 ], [ 57.0, 11.46382576823721 ], [ 58.0, 0.31867850061609093 ], [ 59.0, 0.10961414569768385 ], [ 60.0, 0.04659773954052751 ], [ 61.0, 0.026426234840097818 ], [ 62.0, 0.021735187235346724 ], [ 63.0, 0.016105930109645412 ], [ 64.0, 0.020796977714396505 ], [ 65.0, 0.01282219678631965 ], [ 66.0, 0.012040355518861134 ], [ 67.0, 0.01907692692598777 ], [ 68.0, 0.013604038053778165 ], [ 69.0, 0.012509460279336245 ], [ 70.0, 0.006567466646651528 ], [ 71.0, 0.007192939660618339 ], [ 72.0, 0.00860025394204367 ], [ 73.0, 0.005941993632684716 ], [ 74.0, 0.005160152365226201 ], [ 75.0, 0.004847415858242794 ], [ 76.0, 0.006098361886176419 ], [ 77.0, 0.008756622195535373 ], [ 78.0, 0.002814628562850655 ], [ 79.0, 0.004378311097767685 ], [ 80.0, 0.005160152365226201 ], [ 81.0, 0.005160152365226201 ], [ 82.0, 0.0045346793512593886 ], [ 83.0, 0.0018764190419004367 ], [ 84.0, 0.0014073142814253275 ], [ 85.0, 0.0009382095209502184 ], [ 86.0, 0.0014073142814253275 ], [ 87.0, 0.0014073142814253275 ], [ 88.0, 0.002970996816342358 ], [ 89.0, 0.002970996816342358 ], [ 90.0, 0.0023455238023755457 ], [ 91.0, 0.0018764190419004367 ], [ 92.0, 0.0014073142814253275 ], [ 93.0, 0.0023455238023755457 ], [ 94.0, 0.0023455238023755457 ], [ 95.0, 0.0023455238023755457 ], [ 96.0, 0.0023455238023755457 ], [ 97.0, 0.0014073142814253275 ], [ 98.0, 0.0023455238023755457 ], [ 99.0, 0.017356876137579042 ], [ 100.0, 0.020640609460904808 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAFS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.002024648065550007 ], [ 46.0, 0.005466549776985018 ], [ 47.0, 0.28183101072456096 ], [ 48.0, 0.3176672814847961 ], [ 49.0, 0.031989439435690104 ], [ 50.0, 0.0658010621303752 ], [ 51.0, 0.8290933828427278 ], [ 52.0, 5.495907173935495 ], [ 53.0, 1.8331163585489763 ], [ 54.0, 0.4899648318631017 ], [ 55.0, 5.502790977358363 ], [ 56.0, 62.98254955832295 ], [ 57.0, 21.07516910872966 ], [ 58.0, 0.5602201197376868 ], [ 59.0, 0.13261444829352545 ], [ 60.0, 0.06154930119272021 ], [ 61.0, 0.03867077805200513 ], [ 62.0, 0.02004401584894507 ], [ 63.0, 0.018626762203060063 ], [ 64.0, 0.01781690297684006 ], [ 65.0, 0.015184860491625053 ], [ 66.0, 0.012147888393300043 ], [ 67.0, 0.01417253645885005 ], [ 68.0, 0.009920775521195033 ], [ 69.0, 0.010325705134305035 ], [ 70.0, 0.009110916294975032 ], [ 71.0, 0.008098592262200027 ], [ 72.0, 0.0036443665179900124 ], [ 73.0, 0.00850352187531003 ], [ 74.0, 0.009110916294975032 ], [ 75.0, 0.006681338616315023 ], [ 76.0, 0.005061620163875017 ], [ 77.0, 0.007086268229425025 ], [ 78.0, 0.007086268229425025 ], [ 79.0, 0.0062764090032050215 ], [ 80.0, 0.00566901458354002 ], [ 81.0, 0.0034419017114350114 ], [ 82.0, 0.0022271128721050074 ], [ 83.0, 0.004859155357320017 ], [ 84.0, 0.003239436904880011 ], [ 85.0, 0.002024648065550007 ], [ 86.0, 0.003239436904880011 ], [ 87.0, 0.0024295776786600084 ], [ 88.0, 0.0036443665179900124 ], [ 89.0, 0.004454225744210015 ], [ 90.0, 0.0012147888393300042 ], [ 91.0, 0.0006073944196650021 ], [ 92.0, 0.0030369720983250107 ], [ 93.0, 0.0018221832589950062 ], [ 94.0, 0.002632042485215009 ], [ 95.0, 0.0024295776786600084 ], [ 96.0, 0.0024295776786600084 ], [ 97.0, 0.002024648065550007 ], [ 98.0, 0.003239436904880011 ], [ 99.0, 0.022473593527605078 ], [ 100.0, 0.027535213691480098 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAMS1_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.007466865783087553 ], [ 44.0, 0.006109253822526179 ], [ 45.0, 0.002545522426052575 ], [ 46.0, 0.0037334328915437764 ], [ 47.0, 0.1004632850815416 ], [ 48.0, 0.11098477777589227 ], [ 49.0, 0.052607463471753206 ], [ 50.0, 0.24742477981230987 ], [ 51.0, 3.447485872350533 ], [ 52.0, 19.144025658866063 ], [ 53.0, 6.127411882498689 ], [ 54.0, 0.9213094167359619 ], [ 55.0, 4.766914996521121 ], [ 56.0, 48.0046498209649 ], [ 57.0, 16.1778132265345 ], [ 58.0, 0.44071478269723596 ], [ 59.0, 0.10894835983505022 ], [ 60.0, 0.04870432908513926 ], [ 61.0, 0.031225075092911586 ], [ 62.0, 0.02460671678517489 ], [ 63.0, 0.015273134556315451 ], [ 64.0, 0.014764030071104934 ], [ 65.0, 0.012727612130262876 ], [ 66.0, 0.008654776248578754 ], [ 67.0, 0.010691194189420813 ], [ 68.0, 0.0125579106351927 ], [ 69.0, 0.0056001493373156646 ], [ 70.0, 0.00831537325843841 ], [ 71.0, 0.004072835881684119 ], [ 72.0, 0.0056001493373156646 ], [ 73.0, 0.0056001493373156646 ], [ 74.0, 0.0078062687732278965 ], [ 75.0, 0.004751641861964806 ], [ 76.0, 0.0037334328915437764 ], [ 77.0, 0.0030546269112630897 ], [ 78.0, 0.00509104485210515 ], [ 79.0, 0.004581940366894635 ], [ 80.0, 0.002545522426052575 ], [ 81.0, 0.0037334328915437764 ], [ 82.0, 0.0039031343866139483 ], [ 83.0, 0.0015273134556315448 ], [ 84.0, 0.002545522426052575 ], [ 85.0, 0.0005091044852105149 ], [ 86.0, 0.0 ], [ 87.0, 0.0015273134556315448 ], [ 88.0, 0.0020364179408420596 ], [ 89.0, 0.0010182089704210298 ], [ 90.0, 0.0030546269112630897 ], [ 91.0, 0.0015273134556315448 ], [ 92.0, 0.0030546269112630897 ], [ 93.0, 0.0015273134556315448 ], [ 94.0, 0.0010182089704210298 ], [ 95.0, 0.0037334328915437764 ], [ 96.0, 0.0027152239211227463 ], [ 97.0, 0.0010182089704210298 ], [ 98.0, 0.004072835881684119 ], [ 99.0, 0.021042985388701287 ], [ 100.0, 0.02986746313235023 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAMS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.004654286265201227 ], [ 44.0, 0.005152959793615645 ], [ 45.0, 0.0023271431326006135 ], [ 46.0, 0.012134389191417487 ], [ 47.0, 0.42137913151018264 ], [ 48.0, 0.45046842066769033 ], [ 49.0, 0.37417137082028457 ], [ 50.0, 1.038238286158816 ], [ 51.0, 2.0591892233326035 ], [ 52.0, 13.104142979674052 ], [ 53.0, 16.643395235340638 ], [ 54.0, 12.902013976156743 ], [ 55.0, 8.416778037088012 ], [ 56.0, 31.682723954281634 ], [ 57.0, 11.966668661360758 ], [ 58.0, 0.48022260786308396 ], [ 59.0, 0.07347123318639082 ], [ 60.0, 0.037566739140552766 ], [ 61.0, 0.027925717591207367 ], [ 62.0, 0.019282043098690804 ], [ 63.0, 0.041223678348925166 ], [ 64.0, 0.026595921515435588 ], [ 65.0, 0.015957552909261354 ], [ 66.0, 0.014960205852432518 ], [ 67.0, 0.012965511738774851 ], [ 68.0, 0.010638368606174236 ], [ 69.0, 0.008145000964102148 ], [ 70.0, 0.007978776454630677 ], [ 71.0, 0.006981429397801842 ], [ 72.0, 0.006316531359915953 ], [ 73.0, 0.007147653907273315 ], [ 74.0, 0.009474797039873929 ], [ 75.0, 0.003490714698900921 ], [ 76.0, 0.007978776454630677 ], [ 77.0, 0.003989388227315338 ], [ 78.0, 0.004654286265201227 ], [ 79.0, 0.0033244901894294485 ], [ 80.0, 0.0026595921515435586 ], [ 81.0, 0.0021609186231291416 ], [ 82.0, 0.003490714698900921 ], [ 83.0, 0.0036569392083723937 ], [ 84.0, 0.0009973470568288346 ], [ 85.0, 0.0026595921515435586 ], [ 86.0, 0.0026595921515435586 ], [ 87.0, 0.0 ], [ 88.0, 0.0024933676420720863 ], [ 89.0, 0.0014960205852432517 ], [ 90.0, 0.0029920411704865034 ], [ 91.0, 0.0029920411704865034 ], [ 92.0, 0.0024933676420720863 ], [ 93.0, 0.0024933676420720863 ], [ 94.0, 0.0009973470568288346 ], [ 95.0, 0.0016622450947147243 ], [ 96.0, 0.0016622450947147243 ], [ 97.0, 0.001994694113657669 ], [ 98.0, 0.0016622450947147243 ], [ 99.0, 0.015126430361903993 ], [ 100.0, 0.029920411704865056 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICFS1_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0005382150635631981 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0005382150635631981 ], [ 14.0, 0.0005382150635631981 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0010764301271263962 ], [ 20.0, 0.0021528602542527924 ], [ 21.0, 0.0026910753178159908 ], [ 22.0, 0.0010764301271263962 ], [ 23.0, 0.0016146451906895946 ], [ 24.0, 0.0016146451906895946 ], [ 25.0, 0.0021528602542527924 ], [ 26.0, 0.0016146451906895946 ], [ 27.0, 0.0021528602542527924 ], [ 28.0, 0.002332265275440525 ], [ 29.0, 0.004485125529693318 ], [ 30.0, 0.004305720508505585 ], [ 31.0, 0.0059203656991951795 ], [ 32.0, 0.0026910753178159908 ], [ 33.0, 0.010226086207700763 ], [ 34.0, 0.013634781610267686 ], [ 35.0, 0.019555147309462867 ], [ 36.0, 0.019016932245899665 ], [ 37.0, 0.02511670296628258 ], [ 38.0, 0.03247230883497962 ], [ 39.0, 0.032292903813791886 ], [ 40.0, 0.041263154873178526 ], [ 41.0, 0.04359542014861905 ], [ 42.0, 0.05579496158938487 ], [ 43.0, 0.07714415911072507 ], [ 44.0, 0.10172264701344444 ], [ 45.0, 0.14316520690781076 ], [ 46.0, 0.3055267510827088 ], [ 47.0, 2.852360431863762 ], [ 48.0, 3.7802432014467153 ], [ 49.0, 0.9942626274224141 ], [ 50.0, 0.9000749912988535 ], [ 51.0, 2.4861947836195992 ], [ 52.0, 19.872694196965142 ], [ 53.0, 35.47016673902673 ], [ 54.0, 12.30126408777926 ], [ 55.0, 7.5161733626600755 ], [ 56.0, 8.196836013046338 ], [ 57.0, 3.9232290033333346 ], [ 58.0, 0.36311576288397096 ], [ 59.0, 0.09024072565742955 ], [ 60.0, 0.06368878252164509 ], [ 61.0, 0.02870480339003723 ], [ 62.0, 0.01632585692808368 ], [ 63.0, 0.014172996673830884 ], [ 64.0, 0.006458580762758378 ], [ 65.0, 0.003229290381379189 ], [ 66.0, 0.004305720508505585 ], [ 67.0, 0.003946910466130119 ], [ 68.0, 0.0034086954025669214 ], [ 69.0, 0.003229290381379189 ], [ 70.0, 0.0053821506356319816 ], [ 71.0, 0.003767505444942387 ], [ 72.0, 0.004485125529693317 ], [ 73.0, 0.003229290381379189 ], [ 74.0, 0.0010764301271263962 ], [ 75.0, 0.003767505444942387 ], [ 76.0, 0.003229290381379189 ], [ 77.0, 0.0016146451906895946 ], [ 78.0, 0.0010764301271263962 ], [ 79.0, 0.0010764301271263962 ], [ 80.0, 0.0016146451906895946 ], [ 81.0, 0.0010764301271263962 ], [ 82.0, 0.0016146451906895946 ], [ 83.0, 0.0010764301271263962 ], [ 84.0, 0.0016146451906895946 ], [ 85.0, 0.0005382150635631981 ], [ 86.0, 0.0016146451906895946 ], [ 87.0, 0.003946910466130119 ], [ 88.0, 0.002332265275440525 ], [ 89.0, 0.0016146451906895946 ], [ 90.0, 0.0021528602542527924 ], [ 91.0, 0.0016146451906895946 ], [ 92.0, 0.003767505444942387 ], [ 93.0, 0.0034086954025669214 ], [ 94.0, 0.003946910466130119 ], [ 95.0, 0.003767505444942387 ], [ 96.0, 0.003946910466130119 ], [ 97.0, 0.004485125529693317 ], [ 98.0, 0.006458580762758378 ], [ 99.0, 0.011302516334827161 ], [ 100.0, 0.057050796737698944 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICFS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.00043376420577773904 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.00043376420577773904 ], [ 12.0, 0.0008675284115554781 ], [ 13.0, 0.00043376420577773904 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.00043376420577773904 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.001301292617333217 ], [ 24.0, 0.001301292617333217 ], [ 25.0, 0.0008675284115554781 ], [ 26.0, 0.0 ], [ 27.0, 0.0017350568231109561 ], [ 28.0, 0.0031809375090367524 ], [ 29.0, 0.0034701136462219123 ], [ 30.0, 0.003903877851999651 ], [ 31.0, 0.0017350568231109561 ], [ 32.0, 0.002168821028888695 ], [ 33.0, 0.003903877851999651 ], [ 34.0, 0.005638934675110607 ], [ 35.0, 0.010988693213036055 ], [ 36.0, 0.00867528411555478 ], [ 37.0, 0.018218096642665035 ], [ 38.0, 0.02168821028888695 ], [ 39.0, 0.02718255689540498 ], [ 40.0, 0.026748792689627238 ], [ 41.0, 0.03527948873658944 ], [ 42.0, 0.04525606546947744 ], [ 43.0, 0.06014863653451315 ], [ 44.0, 0.06752262803273472 ], [ 45.0, 0.08125849454902981 ], [ 46.0, 0.1174055116971747 ], [ 47.0, 0.7129637662300103 ], [ 48.0, 1.5628524334171938 ], [ 49.0, 2.4830109019403706 ], [ 50.0, 2.756137763511751 ], [ 51.0, 4.052514386512818 ], [ 52.0, 16.324715884445197 ], [ 53.0, 24.810878806280932 ], [ 54.0, 18.190480321563857 ], [ 55.0, 10.760533240796955 ], [ 56.0, 10.675370868395929 ], [ 57.0, 6.165813597061969 ], [ 58.0, 0.5938231977097246 ], [ 59.0, 0.08747578149851071 ], [ 60.0, 0.03817125010844103 ], [ 61.0, 0.025013735866516285 ], [ 62.0, 0.01691680402533182 ], [ 63.0, 0.023278679043405325 ], [ 64.0, 0.012723750036147013 ], [ 65.0, 0.002602585234666434 ], [ 66.0, 0.003036349440444173 ], [ 67.0, 0.002602585234666434 ], [ 68.0, 0.0014458806859257965 ], [ 69.0, 0.003903877851999651 ], [ 70.0, 0.003759289783407071 ], [ 71.0, 0.0027471733032590137 ], [ 72.0, 0.002602585234666434 ], [ 73.0, 0.0027471733032590137 ], [ 74.0, 0.00404846592059223 ], [ 75.0, 0.00433764205777739 ], [ 76.0, 0.002602585234666434 ], [ 77.0, 0.00043376420577773904 ], [ 78.0, 0.001301292617333217 ], [ 79.0, 0.00404846592059223 ], [ 80.0, 0.005638934675110607 ], [ 81.0, 0.0036147017148144907 ], [ 82.0, 0.0023134090974812746 ], [ 83.0, 0.0017350568231109561 ], [ 84.0, 0.001301292617333217 ], [ 85.0, 0.0017350568231109561 ], [ 86.0, 0.002168821028888695 ], [ 87.0, 0.001301292617333217 ], [ 88.0, 0.0017350568231109561 ], [ 89.0, 0.002168821028888695 ], [ 90.0, 0.0017350568231109561 ], [ 91.0, 0.002168821028888695 ], [ 92.0, 0.002168821028888695 ], [ 93.0, 0.0017350568231109561 ], [ 94.0, 0.0034701136462219123 ], [ 95.0, 0.0031809375090367524 ], [ 96.0, 0.00448223012636997 ], [ 97.0, 0.00433764205777739 ], [ 98.0, 0.005638934675110607 ], [ 99.0, 0.009687400595702838 ], [ 100.0, 0.05060582400740282 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICMS1_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.00038943893532587576 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.00038943893532587576 ], [ 7.0, 0.00038943893532587576 ], [ 8.0, 0.0007788778706517515 ], [ 9.0, 0.0 ], [ 10.0, 0.00038943893532587576 ], [ 11.0, 0.0007788778706517515 ], [ 12.0, 0.0007788778706517515 ], [ 13.0, 0.0 ], [ 14.0, 0.00038943893532587576 ], [ 15.0, 0.00038943893532587576 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.00038943893532587576 ], [ 19.0, 0.0 ], [ 20.0, 0.0007788778706517515 ], [ 21.0, 0.0011683168059776273 ], [ 22.0, 0.001557755741303503 ], [ 23.0, 0.0007788778706517515 ], [ 24.0, 0.0007788778706517515 ], [ 25.0, 0.0011683168059776273 ], [ 26.0, 0.0019471946766293788 ], [ 27.0, 0.0011683168059776273 ], [ 28.0, 0.0019471946766293788 ], [ 29.0, 0.0036347633963748397 ], [ 30.0, 0.001557755741303503 ], [ 31.0, 0.0035049504179328816 ], [ 32.0, 0.005841584029888137 ], [ 33.0, 0.0063608359436559715 ], [ 34.0, 0.008697469555611225 ], [ 35.0, 0.014019801671731526 ], [ 36.0, 0.021808580378249044 ], [ 37.0, 0.025053904839298008 ], [ 38.0, 0.02842904227878893 ], [ 39.0, 0.028818481214114802 ], [ 40.0, 0.030765675890744183 ], [ 41.0, 0.035438943114654696 ], [ 42.0, 0.041929592036752616 ], [ 43.0, 0.05568976775160024 ], [ 44.0, 0.07035863431554157 ], [ 45.0, 0.08983058108183535 ], [ 46.0, 0.17174257047871114 ], [ 47.0, 1.5277689432834107 ], [ 48.0, 1.9503101881119855 ], [ 49.0, 0.4433113213792885 ], [ 50.0, 0.4966644555189331 ], [ 51.0, 2.7162067609195333 ], [ 52.0, 21.182752009180394 ], [ 53.0, 23.58870575162363 ], [ 54.0, 4.536314531654243 ], [ 55.0, 3.8884179562504277 ], [ 56.0, 25.429713411887526 ], [ 57.0, 12.53396232048484 ], [ 58.0, 0.7337029541539497 ], [ 59.0, 0.09424422234886194 ], [ 60.0, 0.040112210338565206 ], [ 61.0, 0.01674587421901266 ], [ 62.0, 0.009606160404704935 ], [ 63.0, 0.007918591684959474 ], [ 64.0, 0.007139713814307721 ], [ 65.0, 0.005841584029888137 ], [ 66.0, 0.004024202331700716 ], [ 67.0, 0.0019471946766293788 ], [ 68.0, 0.0019471946766293788 ], [ 69.0, 0.0007788778706517515 ], [ 70.0, 0.0011683168059776273 ], [ 71.0, 0.0023366336119552546 ], [ 72.0, 0.0023366336119552546 ], [ 73.0, 0.0023366336119552546 ], [ 74.0, 0.003115511482607006 ], [ 75.0, 0.004024202331700716 ], [ 76.0, 0.0019471946766293788 ], [ 77.0, 0.001557755741303503 ], [ 78.0, 0.001557755741303503 ], [ 79.0, 0.0007788778706517515 ], [ 80.0, 0.0011683168059776273 ], [ 81.0, 0.0023366336119552546 ], [ 82.0, 0.0038943893532587576 ], [ 83.0, 0.0019471946766293788 ], [ 84.0, 0.001557755741303503 ], [ 85.0, 0.001557755741303503 ], [ 86.0, 0.0019471946766293788 ], [ 87.0, 0.0007788778706517515 ], [ 88.0, 0.0011683168059776273 ], [ 89.0, 0.0007788778706517515 ], [ 90.0, 0.001557755741303503 ], [ 91.0, 0.0011683168059776273 ], [ 92.0, 0.0011683168059776273 ], [ 93.0, 0.002077007655071337 ], [ 94.0, 0.002596259568839171 ], [ 95.0, 0.0027260725472811305 ], [ 96.0, 0.003115511482607006 ], [ 97.0, 0.0028558855257230886 ], [ 98.0, 0.006490648922097928 ], [ 99.0, 0.009086908490937101 ], [ 100.0, 0.050886687549247696 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICMS2_R2", "pairs": [ [ 0.0, 0.0011988802458503755 ], [ 1.0, 0.0011988802458503755 ], [ 2.0, 0.0 ], [ 3.0, 0.0005994401229251877 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0005994401229251877 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0005994401229251877 ], [ 15.0, 0.0005994401229251877 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0011988802458503755 ], [ 23.0, 0.002597573866009147 ], [ 24.0, 0.0005994401229251877 ], [ 25.0, 0.0005994401229251877 ], [ 26.0, 0.001798320368775563 ], [ 27.0, 0.003596640737551126 ], [ 28.0, 0.0005994401229251877 ], [ 29.0, 0.0007992534972335835 ], [ 30.0, 0.001998133743083959 ], [ 31.0, 0.001798320368775563 ], [ 32.0, 0.001798320368775563 ], [ 33.0, 0.009191415218186212 ], [ 34.0, 0.007193281475102252 ], [ 35.0, 0.016784323441905256 ], [ 36.0, 0.02637536540870826 ], [ 37.0, 0.027374432280250244 ], [ 38.0, 0.03796454111859523 ], [ 39.0, 0.04056211498460437 ], [ 40.0, 0.04016248823598757 ], [ 41.0, 0.043958942347847106 ], [ 42.0, 0.048554649956940206 ], [ 43.0, 0.07632870898580724 ], [ 44.0, 0.0927134056790957 ], [ 45.0, 0.1290794398032238 ], [ 46.0, 0.35267060565431885 ], [ 47.0, 3.30591227793241 ], [ 48.0, 4.326558993899697 ], [ 49.0, 0.8683889247442884 ], [ 50.0, 0.8665906043755105 ], [ 51.0, 5.187155197045942 ], [ 52.0, 34.44482853015284 ], [ 53.0, 19.85765295214269 ], [ 54.0, 2.8689204283199485 ], [ 55.0, 2.8912995262424888 ], [ 56.0, 15.785656197111885 ], [ 57.0, 7.762150151758259 ], [ 58.0, 0.5360992832694262 ], [ 59.0, 0.07712796248304081 ], [ 60.0, 0.031970139889343344 ], [ 61.0, 0.0195817106822228 ], [ 62.0, 0.013986936201587714 ], [ 63.0, 0.016384696693288462 ], [ 64.0, 0.007393094849410648 ], [ 65.0, 0.001798320368775563 ], [ 66.0, 0.004795520983401502 ], [ 67.0, 0.003596640737551126 ], [ 68.0, 0.003596640737551126 ], [ 69.0, 0.001798320368775563 ], [ 70.0, 0.002397760491700751 ], [ 71.0, 0.0005994401229251877 ], [ 72.0, 0.001798320368775563 ], [ 73.0, 0.0005994401229251877 ], [ 74.0, 0.001798320368775563 ], [ 75.0, 0.004196080860476314 ], [ 76.0, 0.005994401229251878 ], [ 77.0, 0.002997200614625939 ], [ 78.0, 0.001798320368775563 ], [ 79.0, 0.001798320368775563 ], [ 80.0, 0.004196080860476314 ], [ 81.0, 0.002397760491700751 ], [ 82.0, 0.0011988802458503755 ], [ 83.0, 0.002397760491700751 ], [ 84.0, 0.002997200614625939 ], [ 85.0, 0.0 ], [ 86.0, 0.0007992534972335835 ], [ 87.0, 0.0013986936201587712 ], [ 88.0, 0.001798320368775563 ], [ 89.0, 0.0005994401229251877 ], [ 90.0, 0.001798320368775563 ], [ 91.0, 0.0005994401229251877 ], [ 92.0, 0.0011988802458503755 ], [ 93.0, 0.002997200614625939 ], [ 94.0, 0.002997200614625939 ], [ 95.0, 0.002997200614625939 ], [ 96.0, 0.002997200614625939 ], [ 97.0, 0.004795520983401502 ], [ 98.0, 0.008991601843877815 ], [ 99.0, 0.013787122827279319 ], [ 100.0, 0.0607432657897523 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPFS1_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.000946533478889149 ], [ 3.0, 0.000946533478889149 ], [ 4.0, 0.0004732667394445745 ], [ 5.0, 0.0 ], [ 6.0, 0.0004732667394445745 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0004732667394445745 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0004732667394445745 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0004732667394445745 ], [ 17.0, 0.0 ], [ 18.0, 0.0004732667394445745 ], [ 19.0, 0.0004732667394445745 ], [ 20.0, 0.0004732667394445745 ], [ 21.0, 0.000946533478889149 ], [ 22.0, 0.001893066957778298 ], [ 23.0, 0.001893066957778298 ], [ 24.0, 0.0014198002183337234 ], [ 25.0, 0.001893066957778298 ], [ 26.0, 0.0023663336972228723 ], [ 27.0, 0.0033128671761120214 ], [ 28.0, 0.0025240892770377306 ], [ 29.0, 0.0020508225375931556 ], [ 30.0, 0.003786133915556596 ], [ 31.0, 0.004732667394445745 ], [ 32.0, 0.006152467612779468 ], [ 33.0, 0.005679200873334894 ], [ 34.0, 0.005679200873334894 ], [ 35.0, 0.006152467612779468 ], [ 36.0, 0.009938601528336064 ], [ 37.0, 0.013724735443892659 ], [ 38.0, 0.01893066957778298 ], [ 39.0, 0.023190070232784146 ], [ 40.0, 0.03170887154278649 ], [ 41.0, 0.044329317927975134 ], [ 42.0, 0.05079729670038432 ], [ 43.0, 0.06704612142131472 ], [ 44.0, 0.0686236772194633 ], [ 45.0, 0.07446063367261306 ], [ 46.0, 0.09102496955317316 ], [ 47.0, 0.3098319587563814 ], [ 48.0, 0.4496034024723458 ], [ 49.0, 0.2421548150158072 ], [ 50.0, 0.3469045200128733 ], [ 51.0, 1.1757523363601396 ], [ 52.0, 16.971187520902582 ], [ 53.0, 53.524417408643686 ], [ 54.0, 15.015807109097445 ], [ 55.0, 4.997539012954891 ], [ 56.0, 3.8724262177153213 ], [ 57.0, 2.045774359039082 ], [ 58.0, 0.18189218352653141 ], [ 59.0, 0.04464482908760486 ], [ 60.0, 0.025240892770377304 ], [ 61.0, 0.016564335880560103 ], [ 62.0, 0.016722091460374962 ], [ 63.0, 0.011989424065929219 ], [ 64.0, 0.005836956453149752 ], [ 65.0, 0.004732667394445745 ], [ 66.0, 0.004732667394445745 ], [ 67.0, 0.0023663336972228723 ], [ 68.0, 0.0033128671761120214 ], [ 69.0, 0.005363689713705177 ], [ 70.0, 0.002839600436667447 ], [ 71.0, 0.00520593413389032 ], [ 72.0, 0.00520593413389032 ], [ 73.0, 0.002839600436667447 ], [ 74.0, 0.001893066957778298 ], [ 75.0, 0.0033128671761120214 ], [ 76.0, 0.002839600436667447 ], [ 77.0, 0.003786133915556596 ], [ 78.0, 0.0014198002183337234 ], [ 79.0, 0.001893066957778298 ], [ 80.0, 0.000946533478889149 ], [ 81.0, 0.001893066957778298 ], [ 82.0, 0.001893066957778298 ], [ 83.0, 0.003943889495371454 ], [ 84.0, 0.0029973560164823047 ], [ 85.0, 0.004890422974260602 ], [ 86.0, 0.005363689713705177 ], [ 87.0, 0.002839600436667447 ], [ 88.0, 0.0014198002183337234 ], [ 89.0, 0.0014198002183337234 ], [ 90.0, 0.0023663336972228723 ], [ 91.0, 0.0014198002183337234 ], [ 92.0, 0.001893066957778298 ], [ 93.0, 0.001893066957778298 ], [ 94.0, 0.0034706227559268793 ], [ 95.0, 0.0034706227559268793 ], [ 96.0, 0.0020508225375931556 ], [ 97.0, 0.00425940065500117 ], [ 98.0, 0.00773002341092805 ], [ 99.0, 0.013409224284262944 ], [ 100.0, 0.07446063367261306 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPFS2_R2", "pairs": [ [ 0.0, 0.0006700736187549139 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.00033503680937745697 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.00033503680937745697 ], [ 7.0, 0.00033503680937745697 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.00033503680937745697 ], [ 12.0, 0.00033503680937745697 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0006700736187549139 ], [ 17.0, 0.0006700736187549139 ], [ 18.0, 0.00033503680937745697 ], [ 19.0, 0.00033503680937745697 ], [ 20.0, 0.0006700736187549139 ], [ 21.0, 0.0006700736187549139 ], [ 22.0, 0.001005110428132371 ], [ 23.0, 0.00044671574583660925 ], [ 24.0, 0.00044671574583660925 ], [ 25.0, 0.001675184046887285 ], [ 26.0, 0.0013401472375098279 ], [ 27.0, 0.001005110428132371 ], [ 28.0, 0.002010220856264742 ], [ 29.0, 0.0030153312843971126 ], [ 30.0, 0.0030153312843971126 ], [ 31.0, 0.005472267886498465 ], [ 32.0, 0.003127010220856265 ], [ 33.0, 0.0048021942677435505 ], [ 34.0, 0.006030662568794225 ], [ 35.0, 0.011502930455292687 ], [ 36.0, 0.013513151311557432 ], [ 37.0, 0.016751840468872847 ], [ 38.0, 0.024792723893931813 ], [ 39.0, 0.030488349653348585 ], [ 40.0, 0.03160513901794011 ], [ 41.0, 0.0360722964763062 ], [ 42.0, 0.03964602244299908 ], [ 43.0, 0.053270852691015655 ], [ 44.0, 0.05851976270459583 ], [ 45.0, 0.06667232506611394 ], [ 46.0, 0.08599278107354728 ], [ 47.0, 0.21475859481094994 ], [ 48.0, 1.186588699878494 ], [ 49.0, 2.6511462726038153 ], [ 50.0, 3.1624124437138157 ], [ 51.0, 4.015862876134664 ], [ 52.0, 15.486518118790679 ], [ 53.0, 26.248458830676874 ], [ 54.0, 24.600859481094997 ], [ 55.0, 11.464847937960116 ], [ 56.0, 6.508090022157101 ], [ 57.0, 3.391800979200915 ], [ 58.0, 0.29003019798441865 ], [ 59.0, 0.04657011650346652 ], [ 60.0, 0.02289418197412623 ], [ 61.0, 0.010162783217782861 ], [ 62.0, 0.009381030662568795 ], [ 63.0, 0.019432134943892506 ], [ 64.0, 0.009716067471946253 ], [ 65.0, 0.005025552140661855 ], [ 66.0, 0.0030153312843971126 ], [ 67.0, 0.001675184046887285 ], [ 68.0, 0.003685404903152027 ], [ 69.0, 0.003685404903152027 ], [ 70.0, 0.002345257665642199 ], [ 71.0, 0.002345257665642199 ], [ 72.0, 0.0006700736187549139 ], [ 73.0, 0.001005110428132371 ], [ 74.0, 0.001675184046887285 ], [ 75.0, 0.0026802944750196557 ], [ 76.0, 0.001675184046887285 ], [ 77.0, 0.002121899792723894 ], [ 78.0, 0.001786862983346437 ], [ 79.0, 0.002345257665642199 ], [ 80.0, 0.002121899792723894 ], [ 81.0, 0.002010220856264742 ], [ 82.0, 0.001675184046887285 ], [ 83.0, 0.002010220856264742 ], [ 84.0, 0.0026802944750196557 ], [ 85.0, 0.002345257665642199 ], [ 86.0, 0.002121899792723894 ], [ 87.0, 0.001786862983346437 ], [ 88.0, 0.002345257665642199 ], [ 89.0, 0.0013401472375098279 ], [ 90.0, 0.0006700736187549139 ], [ 91.0, 0.0013401472375098279 ], [ 92.0, 0.001675184046887285 ], [ 93.0, 0.0027919734114788077 ], [ 94.0, 0.0015635051104281325 ], [ 95.0, 0.003127010220856265 ], [ 96.0, 0.003685404903152027 ], [ 97.0, 0.005695625759416768 ], [ 98.0, 0.0048021942677435505 ], [ 99.0, 0.009157672789650491 ], [ 100.0, 0.061870130798370455 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPMS1_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0002180264248026864 ], [ 2.0, 0.0 ], [ 3.0, 0.0004360528496053728 ], [ 4.0, 0.0004360528496053728 ], [ 5.0, 0.0002180264248026864 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.00029070189973691516 ], [ 13.0, 0.00029070189973691516 ], [ 14.0, 0.0 ], [ 15.0, 0.00029070189973691516 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0002180264248026864 ], [ 20.0, 0.0006540792744080592 ], [ 21.0, 0.0002180264248026864 ], [ 22.0, 0.0008721056992107456 ], [ 23.0, 0.0004360528496053728 ], [ 24.0, 0.0011628075989476606 ], [ 25.0, 0.0009447811741449743 ], [ 26.0, 0.0008721056992107456 ], [ 27.0, 0.002616317097632237 ], [ 28.0, 0.0019622378232241776 ], [ 29.0, 0.002616317097632237 ], [ 30.0, 0.0023982906728295503 ], [ 31.0, 0.0021802642480268637 ], [ 32.0, 0.003924475646448355 ], [ 33.0, 0.005668687044869846 ], [ 34.0, 0.008575706042238996 ], [ 35.0, 0.014535094986845758 ], [ 36.0, 0.023692204828558588 ], [ 37.0, 0.029869620197968037 ], [ 38.0, 0.032921990145205644 ], [ 39.0, 0.03808194886553589 ], [ 40.0, 0.03895405456474663 ], [ 41.0, 0.04549484730882723 ], [ 42.0, 0.05159958720330245 ], [ 43.0, 0.0613381008444891 ], [ 44.0, 0.065117225541069 ], [ 45.0, 0.07543714298172947 ], [ 46.0, 0.13539440980246828 ], [ 47.0, 0.9017572929839108 ], [ 48.0, 1.3371560633148751 ], [ 49.0, 1.0497972354249352 ], [ 50.0, 1.6429017863631614 ], [ 51.0, 6.628075989476527 ], [ 52.0, 44.6791377781655 ], [ 53.0, 27.707306792249863 ], [ 54.0, 6.942906146891661 ], [ 55.0, 5.137356647625696 ], [ 56.0, 2.131135626971325 ], [ 57.0, 0.8032820244480314 ], [ 58.0, 0.12311225453858357 ], [ 59.0, 0.03575633366764057 ], [ 60.0, 0.02252939722961093 ], [ 61.0, 0.012572857163621581 ], [ 62.0, 0.009302460791581285 ], [ 63.0, 0.01635198186020148 ], [ 64.0, 0.01271820811349004 ], [ 65.0, 0.005668687044869846 ], [ 66.0, 0.002616317097632237 ], [ 67.0, 0.0013081585488161184 ], [ 68.0, 0.0021802642480268637 ], [ 69.0, 0.0024709661477637793 ], [ 70.0, 0.0015261849736188048 ], [ 71.0, 0.0017442113984214912 ], [ 72.0, 0.0034884227968429824 ], [ 73.0, 0.002616317097632237 ], [ 74.0, 0.002688992572566465 ], [ 75.0, 0.0029070189973691516 ], [ 76.0, 0.0021802642480268637 ], [ 77.0, 0.0023982906728295503 ], [ 78.0, 0.0023982906728295503 ], [ 79.0, 0.0008721056992107456 ], [ 80.0, 0.0010901321240134319 ], [ 81.0, 0.0017442113984214912 ], [ 82.0, 0.002470966147763779 ], [ 83.0, 0.0018168868733557198 ], [ 84.0, 0.0008721056992107456 ], [ 85.0, 0.0006540792744080592 ], [ 86.0, 0.0015261849736188048 ], [ 87.0, 0.0015261849736188048 ], [ 88.0, 0.0012354830738818894 ], [ 89.0, 0.0008721056992107456 ], [ 90.0, 0.0018168868733557198 ], [ 91.0, 0.0011628075989476606 ], [ 92.0, 0.0018168868733557198 ], [ 93.0, 0.0015261849736188048 ], [ 94.0, 0.002834343522434923 ], [ 95.0, 0.0021802642480268637 ], [ 96.0, 0.003997151121382584 ], [ 97.0, 0.005232634195264474 ], [ 98.0, 0.007267547493422881 ], [ 99.0, 0.012354830738818897 ], [ 100.0, 0.0658439802904113 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPMS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0006203878044165409 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.00031019390220827044 ], [ 5.0, 0.0006203878044165409 ], [ 6.0, 0.00031019390220827044 ], [ 7.0, 0.00031019390220827044 ], [ 8.0, 0.00031019390220827044 ], [ 9.0, 0.0006203878044165409 ], [ 10.0, 0.00031019390220827044 ], [ 11.0, 0.00031019390220827044 ], [ 12.0, 0.00031019390220827044 ], [ 13.0, 0.00031019390220827044 ], [ 14.0, 0.0 ], [ 15.0, 0.00031019390220827044 ], [ 16.0, 0.0006203878044165409 ], [ 17.0, 0.00031019390220827044 ], [ 18.0, 0.0 ], [ 19.0, 0.00031019390220827044 ], [ 20.0, 0.00031019390220827044 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.00031019390220827044 ], [ 24.0, 0.0006203878044165409 ], [ 25.0, 0.0009305817066248114 ], [ 26.0, 0.0015509695110413522 ], [ 27.0, 0.0015509695110413522 ], [ 28.0, 0.0012407756088330818 ], [ 29.0, 0.0009305817066248114 ], [ 30.0, 0.003825724793902002 ], [ 31.0, 0.002171357315457893 ], [ 32.0, 0.006617469913776437 ], [ 33.0, 0.007961643490012275 ], [ 34.0, 0.008271837392220547 ], [ 35.0, 0.010133000805470168 ], [ 36.0, 0.017164062588857634 ], [ 37.0, 0.024505318274453364 ], [ 38.0, 0.03432812517771527 ], [ 39.0, 0.03556890078654834 ], [ 40.0, 0.049424228418517756 ], [ 41.0, 0.04704607516825435 ], [ 42.0, 0.049734422320726036 ], [ 43.0, 0.056765484104113494 ], [ 44.0, 0.06865625035543052 ], [ 45.0, 0.08602710887909366 ], [ 46.0, 0.1505474405384139 ], [ 47.0, 1.2258863015270849 ], [ 48.0, 2.0337346208448235 ], [ 49.0, 1.4164487554503655 ], [ 50.0, 1.6634664995755513 ], [ 51.0, 3.3883513917883454 ], [ 52.0, 20.356371434450388 ], [ 53.0, 30.8655340453317 ], [ 54.0, 17.643415565736838 ], [ 55.0, 16.51089762877442 ], [ 56.0, 3.305943211768344 ], [ 57.0, 0.6196640186447215 ], [ 58.0, 0.09874505886963275 ], [ 59.0, 0.027917451198744343 ], [ 60.0, 0.01623348088223282 ], [ 61.0, 0.010856786577289465 ], [ 62.0, 0.007444653652998491 ], [ 63.0, 0.007754847555206761 ], [ 64.0, 0.005066500402735084 ], [ 65.0, 0.0035155308916937317 ], [ 66.0, 0.0028951430872771904 ], [ 67.0, 0.0032053369894854606 ], [ 68.0, 0.0031019390220827043 ], [ 69.0, 0.0012407756088330818 ], [ 70.0, 0.0027917451198744337 ], [ 71.0, 0.0027917451198744337 ], [ 72.0, 0.0015509695110413522 ], [ 73.0, 0.0027917451198744337 ], [ 74.0, 0.002171357315457893 ], [ 75.0, 0.0015509695110413522 ], [ 76.0, 0.0009305817066248114 ], [ 77.0, 0.00031019390220827044 ], [ 78.0, 0.0015509695110413522 ], [ 79.0, 0.0012407756088330818 ], [ 80.0, 0.0018611634132496228 ], [ 81.0, 0.0015509695110413522 ], [ 82.0, 0.0018611634132496228 ], [ 83.0, 0.0013441735762358385 ], [ 84.0, 0.0015509695110413522 ], [ 85.0, 0.0012407756088330818 ], [ 86.0, 0.0009305817066248114 ], [ 87.0, 0.0 ], [ 88.0, 0.0013441735762358385 ], [ 89.0, 0.0025849491850689203 ], [ 90.0, 0.002171357315457893 ], [ 91.0, 0.0012407756088330818 ], [ 92.0, 0.0022747552828606497 ], [ 93.0, 0.0016543674784441089 ], [ 94.0, 0.0018611634132496228 ], [ 95.0, 0.0012407756088330818 ], [ 96.0, 0.003412132924290975 ], [ 97.0, 0.0044461125983185435 ], [ 98.0, 0.0051698983701378405 ], [ 99.0, 0.009512613001053627 ], [ 100.0, 0.045288309722407466 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVFS1_R2", "pairs": [ [ 0.0, 0.0006599280678406061 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.00032996403392030306 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.00032996403392030306 ], [ 9.0, 0.00032996403392030306 ], [ 10.0, 0.00032996403392030306 ], [ 11.0, 0.00032996403392030306 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.00032996403392030306 ], [ 16.0, 0.0 ], [ 17.0, 0.0007699160791473738 ], [ 18.0, 0.00032996403392030306 ], [ 19.0, 0.00032996403392030306 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.00032996403392030306 ], [ 23.0, 0.0013198561356812123 ], [ 24.0, 0.0006599280678406061 ], [ 25.0, 0.0013198561356812123 ], [ 26.0, 0.0016498201696015155 ], [ 27.0, 0.0013198561356812123 ], [ 28.0, 0.001979784203521819 ], [ 29.0, 0.003299640339203031 ], [ 30.0, 0.007039232723633132 ], [ 31.0, 0.004069556418350405 ], [ 32.0, 0.005389412554031617 ], [ 33.0, 0.00769916079147374 ], [ 34.0, 0.00912900493846172 ], [ 35.0, 0.01814802186561667 ], [ 36.0, 0.028706870951066367 ], [ 37.0, 0.04058557617219728 ], [ 38.0, 0.04696488082798981 ], [ 39.0, 0.051034437246340214 ], [ 40.0, 0.05532396968730416 ], [ 41.0, 0.057413741902132734 ], [ 42.0, 0.057083777868212435 ], [ 43.0, 0.057193765879519194 ], [ 44.0, 0.06808257899888921 ], [ 45.0, 0.08667055290973293 ], [ 46.0, 0.11669727999648052 ], [ 47.0, 0.4515007864142813 ], [ 48.0, 0.6257217963242013 ], [ 49.0, 0.4090454140498688 ], [ 50.0, 0.9548059261540556 ], [ 51.0, 6.625897777142299 ], [ 52.0, 44.20561158833689 ], [ 53.0, 34.71386618858544 ], [ 54.0, 9.375818035834099 ], [ 55.0, 1.1413455933303285 ], [ 56.0, 0.3131358681903676 ], [ 57.0, 0.17741066223781632 ], [ 58.0, 0.0524642813933282 ], [ 59.0, 0.02727702680407839 ], [ 60.0, 0.014628405503800103 ], [ 61.0, 0.009238992949768486 ], [ 62.0, 0.006379304655792526 ], [ 63.0, 0.006379304655792526 ], [ 64.0, 0.003629604373123334 ], [ 65.0, 0.0030796643165894953 ], [ 66.0, 0.0026397122713624245 ], [ 67.0, 0.00571937658795192 ], [ 68.0, 0.0016498201696015155 ], [ 69.0, 0.0027497002826691918 ], [ 70.0, 0.003629604373123334 ], [ 71.0, 0.003299640339203031 ], [ 72.0, 0.0016498201696015155 ], [ 73.0, 0.0009898921017609094 ], [ 74.0, 0.003299640339203031 ], [ 75.0, 0.002969676305282728 ], [ 76.0, 0.00032996403392030306 ], [ 77.0, 0.0009898921017609094 ], [ 78.0, 0.0013198561356812123 ], [ 79.0, 0.0006599280678406061 ], [ 80.0, 0.0026397122713624245 ], [ 81.0, 0.001979784203521819 ], [ 82.0, 0.00032996403392030306 ], [ 83.0, 0.0009898921017609094 ], [ 84.0, 0.001759808180908283 ], [ 85.0, 0.0016498201696015155 ], [ 86.0, 0.0006599280678406061 ], [ 87.0, 0.0009898921017609094 ], [ 88.0, 0.00142984414698798 ], [ 89.0, 0.001759808180908283 ], [ 90.0, 0.0016498201696015155 ], [ 91.0, 0.0026397122713624245 ], [ 92.0, 0.001979784203521819 ], [ 93.0, 0.003189652327896263 ], [ 94.0, 0.00428953244096394 ], [ 95.0, 0.0023097482374421214 ], [ 96.0, 0.001979784203521819 ], [ 97.0, 0.004619496474884243 ], [ 98.0, 0.007259208746246668 ], [ 99.0, 0.009348980961075254 ], [ 100.0, 0.06423299860315243 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVFS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0005977143403624543 ], [ 3.0, 0.0005977143403624543 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0005977143403624543 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0005977143403624543 ], [ 13.0, 0.0005977143403624543 ], [ 14.0, 0.0005977143403624543 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0011954286807249086 ], [ 19.0, 0.0005977143403624543 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0011954286807249086 ], [ 23.0, 0.0005977143403624543 ], [ 24.0, 0.0 ], [ 25.0, 0.0011954286807249086 ], [ 26.0, 0.001793143021087363 ], [ 27.0, 0.003586286042174726 ], [ 28.0, 0.0005977143403624543 ], [ 29.0, 0.0023908573614498173 ], [ 30.0, 0.0023908573614498173 ], [ 31.0, 0.0023908573614498173 ], [ 32.0, 0.0037855241556288776 ], [ 33.0, 0.008567238878528512 ], [ 34.0, 0.005977143403624544 ], [ 35.0, 0.007770286424711907 ], [ 36.0, 0.013149715487973997 ], [ 37.0, 0.018529144551236085 ], [ 38.0, 0.02908876456430612 ], [ 39.0, 0.027494859656672904 ], [ 40.0, 0.03566362230829312 ], [ 41.0, 0.05479048119989163 ], [ 42.0, 0.06774095857441145 ], [ 43.0, 0.06475238687259922 ], [ 44.0, 0.09045410350818478 ], [ 45.0, 0.12253143977430324 ], [ 46.0, 0.09563429445799272 ], [ 47.0, 0.10220915220197971 ], [ 48.0, 0.14743620395607213 ], [ 49.0, 0.19744497043306408 ], [ 50.0, 0.3452796506160444 ], [ 51.0, 1.2601810675975056 ], [ 52.0, 19.7688040931477 ], [ 53.0, 61.53389438786082 ], [ 54.0, 13.387008081097887 ], [ 55.0, 1.5921117646121248 ], [ 56.0, 0.4166068952326307 ], [ 57.0, 0.1470377277291638 ], [ 58.0, 0.08148838840274793 ], [ 59.0, 0.07172572084349453 ], [ 60.0, 0.053794290632620895 ], [ 61.0, 0.02928800267776027 ], [ 62.0, 0.015739810962877965 ], [ 63.0, 0.011356572466886634 ], [ 64.0, 0.007969524538166059 ], [ 65.0, 0.006176381517078695 ], [ 66.0, 0.007969524538166057 ], [ 67.0, 0.0037855241556288776 ], [ 68.0, 0.0019923811345415143 ], [ 69.0, 0.0031878098152664236 ], [ 70.0, 0.0011954286807249086 ], [ 71.0, 0.0037855241556288776 ], [ 72.0, 0.0037855241556288776 ], [ 73.0, 0.0023908573614498173 ], [ 74.0, 0.00557866717671624 ], [ 75.0, 0.0031878098152664236 ], [ 76.0, 0.0011954286807249086 ], [ 77.0, 0.0023908573614498173 ], [ 78.0, 0.0 ], [ 79.0, 0.0019923811345415143 ], [ 80.0, 0.00139466679417906 ], [ 81.0, 0.0023908573614498173 ], [ 82.0, 0.0023908573614498173 ], [ 83.0, 0.0011954286807249086 ], [ 84.0, 0.0005977143403624543 ], [ 85.0, 0.001793143021087363 ], [ 86.0, 0.0 ], [ 87.0, 0.0005977143403624543 ], [ 88.0, 0.0011954286807249086 ], [ 89.0, 0.001793143021087363 ], [ 90.0, 0.0005977143403624543 ], [ 91.0, 0.0005977143403624543 ], [ 92.0, 0.001793143021087363 ], [ 93.0, 0.002988571701812272 ], [ 94.0, 0.0011954286807249086 ], [ 95.0, 0.0011954286807249086 ], [ 96.0, 0.004184000382537181 ], [ 97.0, 0.00537942906326209 ], [ 98.0, 0.005977143403624544 ], [ 99.0, 0.010360381899615875 ], [ 100.0, 0.06694400612059481 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVMS1_R2", "pairs": [ [ 0.0, 0.0009583225522046198 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0004791612761023099 ], [ 10.0, 0.0 ], [ 11.0, 0.0004791612761023099 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0004791612761023099 ], [ 20.0, 0.0009583225522046198 ], [ 21.0, 0.0004791612761023099 ], [ 22.0, 0.0011180429775720562 ], [ 23.0, 0.002076365529776676 ], [ 24.0, 0.0019166451044092395 ], [ 25.0, 0.0014374838283069296 ], [ 26.0, 0.0009583225522046198 ], [ 27.0, 0.0014374838283069296 ], [ 28.0, 0.0019166451044092395 ], [ 29.0, 0.0043124514849207886 ], [ 30.0, 0.003833290208818479 ], [ 31.0, 0.0047916127610230985 ], [ 32.0, 0.006229096589330028 ], [ 33.0, 0.010541548074250817 ], [ 34.0, 0.011180429775720565 ], [ 35.0, 0.019645612320194704 ], [ 36.0, 0.024437225081217803 ], [ 37.0, 0.030346880819812957 ], [ 38.0, 0.03753429996134761 ], [ 39.0, 0.04935361143853791 ], [ 40.0, 0.048874450162435606 ], [ 41.0, 0.05127025654294715 ], [ 42.0, 0.07570748162416495 ], [ 43.0, 0.09183924458627607 ], [ 44.0, 0.14981775899465552 ], [ 45.0, 0.27104556184853995 ], [ 46.0, 0.7109156133104598 ], [ 47.0, 8.466779748727815 ], [ 48.0, 11.07373653157511 ], [ 49.0, 1.8182573223828997 ], [ 50.0, 0.9856347449424482 ], [ 51.0, 3.7695617590968546 ], [ 52.0, 24.850421821643405 ], [ 53.0, 30.685647842017406 ], [ 54.0, 10.839746108411811 ], [ 55.0, 3.5219950997773406 ], [ 56.0, 1.370880410928709 ], [ 57.0, 0.5059943075640392 ], [ 58.0, 0.12729717901784698 ], [ 59.0, 0.06292984759477002 ], [ 60.0, 0.051429976968314584 ], [ 61.0, 0.03162464422275245 ], [ 62.0, 0.014055397432334422 ], [ 63.0, 0.01804840806652034 ], [ 64.0, 0.013256795305497239 ], [ 65.0, 0.007347139566902085 ], [ 66.0, 0.0043124514849207886 ], [ 67.0, 0.0014374838283069296 ], [ 68.0, 0.0047916127610230985 ], [ 69.0, 0.005749935313227718 ], [ 70.0, 0.002874967656613859 ], [ 71.0, 0.0011180429775720562 ], [ 72.0, 0.002874967656613859 ], [ 73.0, 0.0019166451044092395 ], [ 74.0, 0.0025555268058789857 ], [ 75.0, 0.002874967656613859 ], [ 76.0, 0.003833290208818479 ], [ 77.0, 0.0019166451044092395 ], [ 78.0, 0.0023958063805115492 ], [ 79.0, 0.0023958063805115492 ], [ 80.0, 0.0023958063805115492 ], [ 81.0, 0.0023958063805115492 ], [ 82.0, 0.0014374838283069296 ], [ 83.0, 0.0030346880819812957 ], [ 84.0, 0.0019166451044092395 ], [ 85.0, 0.0019166451044092395 ], [ 86.0, 0.0030346880819812957 ], [ 87.0, 0.0025555268058789857 ], [ 88.0, 0.0023958063805115492 ], [ 89.0, 0.0009583225522046198 ], [ 90.0, 0.0004791612761023099 ], [ 91.0, 0.0023958063805115492 ], [ 92.0, 0.0019166451044092395 ], [ 93.0, 0.0019166451044092395 ], [ 94.0, 0.0009583225522046198 ], [ 95.0, 0.0030346880819812957 ], [ 96.0, 0.003833290208818479 ], [ 97.0, 0.005909655738595155 ], [ 98.0, 0.010062386798148505 ], [ 99.0, 0.012777634029394929 ], [ 100.0, 0.06261040674403508 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVMS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0013890689533828458 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0013890689533828458 ], [ 25.0, 0.000926045968921897 ], [ 26.0, 0.003009649398996166 ], [ 27.0, 0.0034726723834571146 ], [ 28.0, 0.0006945344766914229 ], [ 29.0, 0.002083603430074269 ], [ 30.0, 0.003704183875687588 ], [ 31.0, 0.004398718352379012 ], [ 32.0, 0.004167206860148538 ], [ 33.0, 0.00486174133683996 ], [ 34.0, 0.008334413720297076 ], [ 35.0, 0.01342766654936751 ], [ 36.0, 0.017594873409516047 ], [ 37.0, 0.022919637730816955 ], [ 38.0, 0.03264312040449688 ], [ 39.0, 0.02569777563758265 ], [ 40.0, 0.033337654881188304 ], [ 41.0, 0.04838590187616912 ], [ 42.0, 0.06135054544107568 ], [ 43.0, 0.06644379827014611 ], [ 44.0, 0.0747782119904432 ], [ 45.0, 0.12108051043653813 ], [ 46.0, 0.20558220510066114 ], [ 47.0, 2.373455818346823 ], [ 48.0, 3.208980793806604 ], [ 49.0, 0.6241549830533588 ], [ 50.0, 0.5209008575185675 ], [ 51.0, 1.6717444853962558 ], [ 52.0, 19.73890133906241 ], [ 53.0, 55.557201859500324 ], [ 54.0, 12.432398644268702 ], [ 55.0, 2.0085937065915958 ], [ 56.0, 0.6331839312503472 ], [ 57.0, 0.19030244661344986 ], [ 58.0, 0.04491322949271202 ], [ 59.0, 0.02407719519196933 ], [ 60.0, 0.015279758487211303 ], [ 61.0, 0.007639879243605652 ], [ 62.0, 0.009028948196988499 ], [ 63.0, 0.009954994165910395 ], [ 64.0, 0.0081029022280666 ], [ 65.0, 0.003704183875687588 ], [ 66.0, 0.003704183875687588 ], [ 67.0, 0.002083603430074269 ], [ 68.0, 0.0034726723834571146 ], [ 69.0, 0.0034726723834571146 ], [ 70.0, 0.0027781379067656916 ], [ 71.0, 0.0013890689533828458 ], [ 72.0, 0.002083603430074269 ], [ 73.0, 0.0006945344766914229 ], [ 74.0, 0.0006945344766914229 ], [ 75.0, 0.00486174133683996 ], [ 76.0, 0.004398718352379012 ], [ 77.0, 0.003704183875687588 ], [ 78.0, 0.0027781379067656916 ], [ 79.0, 0.0013890689533828458 ], [ 80.0, 0.005556275813531383 ], [ 81.0, 0.0013890689533828458 ], [ 82.0, 0.0006945344766914229 ], [ 83.0, 0.002083603430074269 ], [ 84.0, 0.000926045968921897 ], [ 85.0, 0.0006945344766914229 ], [ 86.0, 0.003704183875687588 ], [ 87.0, 0.005787787305761857 ], [ 88.0, 0.000926045968921897 ], [ 89.0, 0.0034726723834571146 ], [ 90.0, 0.002083603430074269 ], [ 91.0, 0.002083603430074269 ], [ 92.0, 0.003009649398996166 ], [ 93.0, 0.0027781379067656916 ], [ 94.0, 0.0034726723834571146 ], [ 95.0, 0.0034726723834571146 ], [ 96.0, 0.002083603430074269 ], [ 97.0, 0.004167206860148538 ], [ 98.0, 0.008797436704758025 ], [ 99.0, 0.011112551627062766 ], [ 100.0, 0.05000648232178246 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAFS1_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0007721858651377382 ], [ 45.0, 0.013899345572479285 ], [ 46.0, 0.07567421478349834 ], [ 47.0, 2.1804598366826884 ], [ 48.0, 2.2366363583714586 ], [ 49.0, 0.19671434914383884 ], [ 50.0, 0.18590374703191054 ], [ 51.0, 1.6038300418910811 ], [ 52.0, 17.820505395648716 ], [ 53.0, 8.47917993861122 ], [ 54.0, 1.5395455686183657 ], [ 55.0, 5.511476612420606 ], [ 56.0, 43.84316905079055 ], [ 57.0, 15.377116271886612 ], [ 58.0, 0.44613038358332835 ], [ 59.0, 0.11042257871469657 ], [ 60.0, 0.05173645296422846 ], [ 61.0, 0.03359008513349162 ], [ 62.0, 0.019690739561012326 ], [ 63.0, 0.019690739561012326 ], [ 64.0, 0.015057624370185896 ], [ 65.0, 0.01100364857821277 ], [ 66.0, 0.01679504256674581 ], [ 67.0, 0.013320206173625984 ], [ 68.0, 0.008107951583946253 ], [ 69.0, 0.014478484971332592 ], [ 70.0, 0.012354973842203812 ], [ 71.0, 0.007528812185092948 ], [ 72.0, 0.009266230381652859 ], [ 73.0, 0.008687090982799555 ], [ 74.0, 0.008107951583946253 ], [ 75.0, 0.0046331151908264295 ], [ 76.0, 0.007142719252524079 ], [ 77.0, 0.007721858651377383 ], [ 78.0, 0.004053975791973126 ], [ 79.0, 0.005598347522248602 ], [ 80.0, 0.003474836393119822 ], [ 81.0, 0.0021235111291287804 ], [ 82.0, 0.0015443717302754765 ], [ 83.0, 0.005212254589679733 ], [ 84.0, 0.004826161657110863 ], [ 85.0, 0.0023165575954132147 ], [ 86.0, 0.001351325263991042 ], [ 87.0, 0.002509604061697649 ], [ 88.0, 0.001737418196559911 ], [ 89.0, 0.0028956969942665186 ], [ 90.0, 0.005212254589679733 ], [ 91.0, 0.0028956969942665186 ], [ 92.0, 0.0028956969942665186 ], [ 93.0, 0.002509604061697649 ], [ 94.0, 0.003860929325688691 ], [ 95.0, 0.003088743460550953 ], [ 96.0, 0.0011582787977066074 ], [ 97.0, 0.0023165575954132147 ], [ 98.0, 0.004053975791973126 ], [ 99.0, 0.013899345572479288 ], [ 100.0, 0.030115248740371803 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAFS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0018237802709529542 ], [ 43.0, 0.009726828111749089 ], [ 44.0, 0.012462498518178522 ], [ 45.0, 0.018541766088021702 ], [ 46.0, 0.10912285287868508 ], [ 47.0, 3.2764212567669824 ], [ 48.0, 3.3153285692139787 ], [ 49.0, 0.24864204360658607 ], [ 50.0, 0.16110059060084428 ], [ 51.0, 0.8951721496594085 ], [ 52.0, 8.541674899008163 ], [ 53.0, 3.8776608194244737 ], [ 54.0, 1.4438260478377554 ], [ 55.0, 8.455045336137893 ], [ 56.0, 50.90079547216158 ], [ 57.0, 17.80252715152877 ], [ 58.0, 0.4775264676111817 ], [ 59.0, 0.12249724153234008 ], [ 60.0, 0.04954603069422192 ], [ 61.0, 0.029484447713739422 ], [ 62.0, 0.024013106900880564 ], [ 63.0, 0.02462103365786488 ], [ 64.0, 0.020973473115958974 ], [ 65.0, 0.014590242167623634 ], [ 66.0, 0.011854571761194203 ], [ 67.0, 0.012766461896670678 ], [ 68.0, 0.012766461896670678 ], [ 69.0, 0.009118901354764772 ], [ 70.0, 0.008207011219288294 ], [ 71.0, 0.0036475605419059084 ], [ 72.0, 0.004559450677382386 ], [ 73.0, 0.004559450677382386 ], [ 74.0, 0.0027356704064294313 ], [ 75.0, 0.0018237802709529542 ], [ 76.0, 0.0048634140558745445 ], [ 77.0, 0.006687194326827499 ], [ 78.0, 0.004559450677382386 ], [ 79.0, 0.006383230948335339 ], [ 80.0, 0.004559450677382386 ], [ 81.0, 0.0009118901354764771 ], [ 82.0, 0.003951523920398067 ], [ 83.0, 0.0018237802709529542 ], [ 84.0, 0.0009118901354764771 ], [ 85.0, 0.0009118901354764771 ], [ 86.0, 0.0018237802709529542 ], [ 87.0, 0.0012158535139686361 ], [ 88.0, 0.0018237802709529542 ], [ 89.0, 0.0009118901354764771 ], [ 90.0, 0.0018237802709529542 ], [ 91.0, 0.0018237802709529542 ], [ 92.0, 0.0018237802709529542 ], [ 93.0, 0.0018237802709529542 ], [ 94.0, 0.0018237802709529542 ], [ 95.0, 0.0018237802709529542 ], [ 96.0, 0.0027356704064294313 ], [ 97.0, 0.0018237802709529542 ], [ 98.0, 0.0018237802709529542 ], [ 99.0, 0.01550213230310011 ], [ 100.0, 0.02066950973746681 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAMS1_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0015713116209493574 ], [ 44.0, 0.0009427869725696145 ], [ 45.0, 0.0 ], [ 46.0, 0.0009427869725696145 ], [ 47.0, 0.00628524648379743 ], [ 48.0, 0.016655903182063187 ], [ 49.0, 0.035511642633455485 ], [ 50.0, 0.16027378533683442 ], [ 51.0, 5.087278503985643 ], [ 52.0, 66.99224243452728 ], [ 53.0, 24.736687455119455 ], [ 54.0, 0.963371154804051 ], [ 55.0, 0.411055120040352 ], [ 56.0, 0.9094751662054881 ], [ 57.0, 0.32541863669861193 ], [ 58.0, 0.04541090584543643 ], [ 59.0, 0.029069264987563112 ], [ 60.0, 0.021212706882816325 ], [ 61.0, 0.009899263211980952 ], [ 62.0, 0.018855739451392288 ], [ 63.0, 0.016655903182063187 ], [ 64.0, 0.010527787860360694 ], [ 65.0, 0.011470574832930309 ], [ 66.0, 0.013670411102259408 ], [ 67.0, 0.010684919022455629 ], [ 68.0, 0.007228033456367043 ], [ 69.0, 0.005656721835417686 ], [ 70.0, 0.006128115321702494 ], [ 71.0, 0.008013689266841723 ], [ 72.0, 0.006599508807987301 ], [ 73.0, 0.008170820428936661 ], [ 74.0, 0.00549959067332275 ], [ 75.0, 0.003928279052373394 ], [ 76.0, 0.0029854920798037788 ], [ 77.0, 0.003771147890278458 ], [ 78.0, 0.004085410214468329 ], [ 79.0, 0.004085410214468329 ], [ 80.0, 0.001885573945139229 ], [ 81.0, 0.001885573945139229 ], [ 82.0, 0.005185328349132879 ], [ 83.0, 0.004242541376563265 ], [ 84.0, 0.0032997544039936504 ], [ 85.0, 0.0014141804588544216 ], [ 86.0, 0.002356967431424036 ], [ 87.0, 0.002356967431424036 ], [ 88.0, 0.002828360917708843 ], [ 89.0, 0.002356967431424036 ], [ 90.0, 0.0014141804588544216 ], [ 91.0, 0.002356967431424036 ], [ 92.0, 0.0032997544039936504 ], [ 93.0, 0.002356967431424036 ], [ 94.0, 0.001885573945139229 ], [ 95.0, 0.001885573945139229 ], [ 96.0, 0.002356967431424036 ], [ 97.0, 0.0009427869725696145 ], [ 98.0, 0.003771147890278458 ], [ 99.0, 0.01948426409977203 ], [ 100.0, 0.031111970094797294 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAMS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.004871886777351308 ], [ 31.0, 0.004175902952015407 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0006959838253359011 ], [ 41.0, 0.0 ], [ 42.0, 0.0038279110393474565 ], [ 43.0, 0.005045882733685283 ], [ 44.0, 0.008351805904030814 ], [ 45.0, 0.01809557945873343 ], [ 46.0, 0.025577405581094365 ], [ 47.0, 0.03427720339779313 ], [ 48.0, 0.047152904166507296 ], [ 49.0, 0.10387558593138324 ], [ 50.0, 0.2681277687106557 ], [ 51.0, 5.205263029687197 ], [ 52.0, 65.5695061646766 ], [ 53.0, 23.960809150795413 ], [ 54.0, 1.2028340461367713 ], [ 55.0, 0.7170373360523121 ], [ 56.0, 1.2503349422159467 ], [ 57.0, 0.6095078350379155 ], [ 58.0, 0.281525457348372 ], [ 59.0, 0.18391372584501187 ], [ 60.0, 0.12179716943378273 ], [ 61.0, 0.0683804108392523 ], [ 62.0, 0.048892863729847066 ], [ 63.0, 0.03131927214011555 ], [ 64.0, 0.017573591589731506 ], [ 65.0, 0.0147896562883879 ], [ 66.0, 0.013049696725048148 ], [ 67.0, 0.013049696725048144 ], [ 68.0, 0.00817780994769684 ], [ 69.0, 0.005741866559021184 ], [ 70.0, 0.009047789729366715 ], [ 71.0, 0.006785842297025037 ], [ 72.0, 0.004871886777351308 ], [ 73.0, 0.005393874646353234 ], [ 74.0, 0.004697890821017333 ], [ 75.0, 0.006263854428023111 ], [ 76.0, 0.006263854428023111 ], [ 77.0, 0.0022619474323416788 ], [ 78.0, 0.003653915083013481 ], [ 79.0, 0.005393874646353234 ], [ 80.0, 0.004871886777351308 ], [ 81.0, 0.0017399595633397528 ], [ 82.0, 0.0020879514760077035 ], [ 83.0, 0.0026099393450096293 ], [ 84.0, 0.0020879514760077035 ], [ 85.0, 0.0010439757380038518 ], [ 86.0, 0.0020879514760077035 ], [ 87.0, 0.0015659636070057778 ], [ 88.0, 0.0031319272140115555 ], [ 89.0, 0.0020879514760077035 ], [ 90.0, 0.0026099393450096293 ], [ 91.0, 0.0020879514760077035 ], [ 92.0, 0.0020879514760077035 ], [ 93.0, 0.0026099393450096293 ], [ 94.0, 0.0031319272140115555 ], [ 95.0, 0.0020879514760077035 ], [ 96.0, 0.0020879514760077035 ], [ 97.0, 0.0020879514760077035 ], [ 98.0, 0.003653915083013481 ], [ 99.0, 0.022097486454414863 ], [ 100.0, 0.02992730448944377 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCFS1_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0004058771004139939 ], [ 2.0, 0.0004058771004139939 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0004058771004139939 ], [ 6.0, 0.0004058771004139939 ], [ 7.0, 0.0004058771004139939 ], [ 8.0, 0.0 ], [ 9.0, 0.0004058771004139939 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0004058771004139939 ], [ 16.0, 0.0004058771004139939 ], [ 17.0, 0.0008117542008279878 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.001217631301241982 ], [ 21.0, 0.0016235084016559757 ], [ 22.0, 0.0004058771004139939 ], [ 23.0, 0.0 ], [ 24.0, 0.0004058771004139939 ], [ 25.0, 0.0013529236680466464 ], [ 26.0, 0.0021646778688746344 ], [ 27.0, 0.0020293855020699697 ], [ 28.0, 0.0008117542008279878 ], [ 29.0, 0.002435262602483964 ], [ 30.0, 0.002435262602483964 ], [ 31.0, 0.0028411397028979576 ], [ 32.0, 0.004058771004139939 ], [ 33.0, 0.008523419108693872 ], [ 34.0, 0.008929296209107866 ], [ 35.0, 0.006088156506209909 ], [ 36.0, 0.01542332981573177 ], [ 37.0, 0.023540871824011645 ], [ 38.0, 0.026382011526909603 ], [ 39.0, 0.027870227561760916 ], [ 40.0, 0.031658413832291524 ], [ 41.0, 0.03855832453932942 ], [ 42.0, 0.04031712530779006 ], [ 43.0, 0.059122764293638455 ], [ 44.0, 0.06209919636334107 ], [ 45.0, 0.07035203073842562 ], [ 46.0, 0.07197553914008158 ], [ 47.0, 0.08266363611765008 ], [ 48.0, 0.11851611332088623 ], [ 49.0, 0.1844034959547579 ], [ 50.0, 0.33687799334361507 ], [ 51.0, 1.2354898936602032 ], [ 52.0, 19.464242227453674 ], [ 53.0, 61.674378331574374 ], [ 54.0, 13.688746380929157 ], [ 55.0, 1.885569716156611 ], [ 56.0, 0.431717942473685 ], [ 57.0, 0.10525746137402911 ], [ 58.0, 0.03882890927293875 ], [ 59.0, 0.02935844359661223 ], [ 60.0, 0.017993884785020394 ], [ 61.0, 0.006494033606623903 ], [ 62.0, 0.0032470168033119514 ], [ 63.0, 0.005276402305381921 ], [ 64.0, 0.005952864139405245 ], [ 65.0, 0.007035203073842562 ], [ 66.0, 0.0029764320697026224 ], [ 67.0, 0.0020293855020699697 ], [ 68.0, 0.0016235084016559757 ], [ 69.0, 0.004058771004139939 ], [ 70.0, 0.004058771004139939 ], [ 71.0, 0.0028411397028979576 ], [ 72.0, 0.0017588007684606402 ], [ 73.0, 0.0028411397028979576 ], [ 74.0, 0.004058771004139939 ], [ 75.0, 0.001217631301241982 ], [ 76.0, 0.001217631301241982 ], [ 77.0, 0.0028411397028979576 ], [ 78.0, 0.0033823091701166157 ], [ 79.0, 0.0021646778688746344 ], [ 80.0, 0.002435262602483964 ], [ 81.0, 0.0008117542008279878 ], [ 82.0, 0.0010823389344373172 ], [ 83.0, 0.0013529236680466464 ], [ 84.0, 0.002435262602483964 ], [ 85.0, 0.002570554969288628 ], [ 86.0, 0.0029764320697026224 ], [ 87.0, 0.0008117542008279878 ], [ 88.0, 0.0016235084016559757 ], [ 89.0, 0.0017588007684606402 ], [ 90.0, 0.0004058771004139939 ], [ 91.0, 0.0008117542008279878 ], [ 92.0, 0.0020293855020699697 ], [ 93.0, 0.002435262602483964 ], [ 94.0, 0.0028411397028979576 ], [ 95.0, 0.0032470168033119514 ], [ 96.0, 0.004464648104553933 ], [ 97.0, 0.007711664907865885 ], [ 98.0, 0.0074410801742565555 ], [ 99.0, 0.01190572827881049 ], [ 100.0, 0.06304624293097373 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCFS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0005001700578196595 ], [ 8.0, 0.0005001700578196595 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.001000340115639319 ], [ 22.0, 0.002000680231278638 ], [ 23.0, 0.0005001700578196595 ], [ 24.0, 0.001000340115639319 ], [ 25.0, 0.001000340115639319 ], [ 26.0, 0.0025008502890982976 ], [ 27.0, 0.0035011904047376166 ], [ 28.0, 0.004001360462557276 ], [ 29.0, 0.0035011904047376166 ], [ 30.0, 0.003001020346917957 ], [ 31.0, 0.002000680231278638 ], [ 32.0, 0.006502210751655573 ], [ 33.0, 0.01117046462463906 ], [ 34.0, 0.01217080474027838 ], [ 35.0, 0.01000340115639319 ], [ 36.0, 0.0185062921393274 ], [ 37.0, 0.026175566359228845 ], [ 38.0, 0.027842799885294374 ], [ 39.0, 0.03851309445211378 ], [ 40.0, 0.03801292439429412 ], [ 41.0, 0.050517175839785614 ], [ 42.0, 0.05918679017532637 ], [ 43.0, 0.06435521410612953 ], [ 44.0, 0.0680231278634737 ], [ 45.0, 0.06402176740091642 ], [ 46.0, 0.08569580323976833 ], [ 47.0, 0.0918645672862108 ], [ 48.0, 0.11253826300942338 ], [ 49.0, 0.18056139087289708 ], [ 50.0, 0.33077913157140143 ], [ 51.0, 1.2449232739131355 ], [ 52.0, 19.508966381903214 ], [ 53.0, 61.93522464304523 ], [ 54.0, 13.743172678710778 ], [ 55.0, 1.5248517829395356 ], [ 56.0, 0.3311125782766146 ], [ 57.0, 0.08819665352886662 ], [ 58.0, 0.038513094452113775 ], [ 59.0, 0.033844840579130286 ], [ 60.0, 0.02584211965401574 ], [ 61.0, 0.020506972370606037 ], [ 62.0, 0.01000340115639319 ], [ 63.0, 0.007002380809475233 ], [ 64.0, 0.005001700578196595 ], [ 65.0, 0.0015005101734589786 ], [ 66.0, 0.002000680231278638 ], [ 67.0, 0.004668253872983489 ], [ 68.0, 0.005668593988622808 ], [ 69.0, 0.0026675736417048506 ], [ 70.0, 0.003001020346917957 ], [ 71.0, 0.0036679137573441692 ], [ 72.0, 0.004501530520376936 ], [ 73.0, 0.0035011904047376166 ], [ 74.0, 0.0005001700578196595 ], [ 75.0, 0.0015005101734589786 ], [ 76.0, 0.003001020346917957 ], [ 77.0, 0.0015005101734589786 ], [ 78.0, 0.004501530520376936 ], [ 79.0, 0.0025008502890982976 ], [ 80.0, 0.0 ], [ 81.0, 0.001000340115639319 ], [ 82.0, 0.0025008502890982976 ], [ 83.0, 0.001000340115639319 ], [ 84.0, 0.0015005101734589786 ], [ 85.0, 0.002000680231278638 ], [ 86.0, 0.001000340115639319 ], [ 87.0, 0.0021674035838851907 ], [ 88.0, 0.001000340115639319 ], [ 89.0, 0.001000340115639319 ], [ 90.0, 0.004001360462557276 ], [ 91.0, 0.005501870636016254 ], [ 92.0, 0.002000680231278638 ], [ 93.0, 0.0015005101734589786 ], [ 94.0, 0.003001020346917957 ], [ 95.0, 0.004501530520376936 ], [ 96.0, 0.004001360462557276 ], [ 97.0, 0.004668253872983487 ], [ 98.0, 0.00950323109857353 ], [ 99.0, 0.013504591561130805 ], [ 100.0, 0.05135079260281832 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCMS1_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0004724171380339892 ], [ 3.0, 0.0 ], [ 4.0, 0.0004724171380339892 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0004724171380339892 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0009448342760679783 ], [ 12.0, 0.0004724171380339892 ], [ 13.0, 0.0 ], [ 14.0, 0.0004724171380339892 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0004724171380339892 ], [ 22.0, 0.0 ], [ 23.0, 0.0011023066554126412 ], [ 24.0, 0.00157472379344663 ], [ 25.0, 0.0009448342760679783 ], [ 26.0, 0.0 ], [ 27.0, 0.0009448342760679783 ], [ 28.0, 0.002362085690169946 ], [ 29.0, 0.0037793371042719134 ], [ 30.0, 0.0037793371042719134 ], [ 31.0, 0.004409226621650565 ], [ 32.0, 0.0018896685521359567 ], [ 33.0, 0.004251754242305903 ], [ 34.0, 0.0051965885183738805 ], [ 35.0, 0.009920759898713773 ], [ 36.0, 0.01086559417478175 ], [ 37.0, 0.015117348417087654 ], [ 38.0, 0.025038108315801427 ], [ 39.0, 0.026612832109248055 ], [ 40.0, 0.034958868214515194 ], [ 41.0, 0.03700600914599581 ], [ 42.0, 0.04818654807946688 ], [ 43.0, 0.07842124491364222 ], [ 44.0, 0.07416949067133631 ], [ 45.0, 0.07212234973985567 ], [ 46.0, 0.08078333060381215 ], [ 47.0, 0.1108605550586428 ], [ 48.0, 0.2651834868164125 ], [ 49.0, 0.5313118079088932 ], [ 50.0, 0.7380730419884357 ], [ 51.0, 1.495042769498235 ], [ 52.0, 18.03263457589539 ], [ 53.0, 55.43641895211574 ], [ 54.0, 15.768496705677817 ], [ 55.0, 4.891249574824581 ], [ 56.0, 1.293635596316407 ], [ 57.0, 0.4659607704808581 ], [ 58.0, 0.09023167336449192 ], [ 59.0, 0.039840511974199744 ], [ 60.0, 0.0374784262840298 ], [ 61.0, 0.01858174076267024 ], [ 62.0, 0.00929087038133512 ], [ 63.0, 0.017636906486602263 ], [ 64.0, 0.018109323624636253 ], [ 65.0, 0.008031091346577816 ], [ 66.0, 0.003306919966237924 ], [ 67.0, 0.0025195580695146088 ], [ 68.0, 0.004881643759684554 ], [ 69.0, 0.002362085690169946 ], [ 70.0, 0.0025195580695146088 ], [ 71.0, 0.0051965885183738805 ], [ 72.0, 0.0014172514141019676 ], [ 73.0, 0.004251754242305903 ], [ 74.0, 0.00566900565640787 ], [ 75.0, 0.003306919966237924 ], [ 76.0, 0.002834502828203935 ], [ 77.0, 0.0020471409314806194 ], [ 78.0, 0.0020471409314806194 ], [ 79.0, 0.0037793371042719134 ], [ 80.0, 0.002362085690169946 ], [ 81.0, 0.0018896685521359567 ], [ 82.0, 0.002362085690169946 ], [ 83.0, 0.0011023066554126412 ], [ 84.0, 0.002834502828203935 ], [ 85.0, 0.0014172514141019676 ], [ 86.0, 0.0014172514141019676 ], [ 87.0, 0.002362085690169946 ], [ 88.0, 0.0009448342760679783 ], [ 89.0, 0.0014172514141019676 ], [ 90.0, 0.0014172514141019676 ], [ 91.0, 0.0009448342760679783 ], [ 92.0, 0.0004724171380339892 ], [ 93.0, 0.00157472379344663 ], [ 94.0, 0.002362085690169946 ], [ 95.0, 0.003306919966237924 ], [ 96.0, 0.00566900565640787 ], [ 97.0, 0.004724171380339892 ], [ 98.0, 0.008031091346577816 ], [ 99.0, 0.015747237934466304 ], [ 100.0, 0.07621663160281694 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCMS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0011959147551962501 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0005979573775981251 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0005979573775981251 ], [ 19.0, 0.0005979573775981251 ], [ 20.0, 0.0 ], [ 21.0, 0.0005979573775981251 ], [ 22.0, 0.0 ], [ 23.0, 0.0005979573775981251 ], [ 24.0, 0.0005979573775981251 ], [ 25.0, 0.0005979573775981251 ], [ 26.0, 0.0011959147551962501 ], [ 27.0, 0.0005979573775981251 ], [ 28.0, 0.0005979573775981251 ], [ 29.0, 0.002989786887990625 ], [ 30.0, 0.004185701643186875 ], [ 31.0, 0.0011959147551962501 ], [ 32.0, 0.00837140328637375 ], [ 33.0, 0.019732593460738117 ], [ 34.0, 0.011959147551962498 ], [ 35.0, 0.012557104929560624 ], [ 36.0, 0.013155062307158748 ], [ 37.0, 0.025911486362585417 ], [ 38.0, 0.03169174101270063 ], [ 39.0, 0.03468152790069125 ], [ 40.0, 0.037272676536949795 ], [ 41.0, 0.05122501534757271 ], [ 42.0, 0.05222161097690292 ], [ 43.0, 0.06099165251500875 ], [ 44.0, 0.07992696947228269 ], [ 45.0, 0.10025752031061899 ], [ 46.0, 0.08251811810854126 ], [ 47.0, 0.17141444824479585 ], [ 48.0, 0.41657697306002733 ], [ 49.0, 0.6848605164757191 ], [ 50.0, 0.8815884937055023 ], [ 51.0, 1.7831088999976117 ], [ 52.0, 18.608832229105303 ], [ 53.0, 50.8740143669226 ], [ 54.0, 15.719900818802962 ], [ 55.0, 6.817910019373824 ], [ 56.0, 2.17736213096064 ], [ 57.0, 0.7326971066835689 ], [ 58.0, 0.1773940220207771 ], [ 59.0, 0.06258620552193708 ], [ 60.0, 0.050826377095840626 ], [ 61.0, 0.021327146467666456 ], [ 62.0, 0.015347572691685208 ], [ 63.0, 0.01793872132794375 ], [ 64.0, 0.0119591475519625 ], [ 65.0, 0.0037870633914547916 ], [ 66.0, 0.0031891060138566664 ], [ 67.0, 0.002989786887990625 ], [ 68.0, 0.00358774426558875 ], [ 69.0, 0.0031891060138566664 ], [ 70.0, 0.0013952338810622915 ], [ 71.0, 0.0013952338810622915 ], [ 72.0, 0.0013952338810622915 ], [ 73.0, 0.0 ], [ 74.0, 0.0011959147551962501 ], [ 75.0, 0.0 ], [ 76.0, 0.0031891060138566664 ], [ 77.0, 0.0023918295103925002 ], [ 78.0, 0.0011959147551962501 ], [ 79.0, 0.0005979573775981251 ], [ 80.0, 0.002989786887990625 ], [ 81.0, 0.00358774426558875 ], [ 82.0, 0.0023918295103925002 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0019931912586604165 ], [ 86.0, 0.0019931912586604165 ], [ 87.0, 0.0019931912586604165 ], [ 88.0, 0.0025911486362585417 ], [ 89.0, 0.0023918295103925002 ], [ 90.0, 0.0 ], [ 91.0, 0.0005979573775981251 ], [ 92.0, 0.0011959147551962501 ], [ 93.0, 0.0011959147551962501 ], [ 94.0, 0.0005979573775981251 ], [ 95.0, 0.001793872132794375 ], [ 96.0, 0.0005979573775981251 ], [ 97.0, 0.00358774426558875 ], [ 98.0, 0.007773445908775625 ], [ 99.0, 0.00597957377598125 ], [ 100.0, 0.06298484377366911 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPFS1_R2", "pairs": [ [ 0.0, 0.0006577605883010691 ], [ 1.0, 0.00032888029415053453 ], [ 2.0, 0.00032888029415053453 ], [ 3.0, 0.0 ], [ 4.0, 0.00032888029415053453 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0006577605883010691 ], [ 9.0, 0.00032888029415053453 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.00032888029415053453 ], [ 13.0, 0.0 ], [ 14.0, 0.00032888029415053453 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.00032888029415053453 ], [ 18.0, 0.00032888029415053453 ], [ 19.0, 0.00032888029415053453 ], [ 20.0, 0.0009866408824516035 ], [ 21.0, 0.0006577605883010691 ], [ 22.0, 0.00032888029415053453 ], [ 23.0, 0.0 ], [ 24.0, 0.00032888029415053453 ], [ 25.0, 0.0009866408824516035 ], [ 26.0, 0.0007673873530179137 ], [ 27.0, 0.001425147941318983 ], [ 28.0, 0.0029599226473548106 ], [ 29.0, 0.0036176832356558802 ], [ 30.0, 0.003288802941505345 ], [ 31.0, 0.003288802941505345 ], [ 32.0, 0.004056190294523259 ], [ 33.0, 0.00657760588301069 ], [ 34.0, 0.008441260883197053 ], [ 35.0, 0.012716704707153999 ], [ 36.0, 0.014470732942623521 ], [ 37.0, 0.017101775295827796 ], [ 38.0, 0.021706099413935278 ], [ 39.0, 0.029599226473548106 ], [ 40.0, 0.0339842970622219 ], [ 41.0, 0.042535184710135794 ], [ 42.0, 0.04231593118070211 ], [ 43.0, 0.06270650941803525 ], [ 44.0, 0.07038038294821441 ], [ 45.0, 0.07717724236065877 ], [ 46.0, 0.07344993236028605 ], [ 47.0, 0.09701968677440768 ], [ 48.0, 0.1317713711896475 ], [ 49.0, 0.15873955530999134 ], [ 50.0, 0.30191211003019075 ], [ 51.0, 1.1881348760011679 ], [ 52.0, 19.769981122271226 ], [ 53.0, 62.813285886869565 ], [ 54.0, 12.437046830361332 ], [ 55.0, 0.9901489389225427 ], [ 56.0, 0.90442080891397 ], [ 57.0, 0.43171019945493494 ], [ 58.0, 0.04516622706334007 ], [ 59.0, 0.02674893059091014 ], [ 60.0, 0.014470732942623521 ], [ 61.0, 0.008989394706781277 ], [ 62.0, 0.006687232647727534 ], [ 63.0, 0.005700591765275932 ], [ 64.0, 0.003946563529806414 ], [ 65.0, 0.004604324118107483 ], [ 66.0, 0.0016444014707526725 ], [ 67.0, 0.002850295882637966 ], [ 68.0, 0.0036176832356558802 ], [ 69.0, 0.0010962676471684483 ], [ 70.0, 0.0029599226473548106 ], [ 71.0, 0.0016444014707526725 ], [ 72.0, 0.003288802941505345 ], [ 73.0, 0.0026310423532042763 ], [ 74.0, 0.0013155211766021381 ], [ 75.0, 0.001425147941318983 ], [ 76.0, 0.0013155211766021381 ], [ 77.0, 0.0016444014707526725 ], [ 78.0, 0.0016444014707526725 ], [ 79.0, 0.001973281764903207 ], [ 80.0, 0.0017540282354695175 ], [ 81.0, 0.0017540282354695175 ], [ 82.0, 0.0009866408824516035 ], [ 83.0, 0.0023021620590537415 ], [ 84.0, 0.0009866408824516035 ], [ 85.0, 0.0016444014707526725 ], [ 86.0, 0.0016444014707526725 ], [ 87.0, 0.00032888029415053453 ], [ 88.0, 0.0009866408824516035 ], [ 89.0, 0.0017540282354695175 ], [ 90.0, 0.0009866408824516035 ], [ 91.0, 0.0010962676471684483 ], [ 92.0, 0.0013155211766021381 ], [ 93.0, 0.0016444014707526725 ], [ 94.0, 0.0009866408824516035 ], [ 95.0, 0.002082908529620052 ], [ 96.0, 0.0037273100003727246 ], [ 97.0, 0.004385070588673793 ], [ 98.0, 0.004933204412258018 ], [ 99.0, 0.008550887647913898 ], [ 100.0, 0.04648174823994218 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPFS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0007605603808886383 ], [ 3.0, 0.00038028019044431915 ], [ 4.0, 0.00038028019044431915 ], [ 5.0, 0.0007605603808886383 ], [ 6.0, 0.00038028019044431915 ], [ 7.0, 0.0007605603808886383 ], [ 8.0, 0.00038028019044431915 ], [ 9.0, 0.0 ], [ 10.0, 0.00038028019044431915 ], [ 11.0, 0.00038028019044431915 ], [ 12.0, 0.00038028019044431915 ], [ 13.0, 0.0011408405713329572 ], [ 14.0, 0.0007605603808886383 ], [ 15.0, 0.0 ], [ 16.0, 0.00038028019044431915 ], [ 17.0, 0.0007605603808886383 ], [ 18.0, 0.0015211207617772766 ], [ 19.0, 0.0 ], [ 20.0, 0.0007605603808886383 ], [ 21.0, 0.00038028019044431915 ], [ 22.0, 0.0 ], [ 23.0, 0.0007605603808886383 ], [ 24.0, 0.0011408405713329572 ], [ 25.0, 0.0011408405713329572 ], [ 26.0, 0.0007605603808886383 ], [ 27.0, 0.0011408405713329572 ], [ 28.0, 0.0015211207617772766 ], [ 29.0, 0.0011408405713329572 ], [ 30.0, 0.003422521713998872 ], [ 31.0, 0.003422521713998872 ], [ 32.0, 0.0030422415235545532 ], [ 33.0, 0.0041830820948875105 ], [ 34.0, 0.004943642475776148 ], [ 35.0, 0.010267565141996617 ], [ 36.0, 0.01749288876043868 ], [ 37.0, 0.022436531236214828 ], [ 38.0, 0.028140734092879618 ], [ 39.0, 0.030422415235545532 ], [ 40.0, 0.032323816187767127 ], [ 41.0, 0.03878857942532055 ], [ 42.0, 0.0456336228533183 ], [ 43.0, 0.05083078545605732 ], [ 44.0, 0.048549104313391406 ], [ 45.0, 0.06680255345471872 ], [ 46.0, 0.0670560735816816 ], [ 47.0, 0.09190104602404378 ], [ 48.0, 0.12118262068825635 ], [ 49.0, 0.17099932563646217 ], [ 50.0, 0.34339301197122013 ], [ 51.0, 1.3915719768992487 ], [ 52.0, 20.774833564036747 ], [ 53.0, 61.044984611328225 ], [ 54.0, 12.0536144364501 ], [ 55.0, 1.170375666124133 ], [ 56.0, 1.3619101220445884 ], [ 57.0, 0.696546548830511 ], [ 58.0, 0.07491519751753087 ], [ 59.0, 0.02928157466421257 ], [ 60.0, 0.012676006348143969 ], [ 61.0, 0.011661925840292454 ], [ 62.0, 0.005957722983627666 ], [ 63.0, 0.004690122348813269 ], [ 64.0, 0.006211243110590547 ], [ 65.0, 0.0038028019044431915 ], [ 66.0, 0.0019014009522215958 ], [ 67.0, 0.0015211207617772766 ], [ 68.0, 0.0022816811426659145 ], [ 69.0, 0.0022816811426659145 ], [ 70.0, 0.002661961333110234 ], [ 71.0, 0.0007605603808886383 ], [ 72.0, 0.0035492817774803115 ], [ 73.0, 0.005450682729701907 ], [ 74.0, 0.0038028019044431915 ], [ 75.0, 0.0019014009522215958 ], [ 76.0, 0.0022816811426659145 ], [ 77.0, 0.0041830820948875105 ], [ 78.0, 0.0011408405713329572 ], [ 79.0, 0.002661961333110234 ], [ 80.0, 0.0015211207617772766 ], [ 81.0, 0.0020281610157030353 ], [ 82.0, 0.0007605603808886383 ], [ 83.0, 0.00038028019044431915 ], [ 84.0, 0.0022816811426659145 ], [ 85.0, 0.0030422415235545532 ], [ 86.0, 0.002915481460073113 ], [ 87.0, 0.003295761650517432 ], [ 88.0, 0.0022816811426659145 ], [ 89.0, 0.0007605603808886383 ], [ 90.0, 0.0 ], [ 91.0, 0.0007605603808886383 ], [ 92.0, 0.0024084412061473543 ], [ 93.0, 0.0035492817774803115 ], [ 94.0, 0.0038028019044431915 ], [ 95.0, 0.0038028019044431915 ], [ 96.0, 0.003422521713998872 ], [ 97.0, 0.004563362285331829 ], [ 98.0, 0.004943642475776148 ], [ 99.0, 0.004943642475776148 ], [ 100.0, 0.045633622853318234 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPMS1_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0003596087456846958 ], [ 4.0, 0.0003596087456846958 ], [ 5.0, 0.0 ], [ 6.0, 0.0003596087456846958 ], [ 7.0, 0.0003596087456846958 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0007192174913693916 ], [ 14.0, 0.0003596087456846958 ], [ 15.0, 0.00083908707326429 ], [ 16.0, 0.0003596087456846958 ], [ 17.0, 0.0 ], [ 18.0, 0.0004794783275795944 ], [ 19.0, 0.0003596087456846958 ], [ 20.0, 0.0007192174913693916 ], [ 21.0, 0.0007192174913693916 ], [ 22.0, 0.0003596087456846958 ], [ 23.0, 0.0010788262370540875 ], [ 24.0, 0.0007192174913693916 ], [ 25.0, 0.0003596087456846958 ], [ 26.0, 0.0007192174913693916 ], [ 27.0, 0.0014384349827387833 ], [ 28.0, 0.001798043728423479 ], [ 29.0, 0.003236478711162262 ], [ 30.0, 0.0028768699654775666 ], [ 31.0, 0.003596087456846958 ], [ 32.0, 0.0050345224395857415 ], [ 33.0, 0.00431530494821635 ], [ 34.0, 0.005753739930955133 ], [ 35.0, 0.014024741081703136 ], [ 36.0, 0.022295742232451142 ], [ 37.0, 0.024453394706559318 ], [ 38.0, 0.027330264672036884 ], [ 39.0, 0.03703970080552366 ], [ 40.0, 0.039556962025316535 ], [ 41.0, 0.04471135404679718 ], [ 42.0, 0.04087552742616043 ], [ 43.0, 0.049506137322593124 ], [ 44.0, 0.06173283467587278 ], [ 45.0, 0.07407940161104733 ], [ 46.0, 0.08390870732642902 ], [ 47.0, 0.15367280398926 ], [ 48.0, 0.46293632527809836 ], [ 49.0, 1.5280974299961676 ], [ 50.0, 2.02711449942463 ], [ 51.0, 3.6512274645186222 ], [ 52.0, 33.415084388185605 ], [ 53.0, 40.27306290755662 ], [ 54.0, 11.15098772535483 ], [ 55.0, 4.459987533563495 ], [ 56.0, 1.4414317222861561 ], [ 57.0, 0.5889192558496368 ], [ 58.0, 0.07539796701189123 ], [ 59.0, 0.029607786728039952 ], [ 60.0, 0.018100306866129685 ], [ 61.0, 0.010788262370540874 ], [ 62.0, 0.006472957422324524 ], [ 63.0, 0.00431530494821635 ], [ 64.0, 0.008750479478327598 ], [ 65.0, 0.003715957038741856 ], [ 66.0, 0.003715957038741856 ], [ 67.0, 0.0025172612197928708 ], [ 68.0, 0.00335634829305716 ], [ 69.0, 0.0028768699654775666 ], [ 70.0, 0.0029967395473724646 ], [ 71.0, 0.00335634829305716 ], [ 72.0, 0.00431530494821635 ], [ 73.0, 0.0025172612197928708 ], [ 74.0, 0.002157652474108175 ], [ 75.0, 0.001198695818948986 ], [ 76.0, 0.0 ], [ 77.0, 0.0003596087456846958 ], [ 78.0, 0.0010788262370540875 ], [ 79.0, 0.003236478711162262 ], [ 80.0, 0.001798043728423479 ], [ 81.0, 0.0014384349827387833 ], [ 82.0, 0.001798043728423479 ], [ 83.0, 0.001798043728423479 ], [ 84.0, 0.001798043728423479 ], [ 85.0, 0.002157652474108175 ], [ 86.0, 0.0010788262370540875 ], [ 87.0, 0.0007192174913693916 ], [ 88.0, 0.0007192174913693916 ], [ 89.0, 0.0022775220560030734 ], [ 90.0, 0.0014384349827387833 ], [ 91.0, 0.0007192174913693916 ], [ 92.0, 0.002157652474108175 ], [ 93.0, 0.002157652474108175 ], [ 94.0, 0.0014384349827387833 ], [ 95.0, 0.003236478711162262 ], [ 96.0, 0.0050345224395857415 ], [ 97.0, 0.0028768699654775666 ], [ 98.0, 0.0061133486766398295 ], [ 99.0, 0.008271001150748004 ], [ 100.0, 0.05082470272343697 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPMS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0005666214628655174 ], [ 5.0, 0.0005666214628655174 ], [ 6.0, 0.0 ], [ 7.0, 0.0005666214628655174 ], [ 8.0, 0.0005666214628655174 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0011332429257310348 ], [ 13.0, 0.0011332429257310348 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0005666214628655174 ], [ 20.0, 0.0005666214628655174 ], [ 21.0, 0.0016998643885965524 ], [ 22.0, 0.0016998643885965524 ], [ 23.0, 0.0011332429257310348 ], [ 24.0, 0.0005666214628655174 ], [ 25.0, 0.0011332429257310348 ], [ 26.0, 0.0011332429257310348 ], [ 27.0, 0.0022664858514620696 ], [ 28.0, 0.003399728777193105 ], [ 29.0, 0.005099593165789657 ], [ 30.0, 0.0011332429257310348 ], [ 31.0, 0.0016998643885965524 ], [ 32.0, 0.003399728777193105 ], [ 33.0, 0.004532971702924139 ], [ 34.0, 0.007366079017251727 ], [ 35.0, 0.00982143868966897 ], [ 36.0, 0.019265129737427594 ], [ 37.0, 0.024931344366082766 ], [ 38.0, 0.031164180457603458 ], [ 39.0, 0.03796363801198967 ], [ 40.0, 0.04268548353586899 ], [ 41.0, 0.04551859085019658 ], [ 42.0, 0.05024043637407588 ], [ 43.0, 0.06950556611150348 ], [ 44.0, 0.07422741163538278 ], [ 45.0, 0.06969443993245865 ], [ 46.0, 0.07290529488869657 ], [ 47.0, 0.11653514752934142 ], [ 48.0, 0.32599621496862774 ], [ 49.0, 0.8316114336656244 ], [ 50.0, 1.1608185035904897 ], [ 51.0, 3.061644637683341 ], [ 52.0, 30.204701447151283 ], [ 53.0, 47.01692687183392 ], [ 54.0, 11.263679186482667 ], [ 55.0, 3.2724278218693184 ], [ 56.0, 1.2512890638280179 ], [ 57.0, 0.5016488684569381 ], [ 58.0, 0.08971506495370693 ], [ 59.0, 0.049107193448344834 ], [ 60.0, 0.03607489980243795 ], [ 61.0, 0.023986975261306907 ], [ 62.0, 0.010765807794444832 ], [ 63.0, 0.012465672183041383 ], [ 64.0, 0.009632564868713797 ], [ 65.0, 0.004532971702924139 ], [ 66.0, 0.002833107314327587 ], [ 67.0, 0.004532971702924139 ], [ 68.0, 0.002833107314327587 ], [ 69.0, 0.003399728777193105 ], [ 70.0, 0.003399728777193105 ], [ 71.0, 0.004155224061013795 ], [ 72.0, 0.0011332429257310348 ], [ 73.0, 0.0005666214628655174 ], [ 74.0, 0.002833107314327587 ], [ 75.0, 0.0022664858514620696 ], [ 76.0, 0.0016998643885965524 ], [ 77.0, 0.0016998643885965524 ], [ 78.0, 0.0011332429257310348 ], [ 79.0, 0.0011332429257310348 ], [ 80.0, 0.0022664858514620696 ], [ 81.0, 0.0030219811352827594 ], [ 82.0, 0.002455359672417242 ], [ 83.0, 0.0035886025981482768 ], [ 84.0, 0.003399728777193105 ], [ 85.0, 0.0022664858514620696 ], [ 86.0, 0.003399728777193105 ], [ 87.0, 0.003399728777193105 ], [ 88.0, 0.0016998643885965524 ], [ 89.0, 0.0016998643885965524 ], [ 90.0, 0.002833107314327587 ], [ 91.0, 0.0035886025981482768 ], [ 92.0, 0.003966350240058623 ], [ 93.0, 0.0016998643885965524 ], [ 94.0, 0.0007554952838206898 ], [ 95.0, 0.004721845523879311 ], [ 96.0, 0.005855088449610346 ], [ 97.0, 0.005855088449610346 ], [ 98.0, 0.008499321942982762 ], [ 99.0, 0.014732158034503454 ], [ 100.0, 0.05326241750935861 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVFS1_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0006943512213637994 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0006943512213637994 ], [ 16.0, 0.0006943512213637994 ], [ 17.0, 0.0 ], [ 18.0, 0.0006943512213637994 ], [ 19.0, 0.0 ], [ 20.0, 0.0006943512213637994 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0013887024427275988 ], [ 24.0, 0.0020830536640913983 ], [ 25.0, 0.0006943512213637994 ], [ 26.0, 0.0 ], [ 27.0, 0.0006943512213637994 ], [ 28.0, 0.0034717561068189975 ], [ 29.0, 0.004860458549546596 ], [ 30.0, 0.0041661073281827965 ], [ 31.0, 0.006249160992274194 ], [ 32.0, 0.0041661073281827965 ], [ 33.0, 0.005554809770910395 ], [ 34.0, 0.005554809770910395 ], [ 35.0, 0.00786931384212306 ], [ 36.0, 0.01828458216258005 ], [ 37.0, 0.02569099519046058 ], [ 38.0, 0.02777404885455198 ], [ 39.0, 0.03356030903258364 ], [ 40.0, 0.030088552925764643 ], [ 41.0, 0.03610626351091757 ], [ 42.0, 0.05878840340880168 ], [ 43.0, 0.07498993190729034 ], [ 44.0, 0.06850932050789486 ], [ 45.0, 0.08818260511320251 ], [ 46.0, 0.08447939859926226 ], [ 47.0, 0.10299543116896359 ], [ 48.0, 0.17798536307625396 ], [ 49.0, 0.2402455225918746 ], [ 50.0, 0.36939484976554116 ], [ 51.0, 1.5294242902573287 ], [ 52.0, 21.0237977308601 ], [ 53.0, 59.52649875711135 ], [ 54.0, 13.130644496803692 ], [ 55.0, 2.060602974600636 ], [ 56.0, 0.5638131917474054 ], [ 57.0, 0.2175633826939905 ], [ 58.0, 0.10299543116896358 ], [ 59.0, 0.060408556258650555 ], [ 60.0, 0.049298936716829764 ], [ 61.0, 0.028468400075915775 ], [ 62.0, 0.018747482976822587 ], [ 63.0, 0.018747482976822587 ], [ 64.0, 0.009026565877729393 ], [ 65.0, 0.005554809770910395 ], [ 66.0, 0.0037032065139402633 ], [ 67.0, 0.0027774048854551977 ], [ 68.0, 0.0027774048854551977 ], [ 69.0, 0.0037032065139402633 ], [ 70.0, 0.0020830536640913983 ], [ 71.0, 0.0020830536640913983 ], [ 72.0, 0.0020830536640913983 ], [ 73.0, 0.0027774048854551977 ], [ 74.0, 0.0034717561068189975 ], [ 75.0, 0.0027774048854551977 ], [ 76.0, 0.001620152849848865 ], [ 77.0, 0.0020830536640913983 ], [ 78.0, 0.0034717561068189975 ], [ 79.0, 0.0034717561068189975 ], [ 80.0, 0.0006943512213637994 ], [ 81.0, 0.0013887024427275988 ], [ 82.0, 0.0013887024427275988 ], [ 83.0, 0.0020830536640913983 ], [ 84.0, 0.0013887024427275988 ], [ 85.0, 0.0006943512213637994 ], [ 86.0, 0.0013887024427275988 ], [ 87.0, 0.0027774048854551977 ], [ 88.0, 0.001620152849848865 ], [ 89.0, 0.0023145040712126645 ], [ 90.0, 0.0006943512213637994 ], [ 91.0, 0.001620152849848865 ], [ 92.0, 0.0009258016284850658 ], [ 93.0, 0.0027774048854551977 ], [ 94.0, 0.0020830536640913983 ], [ 95.0, 0.0006943512213637994 ], [ 96.0, 0.0027774048854551977 ], [ 97.0, 0.006943512213637995 ], [ 98.0, 0.010415268320456993 ], [ 99.0, 0.015044276462882322 ], [ 100.0, 0.06850932050789484 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVFS2_R2", "pairs": [ [ 0.0, 0.0010036348308122575 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0015054522462183864 ], [ 4.0, 0.0010036348308122575 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0005018174154061288 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0005018174154061288 ], [ 12.0, 0.0005018174154061288 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0005018174154061288 ], [ 24.0, 0.0005018174154061288 ], [ 25.0, 0.0015054522462183864 ], [ 26.0, 0.0015054522462183864 ], [ 27.0, 0.0005018174154061288 ], [ 28.0, 0.0016727247180204291 ], [ 29.0, 0.0026763595488326864 ], [ 30.0, 0.005018174154061287 ], [ 31.0, 0.00401453932324903 ], [ 32.0, 0.004683629210457201 ], [ 33.0, 0.006858171343883761 ], [ 34.0, 0.009032713477310318 ], [ 35.0, 0.01605815729299612 ], [ 36.0, 0.02358541852408805 ], [ 37.0, 0.027265412903732997 ], [ 38.0, 0.03362176683221063 ], [ 39.0, 0.036298126381043315 ], [ 40.0, 0.056872640412694596 ], [ 41.0, 0.06071990726414158 ], [ 42.0, 0.07075625557226417 ], [ 43.0, 0.08330169095741738 ], [ 44.0, 0.09216713196292567 ], [ 45.0, 0.11909799992305457 ], [ 46.0, 0.2507414352312623 ], [ 47.0, 1.7515100522391918 ], [ 48.0, 2.368912745660532 ], [ 49.0, 0.8290023702509246 ], [ 50.0, 1.3649433699046725 ], [ 51.0, 7.58848295577151 ], [ 52.0, 41.85541971172256 ], [ 53.0, 31.823922305282302 ], [ 54.0, 8.007165952691995 ], [ 55.0, 1.659342920276266 ], [ 56.0, 1.0344129656238332 ], [ 57.0, 0.46869746598932427 ], [ 58.0, 0.08982531735769705 ], [ 59.0, 0.030610862339773857 ], [ 60.0, 0.021243603918859454 ], [ 61.0, 0.011709073026143005 ], [ 62.0, 0.008698168533706231 ], [ 63.0, 0.0035127219078429014 ], [ 64.0, 0.007025443815685803 ], [ 65.0, 0.005018174154061287 ], [ 66.0, 0.005519991569467416 ], [ 67.0, 0.005185446625863331 ], [ 68.0, 0.002174542133426558 ], [ 69.0, 0.003010904492436773 ], [ 70.0, 0.00401453932324903 ], [ 71.0, 0.0025090870770306437 ], [ 72.0, 0.002007269661624515 ], [ 73.0, 0.0025090870770306437 ], [ 74.0, 0.0036799943796449446 ], [ 75.0, 0.002007269661624515 ], [ 76.0, 0.0005018174154061288 ], [ 77.0, 0.0015054522462183864 ], [ 78.0, 0.0025090870770306437 ], [ 79.0, 0.0015054522462183864 ], [ 80.0, 0.002007269661624515 ], [ 81.0, 0.002007269661624515 ], [ 82.0, 0.00401453932324903 ], [ 83.0, 0.0015054522462183864 ], [ 84.0, 0.0010036348308122575 ], [ 85.0, 0.002174542133426558 ], [ 86.0, 0.0016727247180204291 ], [ 87.0, 0.0005018174154061288 ], [ 88.0, 0.0010036348308122575 ], [ 89.0, 0.0010036348308122575 ], [ 90.0, 0.0015054522462183864 ], [ 91.0, 0.0010036348308122575 ], [ 92.0, 0.0005018174154061288 ], [ 93.0, 0.005185446625863331 ], [ 94.0, 0.005519991569467416 ], [ 95.0, 0.004516356738655159 ], [ 96.0, 0.0031781769642388155 ], [ 97.0, 0.008363623590102145 ], [ 98.0, 0.010203620779924618 ], [ 99.0, 0.011541800554340962 ], [ 100.0, 0.04951265165340467 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVMS1_R2", "pairs": [ [ 0.0, 0.00043914381594018783 ], [ 1.0, 0.00021957190797009392 ], [ 2.0, 0.00021957190797009392 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.00021957190797009392 ], [ 7.0, 0.00021957190797009392 ], [ 8.0, 0.00021957190797009392 ], [ 9.0, 0.00043914381594018783 ], [ 10.0, 0.00043914381594018783 ], [ 11.0, 0.0 ], [ 12.0, 0.00021957190797009392 ], [ 13.0, 0.00043914381594018783 ], [ 14.0, 0.00021957190797009392 ], [ 15.0, 0.0 ], [ 16.0, 0.00043914381594018783 ], [ 17.0, 0.0006587157239102817 ], [ 18.0, 0.00043914381594018783 ], [ 19.0, 0.00043914381594018783 ], [ 20.0, 0.00043914381594018783 ], [ 21.0, 0.0011710501758405007 ], [ 22.0, 0.0018297658997507823 ], [ 23.0, 0.0006587157239102817 ], [ 24.0, 0.0010978595398504695 ], [ 25.0, 0.0008782876318803757 ], [ 26.0, 0.0008782876318803757 ], [ 27.0, 0.0008782876318803757 ], [ 28.0, 0.0006587157239102817 ], [ 29.0, 0.0013174314478205634 ], [ 30.0, 0.0037327224354915963 ], [ 31.0, 0.0030740067115813145 ], [ 32.0, 0.0029276254396012518 ], [ 33.0, 0.004025484979451721 ], [ 34.0, 0.00563567897123241 ], [ 35.0, 0.00900244822677385 ], [ 36.0, 0.014564936562016233 ], [ 37.0, 0.01976147171730845 ], [ 38.0, 0.029422635667992584 ], [ 39.0, 0.03447278955130474 ], [ 40.0, 0.03469236145927483 ], [ 41.0, 0.039962087250557096 ], [ 42.0, 0.044060762865998845 ], [ 43.0, 0.053136401728762724 ], [ 44.0, 0.05745464925217456 ], [ 45.0, 0.06565200048305805 ], [ 46.0, 0.07831398050933348 ], [ 47.0, 0.2328926037202796 ], [ 48.0, 0.3560724440915023 ], [ 49.0, 0.4396561503921176 ], [ 50.0, 0.6336113357657015 ], [ 51.0, 1.5092641047504287 ], [ 52.0, 18.1226601868556 ], [ 53.0, 56.74140650445197 ], [ 54.0, 14.18478439868403 ], [ 55.0, 4.348548446711719 ], [ 56.0, 1.8552362410753105 ], [ 57.0, 0.6347823859415419 ], [ 58.0, 0.1312308103301261 ], [ 59.0, 0.0481594384814406 ], [ 60.0, 0.03827870262278637 ], [ 61.0, 0.022835478428889767 ], [ 62.0, 0.013613458294145822 ], [ 63.0, 0.015370033557906573 ], [ 64.0, 0.008563304410833663 ], [ 65.0, 0.004391438159401878 ], [ 66.0, 0.003879103707471658 ], [ 67.0, 0.0027080535316311577 ], [ 68.0, 0.0026348628956411268 ], [ 69.0, 0.0015370033557906572 ], [ 70.0, 0.002195719079700939 ], [ 71.0, 0.0026348628956411268 ], [ 72.0, 0.0015370033557906572 ], [ 73.0, 0.0015370033557906572 ], [ 74.0, 0.002927625439601252 ], [ 75.0, 0.002195719079700939 ], [ 76.0, 0.001976147171730845 ], [ 77.0, 0.0010978595398504695 ], [ 78.0, 0.0015370033557906572 ], [ 79.0, 0.001976147171730845 ], [ 80.0, 0.001976147171730845 ], [ 81.0, 0.0013174314478205634 ], [ 82.0, 0.00336676925554144 ], [ 83.0, 0.002488481623661064 ], [ 84.0, 0.0017565752637607513 ], [ 85.0, 0.0010978595398504695 ], [ 86.0, 0.00021957190797009392 ], [ 87.0, 0.0009514782678704068 ], [ 88.0, 0.0015370033557906572 ], [ 89.0, 0.002195719079700939 ], [ 90.0, 0.0022689097156909704 ], [ 91.0, 0.002927625439601252 ], [ 92.0, 0.002854434803611221 ], [ 93.0, 0.003293578619551409 ], [ 94.0, 0.002195719079700939 ], [ 95.0, 0.0017565752637607513 ], [ 96.0, 0.00395229434346169 ], [ 97.0, 0.0031471973475713463 ], [ 98.0, 0.0036595317995015654 ], [ 99.0, 0.0107590234905346 ], [ 100.0, 0.059577177695885594 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVMS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.000646728738253789 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.000646728738253789 ], [ 7.0, 0.000646728738253789 ], [ 8.0, 0.000646728738253789 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.000646728738253789 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.000646728738253789 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.001293457476507578 ], [ 22.0, 0.0019401862147613669 ], [ 23.0, 0.000646728738253789 ], [ 24.0, 0.0 ], [ 25.0, 0.000646728738253789 ], [ 26.0, 0.002586914953015156 ], [ 27.0, 0.002586914953015156 ], [ 28.0, 0.001293457476507578 ], [ 29.0, 0.001293457476507578 ], [ 30.0, 0.000646728738253789 ], [ 31.0, 0.0019401862147613669 ], [ 32.0, 0.004527101167776523 ], [ 33.0, 0.0038803724295227338 ], [ 34.0, 0.002586914953015156 ], [ 35.0, 0.011641117288568202 ], [ 36.0, 0.014659184733752549 ], [ 37.0, 0.018539557163275284 ], [ 38.0, 0.023282234577136404 ], [ 39.0, 0.027809335744912924 ], [ 40.0, 0.036216809342212185 ], [ 41.0, 0.04225294423258089 ], [ 42.0, 0.04785792663078039 ], [ 43.0, 0.06553517880971728 ], [ 44.0, 0.09269778581637642 ], [ 45.0, 0.11748905411610501 ], [ 46.0, 0.25093075044247015 ], [ 47.0, 1.8755133409359879 ], [ 48.0, 2.5459554662590826 ], [ 49.0, 0.9103784872152502 ], [ 50.0, 0.9284868918863564 ], [ 51.0, 2.3329661351275046 ], [ 52.0, 17.198457336382976 ], [ 53.0, 48.168356425142235 ], [ 54.0, 14.935337904986923 ], [ 55.0, 5.806546188288601 ], [ 56.0, 2.447437121798423 ], [ 57.0, 1.392191397214323 ], [ 58.0, 0.30568711694795764 ], [ 59.0, 0.0763139911139471 ], [ 60.0, 0.04203736798649629 ], [ 61.0, 0.017461675932852305 ], [ 62.0, 0.010994388550314413 ], [ 63.0, 0.024144539561474786 ], [ 64.0, 0.015737065964175533 ], [ 65.0, 0.00646728738253789 ], [ 66.0, 0.003233643691268945 ], [ 67.0, 0.005604982398199504 ], [ 68.0, 0.002802491199099752 ], [ 69.0, 0.002586914953015156 ], [ 70.0, 0.005173829906030312 ], [ 71.0, 0.00646728738253789 ], [ 72.0, 0.004742677413861119 ], [ 73.0, 0.003449219937353541 ], [ 74.0, 0.002586914953015156 ], [ 75.0, 0.0019401862147613669 ], [ 76.0, 0.0008623049843383853 ], [ 77.0, 0.0019401862147613669 ], [ 78.0, 0.003233643691268945 ], [ 79.0, 0.002586914953015156 ], [ 80.0, 0.000646728738253789 ], [ 81.0, 0.002586914953015156 ], [ 82.0, 0.001293457476507578 ], [ 83.0, 0.002586914953015156 ], [ 84.0, 0.000646728738253789 ], [ 85.0, 0.004527101167776523 ], [ 86.0, 0.000646728738253789 ], [ 87.0, 0.0019401862147613669 ], [ 88.0, 0.0038803724295227338 ], [ 89.0, 0.001293457476507578 ], [ 90.0, 0.002155762460845963 ], [ 91.0, 0.0030180674451843483 ], [ 92.0, 0.003449219937353541 ], [ 93.0, 0.003233643691268945 ], [ 94.0, 0.003233643691268945 ], [ 95.0, 0.003233643691268945 ], [ 96.0, 0.00646728738253789 ], [ 97.0, 0.006682863628622487 ], [ 98.0, 0.00991650731989143 ], [ 99.0, 0.017461675932852305 ], [ 100.0, 0.05475636650548745 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null } ] }, { "plot_id": "fastqc_per_sequence_gc_content_plot", "label": "Counts", "uid": "fastqc_per_sequence_gc_content_plot_Counts", "dconfig": { "name": "Counts", "ylab": "Count", "tt_suffix": "", "title": "FastQC: Per Sequence GC Content
Counts, 64 samples" }, "layout": { "title": { "text": "FastQC: Per Sequence GC Content
Counts, 64 samples" }, "xaxis": { "hoverformat": null, "ticksuffix": "%", "title": { "text": "% GC" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": 100 } }, "yaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "Count" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": null } } }, "trace_params": { "hovertemplate": "%{text}
%{x} GC: %{y}", "mode": "lines", "line": { "width": 2 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "n_samples": 64, "lines": [ { "name": "CAFS1_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.25 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.25 ], [ 43.0, 0.0 ], [ 44.0, 0.5833333333333333 ], [ 45.0, 0.8333333333333333 ], [ 46.0, 4.833333333333334 ], [ 47.0, 119.24999999999999 ], [ 48.0, 697.7500000000001 ], [ 49.0, 1127.8333333333333 ], [ 50.0, 1119.6666666666667 ], [ 51.0, 2042.4166666666658 ], [ 52.0, 7474.333333333327 ], [ 53.0, 12338.500000000015 ], [ 54.0, 12201.250000000002 ], [ 55.0, 7139.083333333332 ], [ 56.0, 7340.33333333333 ], [ 57.0, 2106.249999999999 ], [ 58.0, 103.83333333333331 ], [ 59.0, 26.999999999999996 ], [ 60.0, 16.833333333333336 ], [ 61.0, 14.916666666666668 ], [ 62.0, 11.083333333333332 ], [ 63.0, 24.75 ], [ 64.0, 13.25 ], [ 65.0, 6.333333333333333 ], [ 66.0, 7.75 ], [ 67.0, 7.333333333333333 ], [ 68.0, 5.75 ], [ 69.0, 5.25 ], [ 70.0, 4.333333333333333 ], [ 71.0, 4.083333333333333 ], [ 72.0, 4.5 ], [ 73.0, 2.5 ], [ 74.0, 2.833333333333333 ], [ 75.0, 1.9166666666666665 ], [ 76.0, 2.3333333333333335 ], [ 77.0, 2.25 ], [ 78.0, 2.333333333333333 ], [ 79.0, 1.9166666666666665 ], [ 80.0, 2.5833333333333335 ], [ 81.0, 2.75 ], [ 82.0, 2.0 ], [ 83.0, 1.5 ], [ 84.0, 1.75 ], [ 85.0, 1.25 ], [ 86.0, 1.5833333333333333 ], [ 87.0, 1.0833333333333333 ], [ 88.0, 0.8333333333333333 ], [ 89.0, 2.75 ], [ 90.0, 3.25 ], [ 91.0, 2.583333333333333 ], [ 92.0, 2.083333333333333 ], [ 93.0, 2.25 ], [ 94.0, 1.5 ], [ 95.0, 1.0 ], [ 96.0, 1.5 ], [ 97.0, 1.75 ], [ 98.0, 2.833333333333333 ], [ 99.0, 13.583333333333334 ], [ 100.0, 13.33333333333334 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAFS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.0 ], [ 46.0, 3.916666666666667 ], [ 47.0, 139.91666666666663 ], [ 48.0, 772.9166666666667 ], [ 49.0, 1180.6666666666665 ], [ 50.0, 1135.5 ], [ 51.0, 1817.2499999999995 ], [ 52.0, 6974.1666666666615 ], [ 53.0, 11393.666666666672 ], [ 54.0, 11016.333333333334 ], [ 55.0, 6371.083333333331 ], [ 56.0, 6922.666666666664 ], [ 57.0, 2049.4166666666656 ], [ 58.0, 89.41666666666667 ], [ 59.0, 23.583333333333336 ], [ 60.0, 18.083333333333336 ], [ 61.0, 9.5 ], [ 62.0, 11.083333333333334 ], [ 63.0, 22.083333333333332 ], [ 64.0, 9.75 ], [ 65.0, 7.5 ], [ 66.0, 3.25 ], [ 67.0, 6.25 ], [ 68.0, 6.166666666666666 ], [ 69.0, 3.9166666666666665 ], [ 70.0, 2.583333333333333 ], [ 71.0, 3.25 ], [ 72.0, 3.25 ], [ 73.0, 3.0 ], [ 74.0, 2.5 ], [ 75.0, 3.0 ], [ 76.0, 3.083333333333333 ], [ 77.0, 3.833333333333333 ], [ 78.0, 2.75 ], [ 79.0, 2.333333333333333 ], [ 80.0, 2.5 ], [ 81.0, 0.5 ], [ 82.0, 0.5 ], [ 83.0, 0.75 ], [ 84.0, 1.0 ], [ 85.0, 0.25 ], [ 86.0, 0.5 ], [ 87.0, 1.25 ], [ 88.0, 0.75 ], [ 89.0, 0.75 ], [ 90.0, 0.5 ], [ 91.0, 1.5833333333333333 ], [ 92.0, 1.3333333333333333 ], [ 93.0, 1.5 ], [ 94.0, 1.25 ], [ 95.0, 1.3333333333333333 ], [ 96.0, 0.5833333333333333 ], [ 97.0, 0.5 ], [ 98.0, 2.75 ], [ 99.0, 10.0 ], [ 100.0, 15.000000000000009 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAMS1_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.5 ], [ 46.0, 2.333333333333333 ], [ 47.0, 141.24999999999997 ], [ 48.0, 762.416666666667 ], [ 49.0, 1430.6666666666667 ], [ 50.0, 1933.2499999999984 ], [ 51.0, 2067.7499999999986 ], [ 52.0, 6517.249999999994 ], [ 53.0, 10780.916666666672 ], [ 54.0, 11064.500000000004 ], [ 55.0, 7423.749999999996 ], [ 56.0, 4780.333333333334 ], [ 57.0, 1357.1666666666667 ], [ 58.0, 86.25 ], [ 59.0, 26.5 ], [ 60.0, 26.0 ], [ 61.0, 11.0 ], [ 62.0, 11.0 ], [ 63.0, 30.583333333333336 ], [ 64.0, 11.583333333333334 ], [ 65.0, 6.0 ], [ 66.0, 7.75 ], [ 67.0, 6.75 ], [ 68.0, 5.25 ], [ 69.0, 5.833333333333333 ], [ 70.0, 6.0 ], [ 71.0, 3.333333333333333 ], [ 72.0, 4.333333333333334 ], [ 73.0, 3.5 ], [ 74.0, 2.0 ], [ 75.0, 3.833333333333333 ], [ 76.0, 3.583333333333333 ], [ 77.0, 2.0833333333333335 ], [ 78.0, 3.5833333333333335 ], [ 79.0, 2.75 ], [ 80.0, 1.8333333333333333 ], [ 81.0, 3.1666666666666665 ], [ 82.0, 3.0 ], [ 83.0, 3.1666666666666665 ], [ 84.0, 1.9166666666666665 ], [ 85.0, 0.8333333333333333 ], [ 86.0, 0.5833333333333333 ], [ 87.0, 0.5 ], [ 88.0, 1.25 ], [ 89.0, 1.25 ], [ 90.0, 0.5 ], [ 91.0, 1.75 ], [ 92.0, 0.5 ], [ 93.0, 1.25 ], [ 94.0, 0.75 ], [ 95.0, 1.5 ], [ 96.0, 1.75 ], [ 97.0, 1.25 ], [ 98.0, 1.3333333333333333 ], [ 99.0, 10.0 ], [ 100.0, 16.00000000000001 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAMS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.25 ], [ 45.0, 0.5 ], [ 46.0, 4.666666666666666 ], [ 47.0, 177.4166666666667 ], [ 48.0, 827.1666666666672 ], [ 49.0, 1601.5833333333323 ], [ 50.0, 2308.083333333333 ], [ 51.0, 2242.4999999999986 ], [ 52.0, 7072.499999999988 ], [ 53.0, 12159.666666666677 ], [ 54.0, 12602.00000000001 ], [ 55.0, 8009.416666666663 ], [ 56.0, 6262.249999999999 ], [ 57.0, 1771.583333333333 ], [ 58.0, 94.08333333333333 ], [ 59.0, 23.666666666666664 ], [ 60.0, 15.25 ], [ 61.0, 10.75 ], [ 62.0, 12.25 ], [ 63.0, 26.75 ], [ 64.0, 9.75 ], [ 65.0, 5.333333333333333 ], [ 66.0, 3.75 ], [ 67.0, 5.25 ], [ 68.0, 4.75 ], [ 69.0, 4.75 ], [ 70.0, 5.083333333333333 ], [ 71.0, 4.583333333333333 ], [ 72.0, 4.333333333333334 ], [ 73.0, 5.25 ], [ 74.0, 3.75 ], [ 75.0, 1.5 ], [ 76.0, 1.4999999999999998 ], [ 77.0, 2.75 ], [ 78.0, 2.75 ], [ 79.0, 1.5 ], [ 80.0, 2.0 ], [ 81.0, 0.5 ], [ 82.0, 1.9166666666666665 ], [ 83.0, 1.25 ], [ 84.0, 1.0 ], [ 85.0, 1.0 ], [ 86.0, 1.3333333333333333 ], [ 87.0, 1.5833333333333333 ], [ 88.0, 1.75 ], [ 89.0, 1.0 ], [ 90.0, 1.25 ], [ 91.0, 1.5 ], [ 92.0, 1.25 ], [ 93.0, 1.0 ], [ 94.0, 0.75 ], [ 95.0, 1.0 ], [ 96.0, 1.25 ], [ 97.0, 1.25 ], [ 98.0, 1.0 ], [ 99.0, 12.0 ], [ 100.0, 29.66666666666663 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCFS1_R2", "pairs": [ [ 0.0, 0.5 ], [ 1.0, 0.25 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.25 ], [ 8.0, 0.25 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.25 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.25 ], [ 15.0, 0.5 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.75 ], [ 19.0, 0.75 ], [ 20.0, 0.0 ], [ 21.0, 0.25 ], [ 22.0, 0.75 ], [ 23.0, 0.0 ], [ 24.0, 0.5 ], [ 25.0, 0.75 ], [ 26.0, 1.5833333333333333 ], [ 27.0, 0.5833333333333333 ], [ 28.0, 0.75 ], [ 29.0, 1.0 ], [ 30.0, 2.5 ], [ 31.0, 2.75 ], [ 32.0, 0.75 ], [ 33.0, 3.583333333333333 ], [ 34.0, 3.9166666666666665 ], [ 35.0, 5.0 ], [ 36.0, 7.75 ], [ 37.0, 13.333333333333332 ], [ 38.0, 15.833333333333334 ], [ 39.0, 17.5 ], [ 40.0, 19.0 ], [ 41.0, 22.333333333333336 ], [ 42.0, 24.833333333333336 ], [ 43.0, 32.333333333333336 ], [ 44.0, 41.333333333333336 ], [ 45.0, 48.83333333333333 ], [ 46.0, 50.5 ], [ 47.0, 114.66666666666661 ], [ 48.0, 572.9166666666665 ], [ 49.0, 3225.5000000000005 ], [ 50.0, 4320.916666666672 ], [ 51.0, 5441.166666666667 ], [ 52.0, 11833.33333333335 ], [ 53.0, 16708.1666666667 ], [ 54.0, 15450.666666666679 ], [ 55.0, 7905.6666666666615 ], [ 56.0, 4005.1666666666683 ], [ 57.0, 2004.833333333333 ], [ 58.0, 172.66666666666669 ], [ 59.0, 30.916666666666664 ], [ 60.0, 11.25 ], [ 61.0, 7.166666666666666 ], [ 62.0, 8.249999999999998 ], [ 63.0, 17.083333333333336 ], [ 64.0, 6.75 ], [ 65.0, 2.25 ], [ 66.0, 3.0 ], [ 67.0, 2.25 ], [ 68.0, 1.0 ], [ 69.0, 2.5 ], [ 70.0, 2.0 ], [ 71.0, 1.0 ], [ 72.0, 1.5 ], [ 73.0, 1.0 ], [ 74.0, 1.3333333333333333 ], [ 75.0, 1.25 ], [ 76.0, 1.0 ], [ 77.0, 0.5 ], [ 78.0, 1.0 ], [ 79.0, 1.0 ], [ 80.0, 0.75 ], [ 81.0, 0.25 ], [ 82.0, 0.75 ], [ 83.0, 0.5 ], [ 84.0, 0.75 ], [ 85.0, 1.75 ], [ 86.0, 1.75 ], [ 87.0, 1.0 ], [ 88.0, 1.25 ], [ 89.0, 1.9166666666666665 ], [ 90.0, 0.5 ], [ 91.0, 2.25 ], [ 92.0, 2.5 ], [ 93.0, 1.0 ], [ 94.0, 0.5 ], [ 95.0, 1.75 ], [ 96.0, 4.75 ], [ 97.0, 4.0 ], [ 98.0, 4.0 ], [ 99.0, 6.583333333333333 ], [ 100.0, 36.83333333333332 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCFS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.25 ], [ 6.0, 0.25 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.25 ], [ 14.0, 0.25 ], [ 15.0, 1.0 ], [ 16.0, 0.25 ], [ 17.0, 0.5 ], [ 18.0, 1.0 ], [ 19.0, 0.25 ], [ 20.0, 0.25 ], [ 21.0, 0.5 ], [ 22.0, 0.25 ], [ 23.0, 0.75 ], [ 24.0, 1.0833333333333333 ], [ 25.0, 0.5833333333333333 ], [ 26.0, 0.5833333333333333 ], [ 27.0, 1.0 ], [ 28.0, 1.0 ], [ 29.0, 0.8333333333333333 ], [ 30.0, 2.5833333333333335 ], [ 31.0, 1.5 ], [ 32.0, 1.75 ], [ 33.0, 3.0 ], [ 34.0, 3.8333333333333335 ], [ 35.0, 6.333333333333333 ], [ 36.0, 9.75 ], [ 37.0, 11.75 ], [ 38.0, 13.25 ], [ 39.0, 16.5 ], [ 40.0, 16.5 ], [ 41.0, 20.0 ], [ 42.0, 32.25 ], [ 43.0, 34.16666666666667 ], [ 44.0, 33.5 ], [ 45.0, 31.833333333333332 ], [ 46.0, 50.0 ], [ 47.0, 110.9166666666666 ], [ 48.0, 523.6666666666661 ], [ 49.0, 2660.000000000001 ], [ 50.0, 3559.3333333333408 ], [ 51.0, 5348.5833333333285 ], [ 52.0, 11293.833333333338 ], [ 53.0, 15988.833333333396 ], [ 54.0, 14580.916666666692 ], [ 55.0, 7183.666666666661 ], [ 56.0, 3825.2500000000023 ], [ 57.0, 2004.8333333333326 ], [ 58.0, 184.83333333333337 ], [ 59.0, 35.08333333333333 ], [ 60.0, 13.333333333333334 ], [ 61.0, 7.416666666666666 ], [ 62.0, 5.5 ], [ 63.0, 12.25 ], [ 64.0, 7.0 ], [ 65.0, 2.25 ], [ 66.0, 1.5833333333333333 ], [ 67.0, 2.583333333333333 ], [ 68.0, 2.083333333333333 ], [ 69.0, 2.5833333333333335 ], [ 70.0, 2.9166666666666665 ], [ 71.0, 1.75 ], [ 72.0, 1.0 ], [ 73.0, 2.0 ], [ 74.0, 1.25 ], [ 75.0, 1.5833333333333333 ], [ 76.0, 0.75 ], [ 77.0, 0.5 ], [ 78.0, 0.75 ], [ 79.0, 0.75 ], [ 80.0, 0.25 ], [ 81.0, 0.75 ], [ 82.0, 0.5833333333333333 ], [ 83.0, 0.75 ], [ 84.0, 1.0 ], [ 85.0, 1.0 ], [ 86.0, 1.0 ], [ 87.0, 2.0 ], [ 88.0, 1.5 ], [ 89.0, 0.5 ], [ 90.0, 1.0 ], [ 91.0, 1.0 ], [ 92.0, 1.0833333333333333 ], [ 93.0, 0.8333333333333333 ], [ 94.0, 2.333333333333333 ], [ 95.0, 2.333333333333333 ], [ 96.0, 2.0 ], [ 97.0, 3.75 ], [ 98.0, 6.0 ], [ 99.0, 7.833333333333333 ], [ 100.0, 33.8333333333333 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCMS1_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.75 ], [ 16.0, 0.5 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.75 ], [ 20.0, 0.25 ], [ 21.0, 0.0 ], [ 22.0, 0.25 ], [ 23.0, 0.0 ], [ 24.0, 1.25 ], [ 25.0, 0.75 ], [ 26.0, 0.5 ], [ 27.0, 0.5 ], [ 28.0, 1.0 ], [ 29.0, 0.75 ], [ 30.0, 0.75 ], [ 31.0, 2.25 ], [ 32.0, 3.75 ], [ 33.0, 2.75 ], [ 34.0, 4.333333333333334 ], [ 35.0, 7.583333333333334 ], [ 36.0, 11.25 ], [ 37.0, 14.083333333333332 ], [ 38.0, 19.0 ], [ 39.0, 21.75 ], [ 40.0, 23.0 ], [ 41.0, 22.0 ], [ 42.0, 26.25 ], [ 43.0, 35.083333333333336 ], [ 44.0, 38.5 ], [ 45.0, 48.5 ], [ 46.0, 59.916666666666664 ], [ 47.0, 196.7500000000001 ], [ 48.0, 680.0833333333335 ], [ 49.0, 3491.416666666669 ], [ 50.0, 4906.666666666668 ], [ 51.0, 4027.3333333333367 ], [ 52.0, 9158.666666666662 ], [ 53.0, 15096.91666666669 ], [ 54.0, 14675.666666666684 ], [ 55.0, 8526.58333333333 ], [ 56.0, 5209.750000000001 ], [ 57.0, 3340.5 ], [ 58.0, 283.5833333333333 ], [ 59.0, 36.33333333333333 ], [ 60.0, 17.583333333333336 ], [ 61.0, 10.083333333333332 ], [ 62.0, 6.25 ], [ 63.0, 14.75 ], [ 64.0, 7.25 ], [ 65.0, 2.5 ], [ 66.0, 0.75 ], [ 67.0, 2.0 ], [ 68.0, 1.5 ], [ 69.0, 1.25 ], [ 70.0, 1.5 ], [ 71.0, 1.0833333333333333 ], [ 72.0, 1.0 ], [ 73.0, 1.25 ], [ 74.0, 1.0 ], [ 75.0, 2.0 ], [ 76.0, 0.75 ], [ 77.0, 1.0 ], [ 78.0, 1.3333333333333333 ], [ 79.0, 0.5 ], [ 80.0, 1.0 ], [ 81.0, 1.0833333333333333 ], [ 82.0, 0.75 ], [ 83.0, 0.75 ], [ 84.0, 0.25 ], [ 85.0, 1.0 ], [ 86.0, 0.5833333333333333 ], [ 87.0, 1.0 ], [ 88.0, 1.0 ], [ 89.0, 2.0 ], [ 90.0, 2.0 ], [ 91.0, 1.0833333333333333 ], [ 92.0, 0.8333333333333333 ], [ 93.0, 0.8333333333333333 ], [ 94.0, 1.8333333333333333 ], [ 95.0, 1.75 ], [ 96.0, 2.25 ], [ 97.0, 1.9166666666666665 ], [ 98.0, 4.583333333333334 ], [ 99.0, 8.416666666666666 ], [ 100.0, 29.166666666666632 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCMS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.25 ], [ 7.0, 0.0 ], [ 8.0, 0.25 ], [ 9.0, 0.25 ], [ 10.0, 0.3333333333333333 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.75 ], [ 17.0, 0.25 ], [ 18.0, 0.5 ], [ 19.0, 0.25 ], [ 20.0, 0.0 ], [ 21.0, 0.25 ], [ 22.0, 1.0 ], [ 23.0, 0.75 ], [ 24.0, 1.0 ], [ 25.0, 0.75 ], [ 26.0, 1.0 ], [ 27.0, 1.0 ], [ 28.0, 1.8333333333333333 ], [ 29.0, 1.5 ], [ 30.0, 0.75 ], [ 31.0, 1.5 ], [ 32.0, 1.75 ], [ 33.0, 2.25 ], [ 34.0, 4.0 ], [ 35.0, 5.25 ], [ 36.0, 5.5 ], [ 37.0, 14.166666666666668 ], [ 38.0, 19.666666666666668 ], [ 39.0, 21.5 ], [ 40.0, 19.5 ], [ 41.0, 26.5 ], [ 42.0, 31.0 ], [ 43.0, 36.916666666666664 ], [ 44.0, 35.08333333333333 ], [ 45.0, 42.83333333333333 ], [ 46.0, 58.16666666666667 ], [ 47.0, 180.75000000000006 ], [ 48.0, 579.0000000000001 ], [ 49.0, 3095.0000000000014 ], [ 50.0, 4372.41666666667 ], [ 51.0, 3762.750000000003 ], [ 52.0, 8520.83333333332 ], [ 53.0, 14638.500000000025 ], [ 54.0, 14161.833333333343 ], [ 55.0, 8232.583333333328 ], [ 56.0, 4588.666666666667 ], [ 57.0, 2843.5833333333335 ], [ 58.0, 252.75 ], [ 59.0, 31.0 ], [ 60.0, 17.833333333333336 ], [ 61.0, 8.75 ], [ 62.0, 7.25 ], [ 63.0, 12.75 ], [ 64.0, 7.25 ], [ 65.0, 2.333333333333333 ], [ 66.0, 3.1666666666666665 ], [ 67.0, 2.083333333333333 ], [ 68.0, 2.083333333333333 ], [ 69.0, 2.1666666666666665 ], [ 70.0, 1.75 ], [ 71.0, 1.0 ], [ 72.0, 1.25 ], [ 73.0, 0.5 ], [ 74.0, 0.5 ], [ 75.0, 0.8333333333333333 ], [ 76.0, 1.1666666666666665 ], [ 77.0, 1.4166666666666665 ], [ 78.0, 0.75 ], [ 79.0, 0.25 ], [ 80.0, 0.5 ], [ 81.0, 1.0833333333333333 ], [ 82.0, 1.5833333333333333 ], [ 83.0, 0.5833333333333333 ], [ 84.0, 0.8333333333333333 ], [ 85.0, 1.5833333333333333 ], [ 86.0, 1.25 ], [ 87.0, 1.0 ], [ 88.0, 1.25 ], [ 89.0, 1.0 ], [ 90.0, 0.75 ], [ 91.0, 0.75 ], [ 92.0, 1.0 ], [ 93.0, 0.25 ], [ 94.0, 1.0 ], [ 95.0, 1.0 ], [ 96.0, 1.5 ], [ 97.0, 2.75 ], [ 98.0, 3.75 ], [ 99.0, 5.333333333333333 ], [ 100.0, 26.66666666666664 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPFS1_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.75 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.25 ], [ 8.0, 0.0 ], [ 9.0, 0.25 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.5 ], [ 20.0, 0.25 ], [ 21.0, 0.25 ], [ 22.0, 0.75 ], [ 23.0, 1.0 ], [ 24.0, 0.75 ], [ 25.0, 0.0 ], [ 26.0, 0.5 ], [ 27.0, 0.5 ], [ 28.0, 1.5 ], [ 29.0, 2.25 ], [ 30.0, 1.0833333333333333 ], [ 31.0, 1.25 ], [ 32.0, 2.25 ], [ 33.0, 2.5 ], [ 34.0, 3.25 ], [ 35.0, 5.083333333333333 ], [ 36.0, 4.5 ], [ 37.0, 5.5 ], [ 38.0, 5.0 ], [ 39.0, 9.083333333333334 ], [ 40.0, 13.583333333333334 ], [ 41.0, 14.333333333333334 ], [ 42.0, 13.75 ], [ 43.0, 25.916666666666664 ], [ 44.0, 28.749999999999993 ], [ 45.0, 43.33333333333336 ], [ 46.0, 94.5833333333333 ], [ 47.0, 967.5000000000001 ], [ 48.0, 1319.9166666666665 ], [ 49.0, 247.25000000000009 ], [ 50.0, 122.16666666666659 ], [ 51.0, 324.4166666666665 ], [ 52.0, 2276.4166666666656 ], [ 53.0, 3050.083333333336 ], [ 54.0, 4586.916666666669 ], [ 55.0, 7029.499999999986 ], [ 56.0, 18646.083333333358 ], [ 57.0, 10388.416666666684 ], [ 58.0, 686.8333333333346 ], [ 59.0, 74.33333333333333 ], [ 60.0, 27.75 ], [ 61.0, 13.25 ], [ 62.0, 7.416666666666666 ], [ 63.0, 4.5 ], [ 64.0, 4.083333333333333 ], [ 65.0, 2.1666666666666665 ], [ 66.0, 2.0 ], [ 67.0, 2.333333333333333 ], [ 68.0, 2.083333333333333 ], [ 69.0, 1.25 ], [ 70.0, 1.25 ], [ 71.0, 2.5 ], [ 72.0, 1.5 ], [ 73.0, 1.25 ], [ 74.0, 1.0 ], [ 75.0, 2.0 ], [ 76.0, 1.75 ], [ 77.0, 1.5 ], [ 78.0, 1.25 ], [ 79.0, 1.0 ], [ 80.0, 1.0 ], [ 81.0, 1.25 ], [ 82.0, 1.5833333333333333 ], [ 83.0, 1.0 ], [ 84.0, 1.25 ], [ 85.0, 1.25 ], [ 86.0, 0.75 ], [ 87.0, 1.25 ], [ 88.0, 1.25 ], [ 89.0, 0.25 ], [ 90.0, 1.0833333333333333 ], [ 91.0, 2.416666666666667 ], [ 92.0, 2.0833333333333335 ], [ 93.0, 2.333333333333333 ], [ 94.0, 2.4166666666666665 ], [ 95.0, 1.3333333333333333 ], [ 96.0, 1.8333333333333333 ], [ 97.0, 3.3333333333333335 ], [ 98.0, 4.5 ], [ 99.0, 6.0 ], [ 100.0, 28.166666666666636 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPFS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.25 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.25 ], [ 8.0, 0.25 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.25 ], [ 17.0, 0.25 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.5 ], [ 21.0, 0.25 ], [ 22.0, 0.0 ], [ 23.0, 0.5 ], [ 24.0, 1.5 ], [ 25.0, 1.0 ], [ 26.0, 0.75 ], [ 27.0, 1.0833333333333333 ], [ 28.0, 0.75 ], [ 29.0, 0.75 ], [ 30.0, 1.75 ], [ 31.0, 2.75 ], [ 32.0, 2.25 ], [ 33.0, 2.0 ], [ 34.0, 2.0 ], [ 35.0, 3.5 ], [ 36.0, 3.25 ], [ 37.0, 7.75 ], [ 38.0, 10.833333333333334 ], [ 39.0, 13.5 ], [ 40.0, 17.25 ], [ 41.0, 23.666666666666664 ], [ 42.0, 24.333333333333332 ], [ 43.0, 27.666666666666668 ], [ 44.0, 36.66666666666667 ], [ 45.0, 40.083333333333336 ], [ 46.0, 54.58333333333334 ], [ 47.0, 136.3333333333333 ], [ 48.0, 751.7500000000005 ], [ 49.0, 1622.499999999999 ], [ 50.0, 1982.83333333333 ], [ 51.0, 2493.333333333335 ], [ 52.0, 8724.416666666655 ], [ 53.0, 15032.000000000036 ], [ 54.0, 14649.250000000018 ], [ 55.0, 7668.583333333327 ], [ 56.0, 3959.6666666666683 ], [ 57.0, 1941.3333333333328 ], [ 58.0, 240.16666666666669 ], [ 59.0, 43.666666666666664 ], [ 60.0, 17.833333333333336 ], [ 61.0, 9.083333333333334 ], [ 62.0, 6.083333333333333 ], [ 63.0, 9.5 ], [ 64.0, 7.25 ], [ 65.0, 3.0 ], [ 66.0, 1.8333333333333333 ], [ 67.0, 1.5833333333333333 ], [ 68.0, 2.5 ], [ 69.0, 1.75 ], [ 70.0, 0.75 ], [ 71.0, 1.0 ], [ 72.0, 1.5 ], [ 73.0, 1.0 ], [ 74.0, 1.25 ], [ 75.0, 1.5833333333333333 ], [ 76.0, 1.0 ], [ 77.0, 1.25 ], [ 78.0, 1.0 ], [ 79.0, 1.0833333333333333 ], [ 80.0, 0.3333333333333333 ], [ 81.0, 1.5 ], [ 82.0, 2.5 ], [ 83.0, 1.75 ], [ 84.0, 2.0 ], [ 85.0, 1.25 ], [ 86.0, 2.083333333333333 ], [ 87.0, 1.5 ], [ 88.0, 0.5 ], [ 89.0, 1.25 ], [ 90.0, 1.5 ], [ 91.0, 0.5 ], [ 92.0, 1.75 ], [ 93.0, 2.25 ], [ 94.0, 1.75 ], [ 95.0, 2.75 ], [ 96.0, 2.25 ], [ 97.0, 3.333333333333333 ], [ 98.0, 5.25 ], [ 99.0, 6.583333333333333 ], [ 100.0, 34.99999999999997 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPMS1_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.5 ], [ 3.0, 0.5 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.25 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.25 ], [ 12.0, 0.3333333333333333 ], [ 13.0, 0.25 ], [ 14.0, 0.25 ], [ 15.0, 0.25 ], [ 16.0, 0.5 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.25 ], [ 22.0, 0.5 ], [ 23.0, 0.5 ], [ 24.0, 0.5 ], [ 25.0, 1.0 ], [ 26.0, 1.75 ], [ 27.0, 1.25 ], [ 28.0, 1.25 ], [ 29.0, 0.5833333333333333 ], [ 30.0, 1.5 ], [ 31.0, 2.583333333333333 ], [ 32.0, 2.5833333333333335 ], [ 33.0, 2.5 ], [ 34.0, 2.583333333333333 ], [ 35.0, 5.833333333333333 ], [ 36.0, 9.5 ], [ 37.0, 12.083333333333332 ], [ 38.0, 16.5 ], [ 39.0, 22.333333333333332 ], [ 40.0, 19.083333333333336 ], [ 41.0, 26.5 ], [ 42.0, 28.5 ], [ 43.0, 33.58333333333333 ], [ 44.0, 33.83333333333333 ], [ 45.0, 38.58333333333333 ], [ 46.0, 54.33333333333333 ], [ 47.0, 153.49999999999997 ], [ 48.0, 880.9166666666674 ], [ 49.0, 2643.5000000000014 ], [ 50.0, 3142.0000000000045 ], [ 51.0, 3577.58333333334 ], [ 52.0, 11261.000000000022 ], [ 53.0, 17594.00000000003 ], [ 54.0, 18260.333333333343 ], [ 55.0, 10591.25 ], [ 56.0, 4411.666666666668 ], [ 57.0, 1990.2499999999998 ], [ 58.0, 222.16666666666666 ], [ 59.0, 31.333333333333332 ], [ 60.0, 13.916666666666668 ], [ 61.0, 9.166666666666666 ], [ 62.0, 6.749999999999999 ], [ 63.0, 10.75 ], [ 64.0, 6.5 ], [ 65.0, 3.5 ], [ 66.0, 2.083333333333333 ], [ 67.0, 2.583333333333333 ], [ 68.0, 3.5 ], [ 69.0, 1.75 ], [ 70.0, 1.5 ], [ 71.0, 2.333333333333333 ], [ 72.0, 1.0833333333333333 ], [ 73.0, 1.9166666666666665 ], [ 74.0, 1.75 ], [ 75.0, 1.0 ], [ 76.0, 1.0 ], [ 77.0, 1.0 ], [ 78.0, 1.25 ], [ 79.0, 1.0 ], [ 80.0, 1.25 ], [ 81.0, 1.25 ], [ 82.0, 1.8333333333333333 ], [ 83.0, 0.75 ], [ 84.0, 1.0 ], [ 85.0, 2.25 ], [ 86.0, 0.75 ], [ 87.0, 0.5 ], [ 88.0, 0.5 ], [ 89.0, 0.5 ], [ 90.0, 1.5833333333333333 ], [ 91.0, 2.0 ], [ 92.0, 1.75 ], [ 93.0, 2.0 ], [ 94.0, 0.75 ], [ 95.0, 2.0 ], [ 96.0, 1.3333333333333333 ], [ 97.0, 1.0833333333333333 ], [ 98.0, 4.083333333333334 ], [ 99.0, 5.25 ], [ 100.0, 52.33333333333343 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPMS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.25 ], [ 6.0, 0.0 ], [ 7.0, 0.5 ], [ 8.0, 0.5 ], [ 9.0, 0.5 ], [ 10.0, 0.25 ], [ 11.0, 0.0 ], [ 12.0, 0.25 ], [ 13.0, 0.25 ], [ 14.0, 0.0 ], [ 15.0, 0.25 ], [ 16.0, 0.0 ], [ 17.0, 0.5 ], [ 18.0, 0.5 ], [ 19.0, 0.75 ], [ 20.0, 0.25 ], [ 21.0, 0.25 ], [ 22.0, 0.5 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.5 ], [ 26.0, 0.5 ], [ 27.0, 0.75 ], [ 28.0, 0.75 ], [ 29.0, 1.25 ], [ 30.0, 0.75 ], [ 31.0, 1.5833333333333333 ], [ 32.0, 1.75 ], [ 33.0, 1.25 ], [ 34.0, 3.583333333333333 ], [ 35.0, 6.75 ], [ 36.0, 8.25 ], [ 37.0, 9.25 ], [ 38.0, 15.083333333333332 ], [ 39.0, 18.416666666666664 ], [ 40.0, 20.583333333333332 ], [ 41.0, 22.5 ], [ 42.0, 27.5 ], [ 43.0, 36.583333333333336 ], [ 44.0, 48.5 ], [ 45.0, 46.75 ], [ 46.0, 62.75 ], [ 47.0, 188.50000000000006 ], [ 48.0, 986.4166666666672 ], [ 49.0, 2849.5000000000005 ], [ 50.0, 3327.5833333333367 ], [ 51.0, 4103.750000000007 ], [ 52.0, 11323.08333333335 ], [ 53.0, 15092.500000000025 ], [ 54.0, 14182.500000000013 ], [ 55.0, 9151.499999999996 ], [ 56.0, 4273.5 ], [ 57.0, 1771.5833333333333 ], [ 58.0, 233.91666666666666 ], [ 59.0, 42.00000000000001 ], [ 60.0, 23.5 ], [ 61.0, 11.916666666666666 ], [ 62.0, 7.916666666666666 ], [ 63.0, 15.25 ], [ 64.0, 8.25 ], [ 65.0, 4.75 ], [ 66.0, 3.75 ], [ 67.0, 2.083333333333333 ], [ 68.0, 1.25 ], [ 69.0, 2.25 ], [ 70.0, 2.75 ], [ 71.0, 1.5 ], [ 72.0, 2.25 ], [ 73.0, 1.5 ], [ 74.0, 0.75 ], [ 75.0, 1.5 ], [ 76.0, 1.25 ], [ 77.0, 1.25 ], [ 78.0, 1.5 ], [ 79.0, 0.5 ], [ 80.0, 1.0 ], [ 81.0, 1.75 ], [ 82.0, 1.5 ], [ 83.0, 1.25 ], [ 84.0, 1.0 ], [ 85.0, 0.0 ], [ 86.0, 1.75 ], [ 87.0, 1.3333333333333333 ], [ 88.0, 1.5 ], [ 89.0, 0.5 ], [ 90.0, 1.25 ], [ 91.0, 1.75 ], [ 92.0, 1.5 ], [ 93.0, 1.0 ], [ 94.0, 2.5833333333333335 ], [ 95.0, 2.0 ], [ 96.0, 3.5 ], [ 97.0, 4.75 ], [ 98.0, 8.333333333333332 ], [ 99.0, 7.333333333333334 ], [ 100.0, 37.49999999999999 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVFS1_R2", "pairs": [ [ 0.0, 1.0 ], [ 1.0, 0.5 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.25 ], [ 7.0, 0.0 ], [ 8.0, 0.25 ], [ 9.0, 0.25 ], [ 10.0, 0.25 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.25 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.25 ], [ 19.0, 0.25 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.5 ], [ 23.0, 0.25 ], [ 24.0, 0.0 ], [ 25.0, 0.25 ], [ 26.0, 0.5 ], [ 27.0, 0.75 ], [ 28.0, 1.75 ], [ 29.0, 1.75 ], [ 30.0, 1.0 ], [ 31.0, 1.0 ], [ 32.0, 2.5 ], [ 33.0, 3.0 ], [ 34.0, 2.25 ], [ 35.0, 2.75 ], [ 36.0, 6.75 ], [ 37.0, 11.25 ], [ 38.0, 16.75 ], [ 39.0, 18.5 ], [ 40.0, 19.0 ], [ 41.0, 22.75 ], [ 42.0, 26.0 ], [ 43.0, 35.0 ], [ 44.0, 35.166666666666664 ], [ 45.0, 53.25000000000001 ], [ 46.0, 59.75000000000001 ], [ 47.0, 173.1666666666667 ], [ 48.0, 877.0000000000008 ], [ 49.0, 2377.583333333334 ], [ 50.0, 3090.0833333333358 ], [ 51.0, 4182.916666666675 ], [ 52.0, 11713.250000000022 ], [ 53.0, 19719.666666666657 ], [ 54.0, 17214.41666666667 ], [ 55.0, 8818.499999999995 ], [ 56.0, 3166.5000000000005 ], [ 57.0, 1276.75 ], [ 58.0, 154.58333333333331 ], [ 59.0, 35.083333333333336 ], [ 60.0, 17.083333333333332 ], [ 61.0, 9.0 ], [ 62.0, 7.0 ], [ 63.0, 13.25 ], [ 64.0, 4.75 ], [ 65.0, 3.4166666666666665 ], [ 66.0, 0.75 ], [ 67.0, 1.9166666666666665 ], [ 68.0, 0.5 ], [ 69.0, 0.75 ], [ 70.0, 0.75 ], [ 71.0, 1.25 ], [ 72.0, 1.0 ], [ 73.0, 1.0 ], [ 74.0, 0.5 ], [ 75.0, 1.0 ], [ 76.0, 1.5 ], [ 77.0, 1.0 ], [ 78.0, 2.0 ], [ 79.0, 1.75 ], [ 80.0, 0.75 ], [ 81.0, 1.75 ], [ 82.0, 1.3333333333333333 ], [ 83.0, 1.5 ], [ 84.0, 1.25 ], [ 85.0, 0.75 ], [ 86.0, 1.0 ], [ 87.0, 0.25 ], [ 88.0, 0.5 ], [ 89.0, 0.5 ], [ 90.0, 1.0 ], [ 91.0, 1.5 ], [ 92.0, 2.083333333333333 ], [ 93.0, 0.0 ], [ 94.0, 1.0 ], [ 95.0, 2.75 ], [ 96.0, 5.0 ], [ 97.0, 3.75 ], [ 98.0, 4.0 ], [ 99.0, 7.75 ], [ 100.0, 34.99999999999998 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVFS2_R2", "pairs": [ [ 0.0, 0.5 ], [ 1.0, 0.5 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.25 ], [ 6.0, 0.25 ], [ 7.0, 0.25 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.25 ], [ 12.0, 0.25 ], [ 13.0, 0.0 ], [ 14.0, 0.5 ], [ 15.0, 0.0 ], [ 16.0, 0.25 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.5 ], [ 21.0, 0.25 ], [ 22.0, 0.25 ], [ 23.0, 0.25 ], [ 24.0, 0.25 ], [ 25.0, 1.5833333333333333 ], [ 26.0, 1.3333333333333333 ], [ 27.0, 1.0 ], [ 28.0, 1.5 ], [ 29.0, 2.25 ], [ 30.0, 2.5 ], [ 31.0, 3.583333333333333 ], [ 32.0, 3.083333333333333 ], [ 33.0, 3.4166666666666665 ], [ 34.0, 3.75 ], [ 35.0, 4.25 ], [ 36.0, 8.0 ], [ 37.0, 13.583333333333332 ], [ 38.0, 14.5 ], [ 39.0, 20.75 ], [ 40.0, 21.75 ], [ 41.0, 25.75 ], [ 42.0, 28.083333333333332 ], [ 43.0, 34.666666666666664 ], [ 44.0, 34.75000000000001 ], [ 45.0, 46.583333333333336 ], [ 46.0, 59.16666666666668 ], [ 47.0, 184.25000000000006 ], [ 48.0, 970.5000000000005 ], [ 49.0, 2775.9166666666674 ], [ 50.0, 3495.5833333333358 ], [ 51.0, 3648.583333333338 ], [ 52.0, 10435.500000000005 ], [ 53.0, 18179.75000000001 ], [ 54.0, 15724.500000000016 ], [ 55.0, 8082.583333333329 ], [ 56.0, 3319.166666666668 ], [ 57.0, 1506.4999999999998 ], [ 58.0, 169.41666666666666 ], [ 59.0, 26.25 ], [ 60.0, 14.25 ], [ 61.0, 7.0 ], [ 62.0, 6.75 ], [ 63.0, 9.25 ], [ 64.0, 5.5 ], [ 65.0, 3.5 ], [ 66.0, 2.333333333333333 ], [ 67.0, 1.5833333333333333 ], [ 68.0, 1.25 ], [ 69.0, 1.8333333333333333 ], [ 70.0, 0.5 ], [ 71.0, 2.0833333333333335 ], [ 72.0, 1.25 ], [ 73.0, 1.25 ], [ 74.0, 1.5 ], [ 75.0, 1.5 ], [ 76.0, 2.0 ], [ 77.0, 2.0 ], [ 78.0, 1.0 ], [ 79.0, 2.5 ], [ 80.0, 2.25 ], [ 81.0, 1.25 ], [ 82.0, 1.5 ], [ 83.0, 1.8333333333333333 ], [ 84.0, 1.5833333333333333 ], [ 85.0, 1.0833333333333333 ], [ 86.0, 0.5 ], [ 87.0, 0.3333333333333333 ], [ 88.0, 0.75 ], [ 89.0, 1.75 ], [ 90.0, 1.5 ], [ 91.0, 1.5833333333333333 ], [ 92.0, 0.75 ], [ 93.0, 1.8333333333333333 ], [ 94.0, 2.833333333333333 ], [ 95.0, 2.083333333333333 ], [ 96.0, 3.0 ], [ 97.0, 4.083333333333334 ], [ 98.0, 4.583333333333334 ], [ 99.0, 6.0 ], [ 100.0, 32.66666666666662 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVMS1_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.25 ], [ 4.0, 0.25 ], [ 5.0, 0.25 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.25 ], [ 9.0, 0.25 ], [ 10.0, 0.25 ], [ 11.0, 0.5 ], [ 12.0, 0.25 ], [ 13.0, 0.25 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.25 ], [ 17.0, 0.25 ], [ 18.0, 0.0 ], [ 19.0, 0.25 ], [ 20.0, 0.25 ], [ 21.0, 0.5 ], [ 22.0, 0.25 ], [ 23.0, 0.75 ], [ 24.0, 0.5 ], [ 25.0, 1.25 ], [ 26.0, 1.25 ], [ 27.0, 0.75 ], [ 28.0, 0.75 ], [ 29.0, 1.5 ], [ 30.0, 1.75 ], [ 31.0, 2.5 ], [ 32.0, 3.75 ], [ 33.0, 4.5 ], [ 34.0, 3.583333333333333 ], [ 35.0, 3.5 ], [ 36.0, 4.75 ], [ 37.0, 8.25 ], [ 38.0, 10.0 ], [ 39.0, 13.75 ], [ 40.0, 18.25 ], [ 41.0, 23.083333333333336 ], [ 42.0, 31.583333333333336 ], [ 43.0, 40.166666666666664 ], [ 44.0, 40.58333333333333 ], [ 45.0, 49.50000000000001 ], [ 46.0, 67.16666666666669 ], [ 47.0, 237.3333333333335 ], [ 48.0, 1326.2499999999995 ], [ 49.0, 6787.999999999998 ], [ 50.0, 8117.416666666663 ], [ 51.0, 2780.5833333333344 ], [ 52.0, 6324.499999999996 ], [ 53.0, 11184.08333333334 ], [ 54.0, 12818.750000000005 ], [ 55.0, 7867.58333333333 ], [ 56.0, 2548.583333333333 ], [ 57.0, 825.5833333333335 ], [ 58.0, 95.58333333333334 ], [ 59.0, 25.583333333333332 ], [ 60.0, 11.5 ], [ 61.0, 6.25 ], [ 62.0, 3.75 ], [ 63.0, 4.5 ], [ 64.0, 1.75 ], [ 65.0, 1.8333333333333333 ], [ 66.0, 2.083333333333333 ], [ 67.0, 1.3333333333333333 ], [ 68.0, 1.5 ], [ 69.0, 1.75 ], [ 70.0, 0.75 ], [ 71.0, 1.25 ], [ 72.0, 1.0 ], [ 73.0, 0.75 ], [ 74.0, 1.5 ], [ 75.0, 0.75 ], [ 76.0, 1.5 ], [ 77.0, 1.5833333333333333 ], [ 78.0, 1.3333333333333333 ], [ 79.0, 0.75 ], [ 80.0, 1.0 ], [ 81.0, 1.25 ], [ 82.0, 1.5 ], [ 83.0, 2.833333333333333 ], [ 84.0, 0.75 ], [ 85.0, 0.75 ], [ 86.0, 1.75 ], [ 87.0, 1.5 ], [ 88.0, 1.75 ], [ 89.0, 1.5 ], [ 90.0, 1.0 ], [ 91.0, 0.25 ], [ 92.0, 1.0 ], [ 93.0, 2.25 ], [ 94.0, 2.25 ], [ 95.0, 2.4166666666666665 ], [ 96.0, 1.5833333333333333 ], [ 97.0, 2.833333333333333 ], [ 98.0, 3.5 ], [ 99.0, 7.75 ], [ 100.0, 32.83333333333329 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVMS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.5 ], [ 4.0, 0.25 ], [ 5.0, 0.5 ], [ 6.0, 0.5 ], [ 7.0, 0.25 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.25 ], [ 13.0, 0.25 ], [ 14.0, 0.0 ], [ 15.0, 0.5 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.25 ], [ 20.0, 0.0 ], [ 21.0, 0.25 ], [ 22.0, 0.5 ], [ 23.0, 0.25 ], [ 24.0, 0.25 ], [ 25.0, 0.8333333333333333 ], [ 26.0, 0.3333333333333333 ], [ 27.0, 0.75 ], [ 28.0, 0.75 ], [ 29.0, 2.25 ], [ 30.0, 2.0 ], [ 31.0, 1.25 ], [ 32.0, 3.5833333333333335 ], [ 33.0, 4.333333333333334 ], [ 34.0, 4.5 ], [ 35.0, 6.583333333333334 ], [ 36.0, 10.833333333333334 ], [ 37.0, 14.833333333333332 ], [ 38.0, 22.333333333333332 ], [ 39.0, 24.416666666666664 ], [ 40.0, 28.5 ], [ 41.0, 31.416666666666664 ], [ 42.0, 33.58333333333333 ], [ 43.0, 41.5 ], [ 44.0, 43.083333333333336 ], [ 45.0, 61.91666666666667 ], [ 46.0, 78.33333333333333 ], [ 47.0, 257.58333333333366 ], [ 48.0, 1520.9999999999984 ], [ 49.0, 7694.833333333329 ], [ 50.0, 9181.249999999995 ], [ 51.0, 3431.5833333333385 ], [ 52.0, 7787.166666666654 ], [ 53.0, 13859.416666666695 ], [ 54.0, 16865.25000000002 ], [ 55.0, 10516.166666666668 ], [ 56.0, 3350.083333333334 ], [ 57.0, 1130.6666666666667 ], [ 58.0, 120.66666666666667 ], [ 59.0, 26.166666666666668 ], [ 60.0, 15.75 ], [ 61.0, 10.0 ], [ 62.0, 7.499999999999999 ], [ 63.0, 9.083333333333332 ], [ 64.0, 4.5 ], [ 65.0, 3.3333333333333335 ], [ 66.0, 2.75 ], [ 67.0, 1.75 ], [ 68.0, 1.6666666666666665 ], [ 69.0, 2.0 ], [ 70.0, 2.0 ], [ 71.0, 2.75 ], [ 72.0, 1.0 ], [ 73.0, 1.75 ], [ 74.0, 0.75 ], [ 75.0, 2.0 ], [ 76.0, 1.0 ], [ 77.0, 1.5 ], [ 78.0, 1.5 ], [ 79.0, 0.75 ], [ 80.0, 0.5 ], [ 81.0, 1.0833333333333333 ], [ 82.0, 1.0 ], [ 83.0, 1.75 ], [ 84.0, 2.083333333333333 ], [ 85.0, 1.3333333333333333 ], [ 86.0, 2.25 ], [ 87.0, 0.8333333333333333 ], [ 88.0, 0.5 ], [ 89.0, 1.5833333333333333 ], [ 90.0, 1.9166666666666665 ], [ 91.0, 1.8333333333333333 ], [ 92.0, 1.3333333333333333 ], [ 93.0, 0.75 ], [ 94.0, 1.0833333333333333 ], [ 95.0, 2.0 ], [ 96.0, 3.0833333333333335 ], [ 97.0, 6.25 ], [ 98.0, 4.25 ], [ 99.0, 9.5 ], [ 100.0, 48.00000000000006 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAFS1_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.5 ], [ 37.0, 1.5 ], [ 38.0, 0.75 ], [ 39.0, 2.25 ], [ 40.0, 3.1666666666666665 ], [ 41.0, 3.083333333333333 ], [ 42.0, 9.166666666666664 ], [ 43.0, 90.66666666666647 ], [ 44.0, 98.33333333333304 ], [ 45.0, 15.000000000000005 ], [ 46.0, 10.25 ], [ 47.0, 35.25 ], [ 48.0, 155.50000000000003 ], [ 49.0, 261.33333333333337 ], [ 50.0, 295.1666666666668 ], [ 51.0, 540.2499999999997 ], [ 52.0, 3006.0000000000014 ], [ 53.0, 3445.416666666668 ], [ 54.0, 2674.916666666667 ], [ 55.0, 2851.0833333333335 ], [ 56.0, 11652.500000000005 ], [ 57.0, 4107.833333333338 ], [ 58.0, 143.66666666666666 ], [ 59.0, 36.83333333333333 ], [ 60.0, 20.75 ], [ 61.0, 11.75 ], [ 62.0, 7.583333333333334 ], [ 63.0, 14.5 ], [ 64.0, 7.25 ], [ 65.0, 5.583333333333333 ], [ 66.0, 4.916666666666666 ], [ 67.0, 3.9166666666666665 ], [ 68.0, 3.333333333333333 ], [ 69.0, 3.8333333333333335 ], [ 70.0, 3.5 ], [ 71.0, 2.583333333333333 ], [ 72.0, 3.333333333333333 ], [ 73.0, 1.75 ], [ 74.0, 1.0 ], [ 75.0, 1.9166666666666665 ], [ 76.0, 2.9166666666666665 ], [ 77.0, 1.8333333333333333 ], [ 78.0, 2.25 ], [ 79.0, 1.75 ], [ 80.0, 1.5 ], [ 81.0, 0.75 ], [ 82.0, 0.8333333333333333 ], [ 83.0, 0.0 ], [ 84.0, 1.9166666666666665 ], [ 85.0, 0.75 ], [ 86.0, 0.5 ], [ 87.0, 0.5 ], [ 88.0, 0.25 ], [ 89.0, 1.0 ], [ 90.0, 1.75 ], [ 91.0, 0.75 ], [ 92.0, 0.5 ], [ 93.0, 0.25 ], [ 94.0, 0.75 ], [ 95.0, 1.5 ], [ 96.0, 1.0833333333333333 ], [ 97.0, 0.8333333333333333 ], [ 98.0, 0.5 ], [ 99.0, 4.25 ], [ 100.0, 8.666666666666664 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAFS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.3333333333333333 ], [ 39.0, 0.3333333333333333 ], [ 40.0, 0.0 ], [ 41.0, 2.0 ], [ 42.0, 3.6666666666666665 ], [ 43.0, 28.999999999999964 ], [ 44.0, 38.166666666666664 ], [ 45.0, 7.249999999999999 ], [ 46.0, 4.333333333333333 ], [ 47.0, 14.083333333333332 ], [ 48.0, 69.16666666666667 ], [ 49.0, 165.08333333333334 ], [ 50.0, 234.25000000000006 ], [ 51.0, 344.49999999999994 ], [ 52.0, 1186.0 ], [ 53.0, 1337.9166666666665 ], [ 54.0, 1608.1666666666663 ], [ 55.0, 1826.416666666666 ], [ 56.0, 4019.6666666666692 ], [ 57.0, 1355.5833333333333 ], [ 58.0, 51.333333333333336 ], [ 59.0, 14.5 ], [ 60.0, 14.583333333333334 ], [ 61.0, 5.25 ], [ 62.0, 2.0 ], [ 63.0, 6.333333333333334 ], [ 64.0, 4.0 ], [ 65.0, 3.9166666666666665 ], [ 66.0, 2.9166666666666665 ], [ 67.0, 1.5 ], [ 68.0, 1.25 ], [ 69.0, 2.0 ], [ 70.0, 0.5 ], [ 71.0, 1.25 ], [ 72.0, 0.75 ], [ 73.0, 1.0 ], [ 74.0, 0.25 ], [ 75.0, 0.5 ], [ 76.0, 0.5 ], [ 77.0, 0.75 ], [ 78.0, 0.25 ], [ 79.0, 0.0 ], [ 80.0, 0.5 ], [ 81.0, 0.5 ], [ 82.0, 0.75 ], [ 83.0, 0.25 ], [ 84.0, 0.5 ], [ 85.0, 0.25 ], [ 86.0, 0.25 ], [ 87.0, 0.25 ], [ 88.0, 0.75 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.5 ], [ 93.0, 0.5 ], [ 94.0, 0.0 ], [ 95.0, 0.25 ], [ 96.0, 0.75 ], [ 97.0, 0.25 ], [ 98.0, 0.75 ], [ 99.0, 2.75 ], [ 100.0, 3.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAMS1_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.25 ], [ 36.0, 0.5833333333333333 ], [ 37.0, 0.6666666666666666 ], [ 38.0, 0.5 ], [ 39.0, 1.3333333333333333 ], [ 40.0, 0.8333333333333333 ], [ 41.0, 1.75 ], [ 42.0, 6.333333333333332 ], [ 43.0, 128.9999999999993 ], [ 44.0, 154.33333333333334 ], [ 45.0, 23.91666666666665 ], [ 46.0, 7.083333333333332 ], [ 47.0, 8.416666666666666 ], [ 48.0, 55.666666666666664 ], [ 49.0, 184.41666666666669 ], [ 50.0, 190.33333333333334 ], [ 51.0, 1103.4166666666667 ], [ 52.0, 11678.250000000007 ], [ 53.0, 4752.833333333334 ], [ 54.0, 910.0000000000001 ], [ 55.0, 776.1666666666667 ], [ 56.0, 535.3333333333333 ], [ 57.0, 152.25 ], [ 58.0, 25.0 ], [ 59.0, 17.583333333333332 ], [ 60.0, 19.166666666666664 ], [ 61.0, 8.833333333333332 ], [ 62.0, 4.083333333333334 ], [ 63.0, 4.833333333333333 ], [ 64.0, 3.25 ], [ 65.0, 3.75 ], [ 66.0, 2.25 ], [ 67.0, 2.5 ], [ 68.0, 25.75 ], [ 69.0, 37.25 ], [ 70.0, 3.0 ], [ 71.0, 1.5 ], [ 72.0, 1.75 ], [ 73.0, 1.8333333333333333 ], [ 74.0, 1.0 ], [ 75.0, 1.8333333333333333 ], [ 76.0, 2.0 ], [ 77.0, 0.8333333333333333 ], [ 78.0, 0.75 ], [ 79.0, 0.75 ], [ 80.0, 0.5 ], [ 81.0, 0.75 ], [ 82.0, 0.8333333333333333 ], [ 83.0, 0.8333333333333333 ], [ 84.0, 0.5 ], [ 85.0, 1.0 ], [ 86.0, 1.25 ], [ 87.0, 0.0 ], [ 88.0, 1.0 ], [ 89.0, 0.75 ], [ 90.0, 0.75 ], [ 91.0, 0.0 ], [ 92.0, 0.75 ], [ 93.0, 0.5 ], [ 94.0, 1.0 ], [ 95.0, 1.0 ], [ 96.0, 0.25 ], [ 97.0, 0.25 ], [ 98.0, 1.0 ], [ 99.0, 4.083333333333334 ], [ 100.0, 4.999999999999999 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAMS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.25 ], [ 34.0, 0.5 ], [ 35.0, 0.5 ], [ 36.0, 2.4166666666666665 ], [ 37.0, 2.0 ], [ 38.0, 2.333333333333333 ], [ 39.0, 3.0 ], [ 40.0, 1.583333333333333 ], [ 41.0, 0.8333333333333333 ], [ 42.0, 9.583333333333334 ], [ 43.0, 156.75000000000009 ], [ 44.0, 170.5833333333338 ], [ 45.0, 26.666666666666643 ], [ 46.0, 6.249999999999999 ], [ 47.0, 8.75 ], [ 48.0, 18.749999999999996 ], [ 49.0, 36.5 ], [ 50.0, 87.99999999999997 ], [ 51.0, 1367.8333333333323 ], [ 52.0, 16541.583333333358 ], [ 53.0, 6596.999999999998 ], [ 54.0, 562.4166666666666 ], [ 55.0, 319.83333333333337 ], [ 56.0, 266.0833333333333 ], [ 57.0, 170.08333333333331 ], [ 58.0, 41.58333333333333 ], [ 59.0, 12.083333333333334 ], [ 60.0, 9.083333333333334 ], [ 61.0, 6.833333333333333 ], [ 62.0, 6.0 ], [ 63.0, 7.5 ], [ 64.0, 4.75 ], [ 65.0, 3.25 ], [ 66.0, 6.0 ], [ 67.0, 4.0 ], [ 68.0, 3.25 ], [ 69.0, 1.0 ], [ 70.0, 3.333333333333333 ], [ 71.0, 1.25 ], [ 72.0, 0.25 ], [ 73.0, 0.75 ], [ 74.0, 2.5 ], [ 75.0, 2.3333333333333335 ], [ 76.0, 0.5 ], [ 77.0, 1.25 ], [ 78.0, 2.083333333333333 ], [ 79.0, 0.75 ], [ 80.0, 0.75 ], [ 81.0, 0.75 ], [ 82.0, 1.25 ], [ 83.0, 0.5 ], [ 84.0, 0.25 ], [ 85.0, 1.5 ], [ 86.0, 0.5 ], [ 87.0, 0.5 ], [ 88.0, 0.3333333333333333 ], [ 89.0, 0.8333333333333333 ], [ 90.0, 0.5833333333333333 ], [ 91.0, 0.25 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.75 ], [ 95.0, 0.5 ], [ 96.0, 0.25 ], [ 97.0, 0.0 ], [ 98.0, 1.0 ], [ 99.0, 5.5 ], [ 100.0, 7.33333333333333 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCFS1_R2", "pairs": [ [ 0.0, 3.0 ], [ 1.0, 1.5 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.25 ], [ 14.0, 0.25 ], [ 15.0, 0.25 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.25 ], [ 19.0, 0.25 ], [ 20.0, 0.25 ], [ 21.0, 0.0 ], [ 22.0, 0.25 ], [ 23.0, 0.25 ], [ 24.0, 0.5 ], [ 25.0, 0.0 ], [ 26.0, 0.25 ], [ 27.0, 0.75 ], [ 28.0, 1.3333333333333333 ], [ 29.0, 1.75 ], [ 30.0, 1.75 ], [ 31.0, 3.5833333333333335 ], [ 32.0, 5.666666666666666 ], [ 33.0, 3.75 ], [ 34.0, 6.333333333333333 ], [ 35.0, 10.250000000000002 ], [ 36.0, 10.416666666666668 ], [ 37.0, 11.333333333333334 ], [ 38.0, 15.25 ], [ 39.0, 23.166666666666657 ], [ 40.0, 30.83333333333333 ], [ 41.0, 39.00000000000001 ], [ 42.0, 57.66666666666669 ], [ 43.0, 333.41666666666526 ], [ 44.0, 410.33333333332826 ], [ 45.0, 148.58333333333331 ], [ 46.0, 83.49999999999997 ], [ 47.0, 60.750000000000014 ], [ 48.0, 100.33333333333326 ], [ 49.0, 147.49999999999997 ], [ 50.0, 247.58333333333343 ], [ 51.0, 1239.333333333332 ], [ 52.0, 11796.91666666669 ], [ 53.0, 14969.333333333345 ], [ 54.0, 5750.916666666662 ], [ 55.0, 4122.000000000003 ], [ 56.0, 961.0000000000007 ], [ 57.0, 256.2500000000001 ], [ 58.0, 52.666666666666664 ], [ 59.0, 23.75 ], [ 60.0, 17.0 ], [ 61.0, 9.75 ], [ 62.0, 8.666666666666668 ], [ 63.0, 9.750000000000002 ], [ 64.0, 14.583333333333336 ], [ 65.0, 13.416666666666668 ], [ 66.0, 6.333333333333334 ], [ 67.0, 1.8333333333333333 ], [ 68.0, 1.8333333333333333 ], [ 69.0, 1.25 ], [ 70.0, 0.5 ], [ 71.0, 0.25 ], [ 72.0, 1.25 ], [ 73.0, 1.25 ], [ 74.0, 1.0833333333333333 ], [ 75.0, 1.0 ], [ 76.0, 0.25 ], [ 77.0, 0.5 ], [ 78.0, 0.5833333333333333 ], [ 79.0, 0.3333333333333333 ], [ 80.0, 0.8333333333333333 ], [ 81.0, 1.5 ], [ 82.0, 1.0 ], [ 83.0, 0.5 ], [ 84.0, 1.0 ], [ 85.0, 0.25 ], [ 86.0, 0.5 ], [ 87.0, 0.75 ], [ 88.0, 1.0 ], [ 89.0, 1.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.25 ], [ 93.0, 0.5 ], [ 94.0, 0.5 ], [ 95.0, 1.0 ], [ 96.0, 1.75 ], [ 97.0, 1.0 ], [ 98.0, 2.5 ], [ 99.0, 2.75 ], [ 100.0, 22.999999999999986 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCFS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.25 ], [ 9.0, 0.25 ], [ 10.0, 0.25 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.25 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.9166666666666665 ], [ 20.0, 0.6666666666666666 ], [ 21.0, 0.25 ], [ 22.0, 0.0 ], [ 23.0, 0.25 ], [ 24.0, 0.25 ], [ 25.0, 0.0 ], [ 26.0, 0.5 ], [ 27.0, 0.25 ], [ 28.0, 0.5 ], [ 29.0, 1.0 ], [ 30.0, 0.5 ], [ 31.0, 2.25 ], [ 32.0, 3.0 ], [ 33.0, 2.583333333333333 ], [ 34.0, 3.25 ], [ 35.0, 3.1666666666666665 ], [ 36.0, 5.083333333333334 ], [ 37.0, 10.5 ], [ 38.0, 13.25 ], [ 39.0, 27.91666666666665 ], [ 40.0, 31.249999999999993 ], [ 41.0, 38.50000000000001 ], [ 42.0, 76.66666666666663 ], [ 43.0, 640.8333333333362 ], [ 44.0, 775.8333333333487 ], [ 45.0, 213.3333333333343 ], [ 46.0, 110.9999999999999 ], [ 47.0, 56.75000000000003 ], [ 48.0, 73.91666666666669 ], [ 49.0, 106.58333333333327 ], [ 50.0, 158.75000000000003 ], [ 51.0, 650.5000000000008 ], [ 52.0, 6118.083333333322 ], [ 53.0, 9169.999999999996 ], [ 54.0, 3256.500000000004 ], [ 55.0, 2110.8333333333317 ], [ 56.0, 488.6666666666664 ], [ 57.0, 127.08333333333333 ], [ 58.0, 42.083333333333336 ], [ 59.0, 29.583333333333332 ], [ 60.0, 23.916666666666668 ], [ 61.0, 18.333333333333336 ], [ 62.0, 7.916666666666666 ], [ 63.0, 11.750000000000002 ], [ 64.0, 19.916666666666668 ], [ 65.0, 16.25 ], [ 66.0, 7.333333333333334 ], [ 67.0, 1.5 ], [ 68.0, 1.5 ], [ 69.0, 2.0 ], [ 70.0, 1.25 ], [ 71.0, 0.25 ], [ 72.0, 0.75 ], [ 73.0, 1.5 ], [ 74.0, 1.25 ], [ 75.0, 0.75 ], [ 76.0, 0.5 ], [ 77.0, 0.0 ], [ 78.0, 1.3333333333333333 ], [ 79.0, 1.0833333333333333 ], [ 80.0, 0.5 ], [ 81.0, 0.5 ], [ 82.0, 0.5 ], [ 83.0, 0.5 ], [ 84.0, 0.5 ], [ 85.0, 0.25 ], [ 86.0, 0.75 ], [ 87.0, 1.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 1.0 ], [ 91.0, 1.5833333333333333 ], [ 92.0, 1.8333333333333333 ], [ 93.0, 0.0 ], [ 94.0, 0.25 ], [ 95.0, 1.5 ], [ 96.0, 1.0 ], [ 97.0, 1.75 ], [ 98.0, 2.0 ], [ 99.0, 1.5 ], [ 100.0, 12.333333333333337 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCMS1_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.25 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.25 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.75 ], [ 11.0, 0.25 ], [ 12.0, 0.25 ], [ 13.0, 0.25 ], [ 14.0, 0.25 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.25 ], [ 18.0, 0.25 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.5 ], [ 22.0, 0.0 ], [ 23.0, 0.75 ], [ 24.0, 1.0833333333333333 ], [ 25.0, 0.75 ], [ 26.0, 1.0 ], [ 27.0, 1.5 ], [ 28.0, 2.0 ], [ 29.0, 2.583333333333333 ], [ 30.0, 3.333333333333333 ], [ 31.0, 2.5 ], [ 32.0, 4.0 ], [ 33.0, 5.083333333333333 ], [ 34.0, 7.333333333333333 ], [ 35.0, 11.833333333333332 ], [ 36.0, 14.75 ], [ 37.0, 14.0 ], [ 38.0, 18.333333333333336 ], [ 39.0, 26.0 ], [ 40.0, 29.833333333333332 ], [ 41.0, 41.75000000000001 ], [ 42.0, 64.33333333333336 ], [ 43.0, 289.3333333333338 ], [ 44.0, 351.49999999999727 ], [ 45.0, 126.24999999999976 ], [ 46.0, 86.5 ], [ 47.0, 111.33333333333333 ], [ 48.0, 191.25000000000006 ], [ 49.0, 361.4166666666665 ], [ 50.0, 607.0 ], [ 51.0, 2433.666666666671 ], [ 52.0, 21622.66666666661 ], [ 53.0, 26506.333333333285 ], [ 54.0, 13805.250000000036 ], [ 55.0, 10832.833333333336 ], [ 56.0, 1979.9166666666654 ], [ 57.0, 527.7499999999999 ], [ 58.0, 107.74999999999994 ], [ 59.0, 48.58333333333334 ], [ 60.0, 36.083333333333336 ], [ 61.0, 18.416666666666664 ], [ 62.0, 9.083333333333334 ], [ 63.0, 14.0 ], [ 64.0, 11.5 ], [ 65.0, 6.75 ], [ 66.0, 4.0 ], [ 67.0, 3.6666666666666665 ], [ 68.0, 2.0 ], [ 69.0, 2.75 ], [ 70.0, 1.5 ], [ 71.0, 0.75 ], [ 72.0, 2.75 ], [ 73.0, 3.75 ], [ 74.0, 1.75 ], [ 75.0, 2.5 ], [ 76.0, 0.75 ], [ 77.0, 1.75 ], [ 78.0, 1.75 ], [ 79.0, 1.0 ], [ 80.0, 0.5 ], [ 81.0, 1.75 ], [ 82.0, 3.0 ], [ 83.0, 2.0 ], [ 84.0, 1.3333333333333333 ], [ 85.0, 2.3333333333333335 ], [ 86.0, 2.0 ], [ 87.0, 1.25 ], [ 88.0, 2.5 ], [ 89.0, 1.75 ], [ 90.0, 0.5 ], [ 91.0, 1.25 ], [ 92.0, 1.25 ], [ 93.0, 2.0 ], [ 94.0, 1.0 ], [ 95.0, 2.25 ], [ 96.0, 2.5833333333333335 ], [ 97.0, 4.083333333333333 ], [ 98.0, 6.75 ], [ 99.0, 8.916666666666668 ], [ 100.0, 41.16666666666668 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCMS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.25 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.25 ], [ 7.0, 0.25 ], [ 8.0, 0.25 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.5 ], [ 16.0, 0.25 ], [ 17.0, 0.75 ], [ 18.0, 0.5 ], [ 19.0, 0.25 ], [ 20.0, 0.25 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.25 ], [ 26.0, 0.25 ], [ 27.0, 0.5 ], [ 28.0, 0.5 ], [ 29.0, 0.25 ], [ 30.0, 1.0 ], [ 31.0, 0.5 ], [ 32.0, 3.8333333333333335 ], [ 33.0, 5.083333333333333 ], [ 34.0, 5.583333333333332 ], [ 35.0, 4.166666666666666 ], [ 36.0, 9.083333333333334 ], [ 37.0, 17.583333333333332 ], [ 38.0, 22.666666666666664 ], [ 39.0, 28.58333333333333 ], [ 40.0, 33.166666666666664 ], [ 41.0, 58.00000000000004 ], [ 42.0, 110.16666666666647 ], [ 43.0, 802.0833333333527 ], [ 44.0, 958.1666666667022 ], [ 45.0, 214.0000000000009 ], [ 46.0, 109.33333333333326 ], [ 47.0, 87.9166666666666 ], [ 48.0, 141.83333333333331 ], [ 49.0, 215.58333333333337 ], [ 50.0, 292.6666666666668 ], [ 51.0, 830.3333333333354 ], [ 52.0, 7449.749999999976 ], [ 53.0, 10268.250000000007 ], [ 54.0, 5380.416666666662 ], [ 55.0, 4109.000000000004 ], [ 56.0, 782.25 ], [ 57.0, 229.08333333333337 ], [ 58.0, 84.16666666666667 ], [ 59.0, 54.75000000000001 ], [ 60.0, 41.666666666666664 ], [ 61.0, 20.833333333333332 ], [ 62.0, 11.666666666666666 ], [ 63.0, 17.916666666666664 ], [ 64.0, 23.666666666666668 ], [ 65.0, 16.333333333333332 ], [ 66.0, 8.0 ], [ 67.0, 4.25 ], [ 68.0, 1.25 ], [ 69.0, 1.0 ], [ 70.0, 0.25 ], [ 71.0, 1.0 ], [ 72.0, 1.5 ], [ 73.0, 1.25 ], [ 74.0, 1.0 ], [ 75.0, 1.0 ], [ 76.0, 0.8333333333333333 ], [ 77.0, 0.0 ], [ 78.0, 0.5 ], [ 79.0, 0.5 ], [ 80.0, 0.5 ], [ 81.0, 1.0 ], [ 82.0, 0.25 ], [ 83.0, 0.25 ], [ 84.0, 0.0 ], [ 85.0, 0.5 ], [ 86.0, 1.0 ], [ 87.0, 0.25 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.25 ], [ 91.0, 1.25 ], [ 92.0, 1.75 ], [ 93.0, 0.5 ], [ 94.0, 1.0833333333333333 ], [ 95.0, 1.0833333333333333 ], [ 96.0, 0.75 ], [ 97.0, 1.5 ], [ 98.0, 2.833333333333333 ], [ 99.0, 4.75 ], [ 100.0, 21.333333333333325 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPFS1_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.25 ], [ 2.0, 0.25 ], [ 3.0, 0.25 ], [ 4.0, 0.0 ], [ 5.0, 0.25 ], [ 6.0, 0.25 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.25 ], [ 15.0, 0.25 ], [ 16.0, 0.5 ], [ 17.0, 0.25 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 1.25 ], [ 21.0, 0.5 ], [ 22.0, 0.5 ], [ 23.0, 1.5 ], [ 24.0, 0.75 ], [ 25.0, 0.5 ], [ 26.0, 1.0833333333333333 ], [ 27.0, 1.0833333333333333 ], [ 28.0, 0.75 ], [ 29.0, 1.75 ], [ 30.0, 3.25 ], [ 31.0, 1.75 ], [ 32.0, 1.5 ], [ 33.0, 5.0 ], [ 34.0, 5.416666666666667 ], [ 35.0, 5.166666666666666 ], [ 36.0, 11.083333333333334 ], [ 37.0, 14.75 ], [ 38.0, 17.5 ], [ 39.0, 15.666666666666666 ], [ 40.0, 18.75 ], [ 41.0, 26.416666666666668 ], [ 42.0, 37.0 ], [ 43.0, 161.58333333333363 ], [ 44.0, 193.25000000000105 ], [ 45.0, 82.41666666666663 ], [ 46.0, 54.33333333333335 ], [ 47.0, 57.16666666666668 ], [ 48.0, 93.33333333333327 ], [ 49.0, 158.1666666666668 ], [ 50.0, 253.25000000000017 ], [ 51.0, 1135.1666666666672 ], [ 52.0, 11609.833333333356 ], [ 53.0, 15848.833333333352 ], [ 54.0, 6686.749999999991 ], [ 55.0, 4752.5 ], [ 56.0, 3813.166666666668 ], [ 57.0, 1897.6666666666658 ], [ 58.0, 143.58333333333331 ], [ 59.0, 29.83333333333333 ], [ 60.0, 15.833333333333334 ], [ 61.0, 8.333333333333332 ], [ 62.0, 5.583333333333333 ], [ 63.0, 7.0 ], [ 64.0, 11.0 ], [ 65.0, 7.5 ], [ 66.0, 2.25 ], [ 67.0, 2.083333333333333 ], [ 68.0, 1.5833333333333333 ], [ 69.0, 1.25 ], [ 70.0, 2.0 ], [ 71.0, 1.0 ], [ 72.0, 1.25 ], [ 73.0, 1.5 ], [ 74.0, 0.8333333333333333 ], [ 75.0, 1.0833333333333333 ], [ 76.0, 1.25 ], [ 77.0, 1.0 ], [ 78.0, 0.75 ], [ 79.0, 0.5 ], [ 80.0, 0.25 ], [ 81.0, 0.0 ], [ 82.0, 0.25 ], [ 83.0, 0.25 ], [ 84.0, 0.5 ], [ 85.0, 1.3333333333333333 ], [ 86.0, 1.0 ], [ 87.0, 1.0833333333333333 ], [ 88.0, 1.1666666666666665 ], [ 89.0, 0.8333333333333333 ], [ 90.0, 0.5 ], [ 91.0, 0.3333333333333333 ], [ 92.0, 0.8333333333333333 ], [ 93.0, 0.5 ], [ 94.0, 2.25 ], [ 95.0, 1.5 ], [ 96.0, 2.25 ], [ 97.0, 3.5 ], [ 98.0, 3.25 ], [ 99.0, 5.083333333333333 ], [ 100.0, 24.333333333333314 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPFS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.5 ], [ 8.0, 0.5 ], [ 9.0, 0.25 ], [ 10.0, 0.0 ], [ 11.0, 0.25 ], [ 12.0, 0.5 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.25 ], [ 18.0, 0.5 ], [ 19.0, 0.5 ], [ 20.0, 0.25 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.25 ], [ 24.0, 1.0 ], [ 25.0, 1.0 ], [ 26.0, 1.0833333333333333 ], [ 27.0, 1.75 ], [ 28.0, 1.25 ], [ 29.0, 2.0 ], [ 30.0, 2.4166666666666665 ], [ 31.0, 1.8333333333333333 ], [ 32.0, 1.5833333333333333 ], [ 33.0, 5.083333333333333 ], [ 34.0, 5.916666666666666 ], [ 35.0, 8.083333333333334 ], [ 36.0, 16.916666666666668 ], [ 37.0, 27.666666666666664 ], [ 38.0, 32.166666666666664 ], [ 39.0, 41.833333333333364 ], [ 40.0, 49.00000000000003 ], [ 41.0, 39.666666666666664 ], [ 42.0, 69.75000000000001 ], [ 43.0, 568.9166666666629 ], [ 44.0, 724.5833333333451 ], [ 45.0, 217.50000000000085 ], [ 46.0, 117.33333333333326 ], [ 47.0, 85.49999999999996 ], [ 48.0, 121.99999999999993 ], [ 49.0, 182.00000000000006 ], [ 50.0, 307.1666666666666 ], [ 51.0, 1210.9999999999993 ], [ 52.0, 11077.833333333347 ], [ 53.0, 14497.583333333356 ], [ 54.0, 6134.666666666664 ], [ 55.0, 4268.583333333336 ], [ 56.0, 3044.000000000001 ], [ 57.0, 1491.3333333333323 ], [ 58.0, 176.41666666666674 ], [ 59.0, 72.33333333333333 ], [ 60.0, 42.50000000000001 ], [ 61.0, 27.249999999999996 ], [ 62.0, 20.416666666666668 ], [ 63.0, 23.666666666666664 ], [ 64.0, 42.5 ], [ 65.0, 37.583333333333336 ], [ 66.0, 11.833333333333334 ], [ 67.0, 6.249999999999999 ], [ 68.0, 2.083333333333333 ], [ 69.0, 2.0 ], [ 70.0, 2.75 ], [ 71.0, 2.25 ], [ 72.0, 3.083333333333333 ], [ 73.0, 1.3333333333333333 ], [ 74.0, 1.5833333333333333 ], [ 75.0, 0.5 ], [ 76.0, 1.0833333333333333 ], [ 77.0, 1.6666666666666665 ], [ 78.0, 1.0 ], [ 79.0, 0.75 ], [ 80.0, 1.0 ], [ 81.0, 0.75 ], [ 82.0, 0.5833333333333333 ], [ 83.0, 0.25 ], [ 84.0, 0.5 ], [ 85.0, 0.8333333333333333 ], [ 86.0, 0.5 ], [ 87.0, 0.5 ], [ 88.0, 1.5 ], [ 89.0, 0.25 ], [ 90.0, 1.75 ], [ 91.0, 0.75 ], [ 92.0, 1.0 ], [ 93.0, 1.75 ], [ 94.0, 0.0 ], [ 95.0, 0.75 ], [ 96.0, 2.333333333333333 ], [ 97.0, 2.333333333333333 ], [ 98.0, 2.0833333333333335 ], [ 99.0, 3.833333333333333 ], [ 100.0, 21.16666666666666 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPMS1_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.25 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.25 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.25 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.25 ], [ 14.0, 0.0 ], [ 15.0, 0.25 ], [ 16.0, 0.0 ], [ 17.0, 0.5 ], [ 18.0, 0.5 ], [ 19.0, 0.75 ], [ 20.0, 0.0 ], [ 21.0, 0.75 ], [ 22.0, 0.75 ], [ 23.0, 1.25 ], [ 24.0, 0.5 ], [ 25.0, 0.25 ], [ 26.0, 0.0 ], [ 27.0, 1.3333333333333333 ], [ 28.0, 3.9166666666666665 ], [ 29.0, 5.666666666666666 ], [ 30.0, 8.416666666666668 ], [ 31.0, 8.166666666666666 ], [ 32.0, 13.833333333333334 ], [ 33.0, 25.0 ], [ 34.0, 22.5 ], [ 35.0, 23.833333333333336 ], [ 36.0, 20.75 ], [ 37.0, 17.416666666666668 ], [ 38.0, 14.583333333333334 ], [ 39.0, 15.583333333333334 ], [ 40.0, 16.75 ], [ 41.0, 28.166666666666664 ], [ 42.0, 35.75 ], [ 43.0, 46.24999999999999 ], [ 44.0, 43.083333333333336 ], [ 45.0, 34.666666666666664 ], [ 46.0, 45.66666666666667 ], [ 47.0, 39.91666666666667 ], [ 48.0, 193.33333333333334 ], [ 49.0, 556.3333333333333 ], [ 50.0, 621.1666666666666 ], [ 51.0, 698.0833333333335 ], [ 52.0, 6093.999999999998 ], [ 53.0, 8381.333333333328 ], [ 54.0, 5055.666666666665 ], [ 55.0, 3714.4166666666674 ], [ 56.0, 946.6666666666669 ], [ 57.0, 368.58333333333337 ], [ 58.0, 47.5 ], [ 59.0, 19.75 ], [ 60.0, 13.5 ], [ 61.0, 6.583333333333334 ], [ 62.0, 4.416666666666667 ], [ 63.0, 12.416666666666666 ], [ 64.0, 11.583333333333334 ], [ 65.0, 7.0 ], [ 66.0, 4.0 ], [ 67.0, 2.0 ], [ 68.0, 1.5 ], [ 69.0, 0.75 ], [ 70.0, 1.0 ], [ 71.0, 1.0833333333333333 ], [ 72.0, 2.083333333333333 ], [ 73.0, 1.0 ], [ 74.0, 1.0 ], [ 75.0, 0.75 ], [ 76.0, 1.5 ], [ 77.0, 1.0 ], [ 78.0, 1.25 ], [ 79.0, 1.5 ], [ 80.0, 0.25 ], [ 81.0, 0.5833333333333333 ], [ 82.0, 0.75 ], [ 83.0, 0.8333333333333333 ], [ 84.0, 0.0 ], [ 85.0, 0.5 ], [ 86.0, 0.25 ], [ 87.0, 1.0 ], [ 88.0, 0.25 ], [ 89.0, 0.75 ], [ 90.0, 0.75 ], [ 91.0, 0.8333333333333333 ], [ 92.0, 0.75 ], [ 93.0, 0.75 ], [ 94.0, 0.5 ], [ 95.0, 0.5 ], [ 96.0, 1.8333333333333333 ], [ 97.0, 1.0833333333333333 ], [ 98.0, 0.75 ], [ 99.0, 2.0 ], [ 100.0, 13.666666666666673 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPMS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.25 ], [ 3.0, 0.0 ], [ 4.0, 0.5 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.25 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.75 ], [ 23.0, 0.5 ], [ 24.0, 0.75 ], [ 25.0, 0.75 ], [ 26.0, 0.75 ], [ 27.0, 0.25 ], [ 28.0, 0.25 ], [ 29.0, 0.25 ], [ 30.0, 1.0 ], [ 31.0, 1.25 ], [ 32.0, 1.75 ], [ 33.0, 3.25 ], [ 34.0, 3.5833333333333335 ], [ 35.0, 2.75 ], [ 36.0, 6.25 ], [ 37.0, 8.25 ], [ 38.0, 9.333333333333334 ], [ 39.0, 11.083333333333334 ], [ 40.0, 13.750000000000002 ], [ 41.0, 19.249999999999996 ], [ 42.0, 34.249999999999986 ], [ 43.0, 124.41666666666622 ], [ 44.0, 150.4166666666666 ], [ 45.0, 54.66666666666671 ], [ 46.0, 41.25 ], [ 47.0, 68.33333333333334 ], [ 48.0, 236.58333333333337 ], [ 49.0, 1007.0833333333337 ], [ 50.0, 1287.6666666666667 ], [ 51.0, 1146.3333333333337 ], [ 52.0, 7573.666666666654 ], [ 53.0, 8268.666666666659 ], [ 54.0, 4443.083333333335 ], [ 55.0, 2889.083333333333 ], [ 56.0, 1017.2500000000001 ], [ 57.0, 398.16666666666663 ], [ 58.0, 59.08333333333334 ], [ 59.0, 19.333333333333332 ], [ 60.0, 12.75 ], [ 61.0, 7.083333333333334 ], [ 62.0, 4.333333333333334 ], [ 63.0, 6.583333333333333 ], [ 64.0, 15.25 ], [ 65.0, 11.25 ], [ 66.0, 3.0 ], [ 67.0, 1.5 ], [ 68.0, 2.75 ], [ 69.0, 0.5 ], [ 70.0, 0.5 ], [ 71.0, 0.25 ], [ 72.0, 0.75 ], [ 73.0, 0.5 ], [ 74.0, 1.0 ], [ 75.0, 0.25 ], [ 76.0, 0.5 ], [ 77.0, 0.75 ], [ 78.0, 1.0 ], [ 79.0, 0.8333333333333333 ], [ 80.0, 0.25 ], [ 81.0, 0.5 ], [ 82.0, 0.75 ], [ 83.0, 0.5 ], [ 84.0, 1.0 ], [ 85.0, 0.5 ], [ 86.0, 0.0 ], [ 87.0, 1.0833333333333333 ], [ 88.0, 0.5833333333333333 ], [ 89.0, 0.5 ], [ 90.0, 0.25 ], [ 91.0, 0.25 ], [ 92.0, 0.5 ], [ 93.0, 0.25 ], [ 94.0, 0.5 ], [ 95.0, 0.5 ], [ 96.0, 1.25 ], [ 97.0, 1.5833333333333333 ], [ 98.0, 1.75 ], [ 99.0, 1.25 ], [ 100.0, 15.000000000000009 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVFS1_R2", "pairs": [ [ 0.0, 0.5 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.25 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.25 ], [ 12.0, 0.0 ], [ 13.0, 0.25 ], [ 14.0, 0.5 ], [ 15.0, 0.25 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.25 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.5 ], [ 24.0, 0.75 ], [ 25.0, 1.0 ], [ 26.0, 0.5 ], [ 27.0, 1.25 ], [ 28.0, 1.25 ], [ 29.0, 1.75 ], [ 30.0, 0.75 ], [ 31.0, 0.75 ], [ 32.0, 1.0 ], [ 33.0, 1.5 ], [ 34.0, 2.5 ], [ 35.0, 4.25 ], [ 36.0, 6.25 ], [ 37.0, 5.75 ], [ 38.0, 4.5 ], [ 39.0, 8.083333333333332 ], [ 40.0, 11.25 ], [ 41.0, 16.083333333333336 ], [ 42.0, 24.083333333333325 ], [ 43.0, 101.49999999999973 ], [ 44.0, 113.08333333333293 ], [ 45.0, 37.33333333333334 ], [ 46.0, 32.91666666666667 ], [ 47.0, 41.5 ], [ 48.0, 83.41666666666667 ], [ 49.0, 211.99999999999997 ], [ 50.0, 351.4166666666667 ], [ 51.0, 1194.416666666666 ], [ 52.0, 8460.333333333321 ], [ 53.0, 7278.583333333327 ], [ 54.0, 2933.416666666668 ], [ 55.0, 1898.749999999999 ], [ 56.0, 636.2500000000002 ], [ 57.0, 285.83333333333337 ], [ 58.0, 60.333333333333336 ], [ 59.0, 23.499999999999996 ], [ 60.0, 11.0 ], [ 61.0, 6.166666666666666 ], [ 62.0, 6.166666666666666 ], [ 63.0, 8.25 ], [ 64.0, 3.75 ], [ 65.0, 2.0 ], [ 66.0, 2.75 ], [ 67.0, 2.583333333333333 ], [ 68.0, 1.5 ], [ 69.0, 1.0 ], [ 70.0, 0.25 ], [ 71.0, 0.75 ], [ 72.0, 0.5 ], [ 73.0, 1.8333333333333333 ], [ 74.0, 0.5 ], [ 75.0, 0.75 ], [ 76.0, 0.5 ], [ 77.0, 0.0 ], [ 78.0, 0.5 ], [ 79.0, 0.25 ], [ 80.0, 0.25 ], [ 81.0, 0.0 ], [ 82.0, 0.5 ], [ 83.0, 0.5 ], [ 84.0, 1.0 ], [ 85.0, 0.25 ], [ 86.0, 0.75 ], [ 87.0, 0.25 ], [ 88.0, 0.25 ], [ 89.0, 0.25 ], [ 90.0, 0.25 ], [ 91.0, 0.0 ], [ 92.0, 0.25 ], [ 93.0, 0.5833333333333333 ], [ 94.0, 0.25 ], [ 95.0, 0.5 ], [ 96.0, 0.5833333333333333 ], [ 97.0, 1.0 ], [ 98.0, 0.8333333333333333 ], [ 99.0, 3.6666666666666665 ], [ 100.0, 15.166666666666677 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVFS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.25 ], [ 8.0, 0.5 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.25 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.25 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.5 ], [ 27.0, 0.75 ], [ 28.0, 1.5 ], [ 29.0, 1.5 ], [ 30.0, 1.5833333333333333 ], [ 31.0, 1.0 ], [ 32.0, 2.833333333333333 ], [ 33.0, 3.6666666666666665 ], [ 34.0, 2.6666666666666665 ], [ 35.0, 7.666666666666666 ], [ 36.0, 12.833333333333337 ], [ 37.0, 13.583333333333336 ], [ 38.0, 20.5 ], [ 39.0, 23.999999999999993 ], [ 40.0, 29.249999999999993 ], [ 41.0, 41.583333333333336 ], [ 42.0, 60.75000000000003 ], [ 43.0, 364.4999999999973 ], [ 44.0, 408.99999999999545 ], [ 45.0, 105.66666666666654 ], [ 46.0, 65.66666666666667 ], [ 47.0, 65.08333333333337 ], [ 48.0, 123.33333333333323 ], [ 49.0, 250.33333333333357 ], [ 50.0, 366.83333333333326 ], [ 51.0, 1409.0833333333305 ], [ 52.0, 11124.916666666682 ], [ 53.0, 11820.916666666679 ], [ 54.0, 3750.5833333333367 ], [ 55.0, 2617.7500000000014 ], [ 56.0, 920.5833333333351 ], [ 57.0, 301.50000000000006 ], [ 58.0, 62.91666666666667 ], [ 59.0, 19.333333333333336 ], [ 60.0, 13.166666666666666 ], [ 61.0, 10.333333333333332 ], [ 62.0, 8.833333333333332 ], [ 63.0, 12.333333333333334 ], [ 64.0, 14.083333333333332 ], [ 65.0, 8.25 ], [ 66.0, 2.75 ], [ 67.0, 2.1666666666666665 ], [ 68.0, 1.5 ], [ 69.0, 1.0 ], [ 70.0, 1.5 ], [ 71.0, 0.5 ], [ 72.0, 0.75 ], [ 73.0, 2.0 ], [ 74.0, 0.75 ], [ 75.0, 1.0 ], [ 76.0, 0.75 ], [ 77.0, 0.5 ], [ 78.0, 1.0 ], [ 79.0, 1.25 ], [ 80.0, 0.5 ], [ 81.0, 1.5833333333333333 ], [ 82.0, 0.75 ], [ 83.0, 0.3333333333333333 ], [ 84.0, 1.3333333333333333 ], [ 85.0, 0.75 ], [ 86.0, 0.25 ], [ 87.0, 0.25 ], [ 88.0, 0.25 ], [ 89.0, 0.5 ], [ 90.0, 0.5 ], [ 91.0, 0.5 ], [ 92.0, 0.25 ], [ 93.0, 1.75 ], [ 94.0, 1.0 ], [ 95.0, 2.0 ], [ 96.0, 1.75 ], [ 97.0, 1.75 ], [ 98.0, 2.0 ], [ 99.0, 3.75 ], [ 100.0, 19.499999999999996 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVMS1_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.25 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.5 ], [ 19.0, 0.5 ], [ 20.0, 0.0 ], [ 21.0, 0.25 ], [ 22.0, 1.0 ], [ 23.0, 0.8333333333333333 ], [ 24.0, 0.5833333333333333 ], [ 25.0, 1.5 ], [ 26.0, 1.75 ], [ 27.0, 1.75 ], [ 28.0, 1.25 ], [ 29.0, 1.25 ], [ 30.0, 2.0 ], [ 31.0, 2.25 ], [ 32.0, 3.083333333333333 ], [ 33.0, 6.333333333333333 ], [ 34.0, 6.0 ], [ 35.0, 6.083333333333334 ], [ 36.0, 10.333333333333332 ], [ 37.0, 14.666666666666666 ], [ 38.0, 22.166666666666668 ], [ 39.0, 23.666666666666664 ], [ 40.0, 21.999999999999996 ], [ 41.0, 26.749999999999993 ], [ 42.0, 46.08333333333334 ], [ 43.0, 506.7499999999897 ], [ 44.0, 598.4999999999991 ], [ 45.0, 146.83333333333331 ], [ 46.0, 92.49999999999997 ], [ 47.0, 142.41666666666663 ], [ 48.0, 471.24999999999983 ], [ 49.0, 1764.8333333333326 ], [ 50.0, 2153.416666666666 ], [ 51.0, 2319.9166666666642 ], [ 52.0, 11763.500000000015 ], [ 53.0, 14086.666666666688 ], [ 54.0, 10184.749999999998 ], [ 55.0, 6931.083333333328 ], [ 56.0, 2716.166666666668 ], [ 57.0, 1214.1666666666667 ], [ 58.0, 180.33333333333331 ], [ 59.0, 39.0 ], [ 60.0, 33.33333333333333 ], [ 61.0, 20.833333333333332 ], [ 62.0, 9.666666666666668 ], [ 63.0, 18.833333333333332 ], [ 64.0, 18.0 ], [ 65.0, 12.0 ], [ 66.0, 6.333333333333333 ], [ 67.0, 2.0 ], [ 68.0, 2.25 ], [ 69.0, 1.75 ], [ 70.0, 1.0 ], [ 71.0, 1.0 ], [ 72.0, 1.75 ], [ 73.0, 1.5833333333333333 ], [ 74.0, 2.5 ], [ 75.0, 3.25 ], [ 76.0, 2.333333333333333 ], [ 77.0, 0.75 ], [ 78.0, 0.5 ], [ 79.0, 0.5 ], [ 80.0, 1.0833333333333333 ], [ 81.0, 1.1666666666666665 ], [ 82.0, 0.75 ], [ 83.0, 0.5 ], [ 84.0, 1.0 ], [ 85.0, 1.0 ], [ 86.0, 0.5 ], [ 87.0, 1.0 ], [ 88.0, 0.5 ], [ 89.0, 0.9166666666666666 ], [ 90.0, 0.5833333333333333 ], [ 91.0, 1.5 ], [ 92.0, 1.5 ], [ 93.0, 1.0 ], [ 94.0, 0.5 ], [ 95.0, 0.5 ], [ 96.0, 1.0 ], [ 97.0, 2.8333333333333335 ], [ 98.0, 4.0 ], [ 99.0, 5.5 ], [ 100.0, 31.16666666666662 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVMS2_R2", "pairs": [ [ 0.0, 2.0 ], [ 1.0, 0.75 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.25 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.25 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.25 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.75 ], [ 25.0, 0.75 ], [ 26.0, 1.25 ], [ 27.0, 0.5 ], [ 28.0, 1.0833333333333333 ], [ 29.0, 0.8333333333333333 ], [ 30.0, 2.0 ], [ 31.0, 2.833333333333333 ], [ 32.0, 3.6666666666666665 ], [ 33.0, 5.833333333333333 ], [ 34.0, 9.083333333333334 ], [ 35.0, 8.583333333333332 ], [ 36.0, 12.0 ], [ 37.0, 12.25 ], [ 38.0, 18.333333333333332 ], [ 39.0, 22.66666666666666 ], [ 40.0, 25.166666666666657 ], [ 41.0, 31.333333333333325 ], [ 42.0, 50.583333333333364 ], [ 43.0, 370.24999999999636 ], [ 44.0, 434.16666666666026 ], [ 45.0, 99.3333333333332 ], [ 46.0, 75.5 ], [ 47.0, 100.41666666666661 ], [ 48.0, 372.9999999999999 ], [ 49.0, 793.4166666666667 ], [ 50.0, 975.0000000000007 ], [ 51.0, 2136.083333333326 ], [ 52.0, 14881.583333333387 ], [ 53.0, 15202.9166666667 ], [ 54.0, 8316.16666666665 ], [ 55.0, 6178.083333333327 ], [ 56.0, 2303.916666666666 ], [ 57.0, 983.8333333333335 ], [ 58.0, 158.75 ], [ 59.0, 49.58333333333334 ], [ 60.0, 34.75 ], [ 61.0, 12.916666666666666 ], [ 62.0, 8.583333333333332 ], [ 63.0, 25.75 ], [ 64.0, 30.833333333333332 ], [ 65.0, 20.916666666666668 ], [ 66.0, 11.416666666666668 ], [ 67.0, 2.083333333333333 ], [ 68.0, 2.1666666666666665 ], [ 69.0, 1.8333333333333333 ], [ 70.0, 2.75 ], [ 71.0, 1.0833333333333333 ], [ 72.0, 1.3333333333333333 ], [ 73.0, 1.8333333333333333 ], [ 74.0, 1.25 ], [ 75.0, 2.5 ], [ 76.0, 2.5 ], [ 77.0, 2.25 ], [ 78.0, 1.25 ], [ 79.0, 1.75 ], [ 80.0, 0.75 ], [ 81.0, 1.5833333333333333 ], [ 82.0, 1.6666666666666665 ], [ 83.0, 1.3333333333333333 ], [ 84.0, 0.75 ], [ 85.0, 1.5 ], [ 86.0, 1.6666666666666665 ], [ 87.0, 1.7499999999999998 ], [ 88.0, 1.1666666666666665 ], [ 89.0, 0.8333333333333333 ], [ 90.0, 0.75 ], [ 91.0, 1.75 ], [ 92.0, 2.0 ], [ 93.0, 1.75 ], [ 94.0, 1.5 ], [ 95.0, 1.25 ], [ 96.0, 2.0 ], [ 97.0, 2.8333333333333335 ], [ 98.0, 2.75 ], [ 99.0, 5.333333333333333 ], [ 100.0, 29.99999999999996 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAFS1_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.6666666666666666 ], [ 44.0, 0.6666666666666666 ], [ 45.0, 0.3333333333333333 ], [ 46.0, 4.75 ], [ 47.0, 210.58333333333334 ], [ 48.0, 217.83333333333334 ], [ 49.0, 41.16666666666667 ], [ 50.0, 183.83333333333374 ], [ 51.0, 2809.0833333333344 ], [ 52.0, 16312.000000000005 ], [ 53.0, 5760.583333333333 ], [ 54.0, 674.1666666666667 ], [ 55.0, 1829.583333333333 ], [ 56.0, 18725.333333333336 ], [ 57.0, 6109.416666666659 ], [ 58.0, 169.8333333333334 ], [ 59.0, 58.41666666666667 ], [ 60.0, 24.833333333333332 ], [ 61.0, 14.083333333333334 ], [ 62.0, 11.583333333333332 ], [ 63.0, 8.583333333333332 ], [ 64.0, 11.083333333333332 ], [ 65.0, 6.833333333333333 ], [ 66.0, 6.416666666666666 ], [ 67.0, 10.166666666666666 ], [ 68.0, 7.25 ], [ 69.0, 6.666666666666666 ], [ 70.0, 3.5 ], [ 71.0, 3.833333333333333 ], [ 72.0, 4.583333333333334 ], [ 73.0, 3.1666666666666665 ], [ 74.0, 2.75 ], [ 75.0, 2.583333333333333 ], [ 76.0, 3.25 ], [ 77.0, 4.666666666666667 ], [ 78.0, 1.5 ], [ 79.0, 2.333333333333333 ], [ 80.0, 2.75 ], [ 81.0, 2.75 ], [ 82.0, 2.4166666666666665 ], [ 83.0, 1.0 ], [ 84.0, 0.75 ], [ 85.0, 0.5 ], [ 86.0, 0.75 ], [ 87.0, 0.75 ], [ 88.0, 1.5833333333333333 ], [ 89.0, 1.5833333333333333 ], [ 90.0, 1.25 ], [ 91.0, 1.0 ], [ 92.0, 0.75 ], [ 93.0, 1.25 ], [ 94.0, 1.25 ], [ 95.0, 1.25 ], [ 96.0, 1.25 ], [ 97.0, 0.75 ], [ 98.0, 1.25 ], [ 99.0, 9.25 ], [ 100.0, 11.000000000000002 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAFS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.8333333333333333 ], [ 46.0, 2.25 ], [ 47.0, 116.0 ], [ 48.0, 130.75 ], [ 49.0, 13.166666666666666 ], [ 50.0, 27.083333333333325 ], [ 51.0, 341.25 ], [ 52.0, 2262.083333333334 ], [ 53.0, 754.5 ], [ 54.0, 201.66666666666666 ], [ 55.0, 2264.9166666666665 ], [ 56.0, 25923.249999999956 ], [ 57.0, 8674.416666666655 ], [ 58.0, 230.58333333333331 ], [ 59.0, 54.583333333333336 ], [ 60.0, 25.333333333333332 ], [ 61.0, 15.916666666666668 ], [ 62.0, 8.25 ], [ 63.0, 7.666666666666666 ], [ 64.0, 7.333333333333333 ], [ 65.0, 6.25 ], [ 66.0, 5.0 ], [ 67.0, 5.833333333333334 ], [ 68.0, 4.083333333333333 ], [ 69.0, 4.25 ], [ 70.0, 3.75 ], [ 71.0, 3.3333333333333335 ], [ 72.0, 1.5 ], [ 73.0, 3.5 ], [ 74.0, 3.75 ], [ 75.0, 2.75 ], [ 76.0, 2.083333333333333 ], [ 77.0, 2.9166666666666665 ], [ 78.0, 2.9166666666666665 ], [ 79.0, 2.583333333333333 ], [ 80.0, 2.3333333333333335 ], [ 81.0, 1.4166666666666665 ], [ 82.0, 0.9166666666666666 ], [ 83.0, 2.0 ], [ 84.0, 1.3333333333333333 ], [ 85.0, 0.8333333333333333 ], [ 86.0, 1.3333333333333333 ], [ 87.0, 1.0 ], [ 88.0, 1.5 ], [ 89.0, 1.8333333333333333 ], [ 90.0, 0.5 ], [ 91.0, 0.25 ], [ 92.0, 1.25 ], [ 93.0, 0.75 ], [ 94.0, 1.0833333333333333 ], [ 95.0, 1.0 ], [ 96.0, 1.0 ], [ 97.0, 0.8333333333333333 ], [ 98.0, 1.3333333333333333 ], [ 99.0, 9.25 ], [ 100.0, 11.333333333333336 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAMS1_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 3.666666666666667 ], [ 44.0, 3.0 ], [ 45.0, 1.25 ], [ 46.0, 1.8333333333333333 ], [ 47.0, 49.33333333333333 ], [ 48.0, 54.5 ], [ 49.0, 25.833333333333332 ], [ 50.0, 121.49999999999979 ], [ 51.0, 1692.9166666666645 ], [ 52.0, 9400.833333333332 ], [ 53.0, 3008.916666666667 ], [ 54.0, 452.41666666666663 ], [ 55.0, 2340.8333333333326 ], [ 56.0, 23573.08333333331 ], [ 57.0, 7944.249999999982 ], [ 58.0, 216.41666666666674 ], [ 59.0, 53.50000000000001 ], [ 60.0, 23.916666666666664 ], [ 61.0, 15.333333333333334 ], [ 62.0, 12.083333333333334 ], [ 63.0, 7.5 ], [ 64.0, 7.25 ], [ 65.0, 6.25 ], [ 66.0, 4.25 ], [ 67.0, 5.25 ], [ 68.0, 6.166666666666666 ], [ 69.0, 2.75 ], [ 70.0, 4.083333333333333 ], [ 71.0, 2.0 ], [ 72.0, 2.75 ], [ 73.0, 2.75 ], [ 74.0, 3.8333333333333335 ], [ 75.0, 2.333333333333333 ], [ 76.0, 1.8333333333333333 ], [ 77.0, 1.5 ], [ 78.0, 2.5 ], [ 79.0, 2.25 ], [ 80.0, 1.25 ], [ 81.0, 1.8333333333333333 ], [ 82.0, 1.9166666666666665 ], [ 83.0, 0.75 ], [ 84.0, 1.25 ], [ 85.0, 0.25 ], [ 86.0, 0.0 ], [ 87.0, 0.75 ], [ 88.0, 1.0 ], [ 89.0, 0.5 ], [ 90.0, 1.5 ], [ 91.0, 0.75 ], [ 92.0, 1.5 ], [ 93.0, 0.75 ], [ 94.0, 0.5 ], [ 95.0, 1.8333333333333333 ], [ 96.0, 1.3333333333333333 ], [ 97.0, 0.5 ], [ 98.0, 2.0 ], [ 99.0, 10.333333333333334 ], [ 100.0, 14.666666666666675 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAMS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 2.333333333333333 ], [ 44.0, 2.583333333333333 ], [ 45.0, 1.1666666666666665 ], [ 46.0, 6.083333333333333 ], [ 47.0, 211.25 ], [ 48.0, 225.83333333333334 ], [ 49.0, 187.5833333333334 ], [ 50.0, 520.4999999999995 ], [ 51.0, 1032.3333333333348 ], [ 52.0, 6569.499999999997 ], [ 53.0, 8343.833333333328 ], [ 54.0, 6468.166666666665 ], [ 55.0, 4219.583333333336 ], [ 56.0, 15883.500000000024 ], [ 57.0, 5999.249999999994 ], [ 58.0, 240.75000000000003 ], [ 59.0, 36.83333333333333 ], [ 60.0, 18.833333333333332 ], [ 61.0, 14.0 ], [ 62.0, 9.666666666666668 ], [ 63.0, 20.666666666666668 ], [ 64.0, 13.333333333333334 ], [ 65.0, 8.0 ], [ 66.0, 7.5 ], [ 67.0, 6.5 ], [ 68.0, 5.333333333333334 ], [ 69.0, 4.083333333333333 ], [ 70.0, 4.0 ], [ 71.0, 3.5 ], [ 72.0, 3.166666666666667 ], [ 73.0, 3.5833333333333335 ], [ 74.0, 4.75 ], [ 75.0, 1.75 ], [ 76.0, 4.0 ], [ 77.0, 2.0 ], [ 78.0, 2.333333333333333 ], [ 79.0, 1.6666666666666665 ], [ 80.0, 1.3333333333333333 ], [ 81.0, 1.0833333333333333 ], [ 82.0, 1.75 ], [ 83.0, 1.8333333333333333 ], [ 84.0, 0.5 ], [ 85.0, 1.3333333333333333 ], [ 86.0, 1.3333333333333333 ], [ 87.0, 0.0 ], [ 88.0, 1.25 ], [ 89.0, 0.75 ], [ 90.0, 1.5 ], [ 91.0, 1.5 ], [ 92.0, 1.25 ], [ 93.0, 1.25 ], [ 94.0, 0.5 ], [ 95.0, 0.8333333333333333 ], [ 96.0, 0.8333333333333333 ], [ 97.0, 1.0 ], [ 98.0, 0.8333333333333333 ], [ 99.0, 7.583333333333334 ], [ 100.0, 15.000000000000009 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICFS1_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.25 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.25 ], [ 14.0, 0.25 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.5 ], [ 20.0, 1.0 ], [ 21.0, 1.25 ], [ 22.0, 0.5 ], [ 23.0, 0.75 ], [ 24.0, 0.75 ], [ 25.0, 1.0 ], [ 26.0, 0.75 ], [ 27.0, 1.0 ], [ 28.0, 1.0833333333333333 ], [ 29.0, 2.0833333333333335 ], [ 30.0, 2.0 ], [ 31.0, 2.75 ], [ 32.0, 1.25 ], [ 33.0, 4.75 ], [ 34.0, 6.333333333333333 ], [ 35.0, 9.083333333333334 ], [ 36.0, 8.833333333333332 ], [ 37.0, 11.666666666666666 ], [ 38.0, 15.083333333333332 ], [ 39.0, 15.0 ], [ 40.0, 19.166666666666668 ], [ 41.0, 20.25 ], [ 42.0, 25.916666666666664 ], [ 43.0, 35.833333333333336 ], [ 44.0, 47.25 ], [ 45.0, 66.50000000000003 ], [ 46.0, 141.91666666666666 ], [ 47.0, 1324.9166666666665 ], [ 48.0, 1755.9166666666663 ], [ 49.0, 461.83333333333303 ], [ 50.0, 418.0833333333326 ], [ 51.0, 1154.833333333333 ], [ 52.0, 9230.833333333328 ], [ 53.0, 16475.83333333338 ], [ 54.0, 5713.916666666662 ], [ 55.0, 3491.250000000006 ], [ 56.0, 3807.416666666675 ], [ 57.0, 1822.3333333333312 ], [ 58.0, 168.66666666666666 ], [ 59.0, 41.916666666666664 ], [ 60.0, 29.58333333333332 ], [ 61.0, 13.333333333333332 ], [ 62.0, 7.583333333333333 ], [ 63.0, 6.583333333333333 ], [ 64.0, 3.0 ], [ 65.0, 1.5 ], [ 66.0, 2.0 ], [ 67.0, 1.8333333333333333 ], [ 68.0, 1.5833333333333333 ], [ 69.0, 1.5 ], [ 70.0, 2.5 ], [ 71.0, 1.75 ], [ 72.0, 2.083333333333333 ], [ 73.0, 1.5 ], [ 74.0, 0.5 ], [ 75.0, 1.75 ], [ 76.0, 1.5 ], [ 77.0, 0.75 ], [ 78.0, 0.5 ], [ 79.0, 0.5 ], [ 80.0, 0.75 ], [ 81.0, 0.5 ], [ 82.0, 0.75 ], [ 83.0, 0.5 ], [ 84.0, 0.75 ], [ 85.0, 0.25 ], [ 86.0, 0.75 ], [ 87.0, 1.8333333333333333 ], [ 88.0, 1.0833333333333333 ], [ 89.0, 0.75 ], [ 90.0, 1.0 ], [ 91.0, 0.75 ], [ 92.0, 1.75 ], [ 93.0, 1.5833333333333333 ], [ 94.0, 1.8333333333333333 ], [ 95.0, 1.75 ], [ 96.0, 1.8333333333333333 ], [ 97.0, 2.083333333333333 ], [ 98.0, 3.0 ], [ 99.0, 5.25 ], [ 100.0, 26.49999999999997 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICFS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.25 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.25 ], [ 12.0, 0.5 ], [ 13.0, 0.25 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.25 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.75 ], [ 24.0, 0.75 ], [ 25.0, 0.5 ], [ 26.0, 0.0 ], [ 27.0, 1.0 ], [ 28.0, 1.8333333333333333 ], [ 29.0, 2.0 ], [ 30.0, 2.25 ], [ 31.0, 1.0 ], [ 32.0, 1.25 ], [ 33.0, 2.25 ], [ 34.0, 3.25 ], [ 35.0, 6.333333333333333 ], [ 36.0, 5.0 ], [ 37.0, 10.5 ], [ 38.0, 12.5 ], [ 39.0, 15.666666666666666 ], [ 40.0, 15.416666666666666 ], [ 41.0, 20.333333333333332 ], [ 42.0, 26.083333333333336 ], [ 43.0, 34.66666666666667 ], [ 44.0, 38.91666666666667 ], [ 45.0, 46.83333333333335 ], [ 46.0, 67.66666666666667 ], [ 47.0, 410.91666666666663 ], [ 48.0, 900.75 ], [ 49.0, 1431.0833333333333 ], [ 50.0, 1588.4999999999984 ], [ 51.0, 2335.666666666664 ], [ 52.0, 9408.749999999995 ], [ 53.0, 14299.750000000022 ], [ 54.0, 10484.083333333334 ], [ 55.0, 6201.833333333328 ], [ 56.0, 6152.749999999996 ], [ 57.0, 3553.666666666668 ], [ 58.0, 342.24999999999994 ], [ 59.0, 50.41666666666667 ], [ 60.0, 22.0 ], [ 61.0, 14.416666666666666 ], [ 62.0, 9.75 ], [ 63.0, 13.416666666666666 ], [ 64.0, 7.333333333333334 ], [ 65.0, 1.5 ], [ 66.0, 1.75 ], [ 67.0, 1.5 ], [ 68.0, 0.8333333333333333 ], [ 69.0, 2.25 ], [ 70.0, 2.1666666666666665 ], [ 71.0, 1.5833333333333333 ], [ 72.0, 1.5 ], [ 73.0, 1.5833333333333333 ], [ 74.0, 2.333333333333333 ], [ 75.0, 2.5 ], [ 76.0, 1.5 ], [ 77.0, 0.25 ], [ 78.0, 0.75 ], [ 79.0, 2.333333333333333 ], [ 80.0, 3.25 ], [ 81.0, 2.083333333333333 ], [ 82.0, 1.3333333333333333 ], [ 83.0, 1.0 ], [ 84.0, 0.75 ], [ 85.0, 1.0 ], [ 86.0, 1.25 ], [ 87.0, 0.75 ], [ 88.0, 1.0 ], [ 89.0, 1.25 ], [ 90.0, 1.0 ], [ 91.0, 1.25 ], [ 92.0, 1.25 ], [ 93.0, 1.0 ], [ 94.0, 2.0 ], [ 95.0, 1.8333333333333333 ], [ 96.0, 2.5833333333333335 ], [ 97.0, 2.5 ], [ 98.0, 3.25 ], [ 99.0, 5.583333333333333 ], [ 100.0, 29.166666666666632 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICMS1_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.25 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.25 ], [ 7.0, 0.25 ], [ 8.0, 0.5 ], [ 9.0, 0.0 ], [ 10.0, 0.25 ], [ 11.0, 0.5 ], [ 12.0, 0.5 ], [ 13.0, 0.0 ], [ 14.0, 0.25 ], [ 15.0, 0.25 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.25 ], [ 19.0, 0.0 ], [ 20.0, 0.5 ], [ 21.0, 0.75 ], [ 22.0, 1.0 ], [ 23.0, 0.5 ], [ 24.0, 0.5 ], [ 25.0, 0.75 ], [ 26.0, 1.25 ], [ 27.0, 0.75 ], [ 28.0, 1.25 ], [ 29.0, 2.333333333333333 ], [ 30.0, 1.0 ], [ 31.0, 2.25 ], [ 32.0, 3.75 ], [ 33.0, 4.083333333333334 ], [ 34.0, 5.583333333333333 ], [ 35.0, 9.0 ], [ 36.0, 14.0 ], [ 37.0, 16.083333333333336 ], [ 38.0, 18.25 ], [ 39.0, 18.5 ], [ 40.0, 19.75 ], [ 41.0, 22.75 ], [ 42.0, 26.916666666666664 ], [ 43.0, 35.75 ], [ 44.0, 45.16666666666667 ], [ 45.0, 57.66666666666667 ], [ 46.0, 110.24999999999996 ], [ 47.0, 980.7500000000001 ], [ 48.0, 1251.9999999999998 ], [ 49.0, 284.5833333333333 ], [ 50.0, 318.83333333333303 ], [ 51.0, 1743.6666666666613 ], [ 52.0, 13598.250000000022 ], [ 53.0, 15142.750000000005 ], [ 54.0, 2912.0833333333335 ], [ 55.0, 2496.166666666667 ], [ 56.0, 16324.583333333365 ], [ 57.0, 8046.166666666647 ], [ 58.0, 470.9999999999999 ], [ 59.0, 60.5 ], [ 60.0, 25.75 ], [ 61.0, 10.750000000000002 ], [ 62.0, 6.166666666666666 ], [ 63.0, 5.083333333333333 ], [ 64.0, 4.583333333333333 ], [ 65.0, 3.75 ], [ 66.0, 2.583333333333333 ], [ 67.0, 1.25 ], [ 68.0, 1.25 ], [ 69.0, 0.5 ], [ 70.0, 0.75 ], [ 71.0, 1.5 ], [ 72.0, 1.5 ], [ 73.0, 1.5 ], [ 74.0, 2.0 ], [ 75.0, 2.583333333333333 ], [ 76.0, 1.25 ], [ 77.0, 1.0 ], [ 78.0, 1.0 ], [ 79.0, 0.5 ], [ 80.0, 0.75 ], [ 81.0, 1.5 ], [ 82.0, 2.5 ], [ 83.0, 1.25 ], [ 84.0, 1.0 ], [ 85.0, 1.0 ], [ 86.0, 1.25 ], [ 87.0, 0.5 ], [ 88.0, 0.75 ], [ 89.0, 0.5 ], [ 90.0, 1.0 ], [ 91.0, 0.75 ], [ 92.0, 0.75 ], [ 93.0, 1.3333333333333333 ], [ 94.0, 1.6666666666666665 ], [ 95.0, 1.75 ], [ 96.0, 2.0 ], [ 97.0, 1.8333333333333333 ], [ 98.0, 4.166666666666666 ], [ 99.0, 5.833333333333333 ], [ 100.0, 32.66666666666662 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICMS2_R2", "pairs": [ [ 0.0, 0.5 ], [ 1.0, 0.5 ], [ 2.0, 0.0 ], [ 3.0, 0.25 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.25 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.25 ], [ 15.0, 0.25 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.5 ], [ 23.0, 1.0833333333333333 ], [ 24.0, 0.25 ], [ 25.0, 0.25 ], [ 26.0, 0.75 ], [ 27.0, 1.5 ], [ 28.0, 0.25 ], [ 29.0, 0.3333333333333333 ], [ 30.0, 0.8333333333333333 ], [ 31.0, 0.75 ], [ 32.0, 0.75 ], [ 33.0, 3.8333333333333335 ], [ 34.0, 3.0 ], [ 35.0, 7.0 ], [ 36.0, 11.0 ], [ 37.0, 11.416666666666668 ], [ 38.0, 15.833333333333334 ], [ 39.0, 16.916666666666664 ], [ 40.0, 16.75 ], [ 41.0, 18.333333333333336 ], [ 42.0, 20.25 ], [ 43.0, 31.833333333333332 ], [ 44.0, 38.666666666666664 ], [ 45.0, 53.83333333333335 ], [ 46.0, 147.08333333333334 ], [ 47.0, 1378.75 ], [ 48.0, 1804.4166666666667 ], [ 49.0, 362.1666666666666 ], [ 50.0, 361.41666666666555 ], [ 51.0, 2163.3333333333267 ], [ 52.0, 14365.416666666673 ], [ 53.0, 8281.749999999998 ], [ 54.0, 1196.5 ], [ 55.0, 1205.8333333333333 ], [ 56.0, 6583.499999999996 ], [ 57.0, 3237.250000000002 ], [ 58.0, 223.58333333333334 ], [ 59.0, 32.166666666666664 ], [ 60.0, 13.333333333333334 ], [ 61.0, 8.166666666666668 ], [ 62.0, 5.833333333333333 ], [ 63.0, 6.833333333333333 ], [ 64.0, 3.083333333333333 ], [ 65.0, 0.75 ], [ 66.0, 2.0 ], [ 67.0, 1.5 ], [ 68.0, 1.5 ], [ 69.0, 0.75 ], [ 70.0, 1.0 ], [ 71.0, 0.25 ], [ 72.0, 0.75 ], [ 73.0, 0.25 ], [ 74.0, 0.75 ], [ 75.0, 1.75 ], [ 76.0, 2.5 ], [ 77.0, 1.25 ], [ 78.0, 0.75 ], [ 79.0, 0.75 ], [ 80.0, 1.75 ], [ 81.0, 1.0 ], [ 82.0, 0.5 ], [ 83.0, 1.0 ], [ 84.0, 1.25 ], [ 85.0, 0.0 ], [ 86.0, 0.3333333333333333 ], [ 87.0, 0.5833333333333333 ], [ 88.0, 0.75 ], [ 89.0, 0.25 ], [ 90.0, 0.75 ], [ 91.0, 0.25 ], [ 92.0, 0.5 ], [ 93.0, 1.25 ], [ 94.0, 1.25 ], [ 95.0, 1.25 ], [ 96.0, 1.25 ], [ 97.0, 2.0 ], [ 98.0, 3.75 ], [ 99.0, 5.75 ], [ 100.0, 25.33333333333331 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPFS1_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.5 ], [ 3.0, 0.5 ], [ 4.0, 0.25 ], [ 5.0, 0.0 ], [ 6.0, 0.25 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.25 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.25 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.25 ], [ 17.0, 0.0 ], [ 18.0, 0.25 ], [ 19.0, 0.25 ], [ 20.0, 0.25 ], [ 21.0, 0.5 ], [ 22.0, 1.0 ], [ 23.0, 1.0 ], [ 24.0, 0.75 ], [ 25.0, 1.0 ], [ 26.0, 1.25 ], [ 27.0, 1.75 ], [ 28.0, 1.3333333333333333 ], [ 29.0, 1.0833333333333333 ], [ 30.0, 2.0 ], [ 31.0, 2.5 ], [ 32.0, 3.25 ], [ 33.0, 3.0 ], [ 34.0, 3.0 ], [ 35.0, 3.25 ], [ 36.0, 5.25 ], [ 37.0, 7.25 ], [ 38.0, 10.0 ], [ 39.0, 12.25 ], [ 40.0, 16.75 ], [ 41.0, 23.416666666666664 ], [ 42.0, 26.83333333333333 ], [ 43.0, 35.416666666666664 ], [ 44.0, 36.25 ], [ 45.0, 39.333333333333336 ], [ 46.0, 48.083333333333336 ], [ 47.0, 163.66666666666669 ], [ 48.0, 237.50000000000003 ], [ 49.0, 127.91666666666664 ], [ 50.0, 183.2500000000001 ], [ 51.0, 621.0833333333343 ], [ 52.0, 8964.916666666644 ], [ 53.0, 28273.91666666662 ], [ 54.0, 7931.999999999994 ], [ 55.0, 2639.9166666666665 ], [ 56.0, 2045.5833333333321 ], [ 57.0, 1080.6666666666674 ], [ 58.0, 96.08333333333331 ], [ 59.0, 23.583333333333332 ], [ 60.0, 13.333333333333334 ], [ 61.0, 8.75 ], [ 62.0, 8.833333333333332 ], [ 63.0, 6.333333333333333 ], [ 64.0, 3.0833333333333335 ], [ 65.0, 2.5 ], [ 66.0, 2.5 ], [ 67.0, 1.25 ], [ 68.0, 1.75 ], [ 69.0, 2.833333333333333 ], [ 70.0, 1.5 ], [ 71.0, 2.75 ], [ 72.0, 2.75 ], [ 73.0, 1.5 ], [ 74.0, 1.0 ], [ 75.0, 1.75 ], [ 76.0, 1.5 ], [ 77.0, 2.0 ], [ 78.0, 0.75 ], [ 79.0, 1.0 ], [ 80.0, 0.5 ], [ 81.0, 1.0 ], [ 82.0, 1.0 ], [ 83.0, 2.083333333333333 ], [ 84.0, 1.5833333333333333 ], [ 85.0, 2.583333333333333 ], [ 86.0, 2.833333333333333 ], [ 87.0, 1.5 ], [ 88.0, 0.75 ], [ 89.0, 0.75 ], [ 90.0, 1.25 ], [ 91.0, 0.75 ], [ 92.0, 1.0 ], [ 93.0, 1.0 ], [ 94.0, 1.8333333333333333 ], [ 95.0, 1.8333333333333333 ], [ 96.0, 1.0833333333333333 ], [ 97.0, 2.25 ], [ 98.0, 4.083333333333334 ], [ 99.0, 7.083333333333333 ], [ 100.0, 39.333333333333336 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPFS2_R2", "pairs": [ [ 0.0, 0.5 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.25 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.25 ], [ 7.0, 0.25 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.25 ], [ 12.0, 0.25 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.5 ], [ 17.0, 0.5 ], [ 18.0, 0.25 ], [ 19.0, 0.25 ], [ 20.0, 0.5 ], [ 21.0, 0.5 ], [ 22.0, 0.75 ], [ 23.0, 0.3333333333333333 ], [ 24.0, 0.3333333333333333 ], [ 25.0, 1.25 ], [ 26.0, 1.0 ], [ 27.0, 0.75 ], [ 28.0, 1.5 ], [ 29.0, 2.25 ], [ 30.0, 2.25 ], [ 31.0, 4.083333333333334 ], [ 32.0, 2.333333333333333 ], [ 33.0, 3.5833333333333335 ], [ 34.0, 4.5 ], [ 35.0, 8.583333333333332 ], [ 36.0, 10.083333333333334 ], [ 37.0, 12.5 ], [ 38.0, 18.5 ], [ 39.0, 22.75 ], [ 40.0, 23.583333333333336 ], [ 41.0, 26.916666666666664 ], [ 42.0, 29.583333333333332 ], [ 43.0, 39.75 ], [ 44.0, 43.66666666666668 ], [ 45.0, 49.75000000000001 ], [ 46.0, 64.16666666666666 ], [ 47.0, 160.25 ], [ 48.0, 885.4166666666671 ], [ 49.0, 1978.2499999999986 ], [ 50.0, 2359.7499999999995 ], [ 51.0, 2996.583333333337 ], [ 52.0, 11555.833333333352 ], [ 53.0, 19586.250000000004 ], [ 54.0, 18356.833333333336 ], [ 55.0, 8554.916666666664 ], [ 56.0, 4856.249999999999 ], [ 57.0, 2530.9166666666665 ], [ 58.0, 216.41666666666669 ], [ 59.0, 34.75 ], [ 60.0, 17.083333333333336 ], [ 61.0, 7.583333333333333 ], [ 62.0, 7.0 ], [ 63.0, 14.5 ], [ 64.0, 7.25 ], [ 65.0, 3.75 ], [ 66.0, 2.25 ], [ 67.0, 1.25 ], [ 68.0, 2.75 ], [ 69.0, 2.75 ], [ 70.0, 1.75 ], [ 71.0, 1.75 ], [ 72.0, 0.5 ], [ 73.0, 0.75 ], [ 74.0, 1.25 ], [ 75.0, 2.0 ], [ 76.0, 1.25 ], [ 77.0, 1.5833333333333333 ], [ 78.0, 1.3333333333333333 ], [ 79.0, 1.75 ], [ 80.0, 1.5833333333333333 ], [ 81.0, 1.5 ], [ 82.0, 1.25 ], [ 83.0, 1.5 ], [ 84.0, 2.0 ], [ 85.0, 1.75 ], [ 86.0, 1.5833333333333333 ], [ 87.0, 1.3333333333333333 ], [ 88.0, 1.75 ], [ 89.0, 1.0 ], [ 90.0, 0.5 ], [ 91.0, 1.0 ], [ 92.0, 1.25 ], [ 93.0, 2.083333333333333 ], [ 94.0, 1.1666666666666665 ], [ 95.0, 2.333333333333333 ], [ 96.0, 2.75 ], [ 97.0, 4.25 ], [ 98.0, 3.5833333333333335 ], [ 99.0, 6.833333333333334 ], [ 100.0, 46.166666666666714 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPMS1_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.25 ], [ 2.0, 0.0 ], [ 3.0, 0.5 ], [ 4.0, 0.5 ], [ 5.0, 0.25 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.3333333333333333 ], [ 13.0, 0.3333333333333333 ], [ 14.0, 0.0 ], [ 15.0, 0.3333333333333333 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.25 ], [ 20.0, 0.75 ], [ 21.0, 0.25 ], [ 22.0, 1.0 ], [ 23.0, 0.5 ], [ 24.0, 1.3333333333333333 ], [ 25.0, 1.0833333333333333 ], [ 26.0, 1.0 ], [ 27.0, 3.0 ], [ 28.0, 2.25 ], [ 29.0, 3.0 ], [ 30.0, 2.75 ], [ 31.0, 2.5 ], [ 32.0, 4.5 ], [ 33.0, 6.5 ], [ 34.0, 9.833333333333332 ], [ 35.0, 16.666666666666664 ], [ 36.0, 27.166666666666668 ], [ 37.0, 34.25 ], [ 38.0, 37.75 ], [ 39.0, 43.66666666666667 ], [ 40.0, 44.666666666666664 ], [ 41.0, 52.16666666666667 ], [ 42.0, 59.16666666666667 ], [ 43.0, 70.33333333333333 ], [ 44.0, 74.66666666666666 ], [ 45.0, 86.49999999999997 ], [ 46.0, 155.25000000000006 ], [ 47.0, 1034.0 ], [ 48.0, 1533.2499999999995 ], [ 49.0, 1203.7500000000002 ], [ 50.0, 1883.8333333333164 ], [ 51.0, 7600.083333333248 ], [ 52.0, 51231.333333333394 ], [ 53.0, 31770.583333333263 ], [ 54.0, 7961.083333333313 ], [ 55.0, 5890.749999999996 ], [ 56.0, 2443.6666666666665 ], [ 57.0, 921.0833333333338 ], [ 58.0, 141.16666666666666 ], [ 59.0, 41.0 ], [ 60.0, 25.833333333333336 ], [ 61.0, 14.416666666666666 ], [ 62.0, 10.666666666666666 ], [ 63.0, 18.75 ], [ 64.0, 14.583333333333334 ], [ 65.0, 6.5 ], [ 66.0, 3.0 ], [ 67.0, 1.5 ], [ 68.0, 2.5 ], [ 69.0, 2.8333333333333335 ], [ 70.0, 1.75 ], [ 71.0, 2.0 ], [ 72.0, 4.0 ], [ 73.0, 3.0 ], [ 74.0, 3.083333333333333 ], [ 75.0, 3.333333333333333 ], [ 76.0, 2.5 ], [ 77.0, 2.75 ], [ 78.0, 2.75 ], [ 79.0, 1.0 ], [ 80.0, 1.25 ], [ 81.0, 2.0 ], [ 82.0, 2.833333333333333 ], [ 83.0, 2.083333333333333 ], [ 84.0, 1.0 ], [ 85.0, 0.75 ], [ 86.0, 1.75 ], [ 87.0, 1.75 ], [ 88.0, 1.4166666666666665 ], [ 89.0, 1.0 ], [ 90.0, 2.083333333333333 ], [ 91.0, 1.3333333333333333 ], [ 92.0, 2.083333333333333 ], [ 93.0, 1.75 ], [ 94.0, 3.25 ], [ 95.0, 2.5 ], [ 96.0, 4.583333333333333 ], [ 97.0, 6.0 ], [ 98.0, 8.333333333333334 ], [ 99.0, 14.166666666666668 ], [ 100.0, 75.50000000000001 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPMS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.5 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.25 ], [ 5.0, 0.5 ], [ 6.0, 0.25 ], [ 7.0, 0.25 ], [ 8.0, 0.25 ], [ 9.0, 0.5 ], [ 10.0, 0.25 ], [ 11.0, 0.25 ], [ 12.0, 0.25 ], [ 13.0, 0.25 ], [ 14.0, 0.0 ], [ 15.0, 0.25 ], [ 16.0, 0.5 ], [ 17.0, 0.25 ], [ 18.0, 0.0 ], [ 19.0, 0.25 ], [ 20.0, 0.25 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.25 ], [ 24.0, 0.5 ], [ 25.0, 0.75 ], [ 26.0, 1.25 ], [ 27.0, 1.25 ], [ 28.0, 1.0 ], [ 29.0, 0.75 ], [ 30.0, 3.083333333333333 ], [ 31.0, 1.75 ], [ 32.0, 5.333333333333334 ], [ 33.0, 6.416666666666667 ], [ 34.0, 6.666666666666667 ], [ 35.0, 8.166666666666666 ], [ 36.0, 13.833333333333334 ], [ 37.0, 19.75 ], [ 38.0, 27.666666666666668 ], [ 39.0, 28.666666666666664 ], [ 40.0, 39.83333333333333 ], [ 41.0, 37.916666666666664 ], [ 42.0, 40.083333333333336 ], [ 43.0, 45.75 ], [ 44.0, 55.33333333333333 ], [ 45.0, 69.33333333333333 ], [ 46.0, 121.33333333333333 ], [ 47.0, 988.0000000000001 ], [ 48.0, 1639.083333333333 ], [ 49.0, 1141.5833333333333 ], [ 50.0, 1340.6666666666663 ], [ 51.0, 2730.833333333337 ], [ 52.0, 16406.1666666667 ], [ 53.0, 24875.999999999964 ], [ 54.0, 14219.666666666686 ], [ 55.0, 13306.91666666667 ], [ 56.0, 2664.416666666667 ], [ 57.0, 499.4166666666666 ], [ 58.0, 79.58333333333333 ], [ 59.0, 22.5 ], [ 60.0, 13.083333333333332 ], [ 61.0, 8.75 ], [ 62.0, 6.0 ], [ 63.0, 6.25 ], [ 64.0, 4.083333333333333 ], [ 65.0, 2.833333333333333 ], [ 66.0, 2.333333333333333 ], [ 67.0, 2.583333333333333 ], [ 68.0, 2.5 ], [ 69.0, 1.0 ], [ 70.0, 2.25 ], [ 71.0, 2.25 ], [ 72.0, 1.25 ], [ 73.0, 2.25 ], [ 74.0, 1.75 ], [ 75.0, 1.25 ], [ 76.0, 0.75 ], [ 77.0, 0.25 ], [ 78.0, 1.25 ], [ 79.0, 1.0 ], [ 80.0, 1.5 ], [ 81.0, 1.25 ], [ 82.0, 1.5 ], [ 83.0, 1.0833333333333333 ], [ 84.0, 1.25 ], [ 85.0, 1.0 ], [ 86.0, 0.75 ], [ 87.0, 0.0 ], [ 88.0, 1.0833333333333333 ], [ 89.0, 2.083333333333333 ], [ 90.0, 1.75 ], [ 91.0, 1.0 ], [ 92.0, 1.8333333333333333 ], [ 93.0, 1.3333333333333333 ], [ 94.0, 1.5 ], [ 95.0, 1.0 ], [ 96.0, 2.75 ], [ 97.0, 3.5833333333333335 ], [ 98.0, 4.166666666666666 ], [ 99.0, 7.666666666666667 ], [ 100.0, 36.499999999999986 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVFS1_R2", "pairs": [ [ 0.0, 0.5 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.25 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.25 ], [ 9.0, 0.25 ], [ 10.0, 0.25 ], [ 11.0, 0.25 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.25 ], [ 16.0, 0.0 ], [ 17.0, 0.5833333333333333 ], [ 18.0, 0.25 ], [ 19.0, 0.25 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.25 ], [ 23.0, 1.0 ], [ 24.0, 0.5 ], [ 25.0, 1.0 ], [ 26.0, 1.25 ], [ 27.0, 1.0 ], [ 28.0, 1.5 ], [ 29.0, 2.5 ], [ 30.0, 5.333333333333333 ], [ 31.0, 3.0833333333333335 ], [ 32.0, 4.083333333333333 ], [ 33.0, 5.833333333333334 ], [ 34.0, 6.916666666666667 ], [ 35.0, 13.75 ], [ 36.0, 21.75 ], [ 37.0, 30.75 ], [ 38.0, 35.583333333333336 ], [ 39.0, 38.66666666666667 ], [ 40.0, 41.91666666666667 ], [ 41.0, 43.5 ], [ 42.0, 43.25 ], [ 43.0, 43.33333333333333 ], [ 44.0, 51.58333333333334 ], [ 45.0, 65.66666666666666 ], [ 46.0, 88.41666666666666 ], [ 47.0, 342.0833333333333 ], [ 48.0, 474.0833333333333 ], [ 49.0, 309.9166666666665 ], [ 50.0, 723.4166666666706 ], [ 51.0, 5020.166666666666 ], [ 52.0, 33492.74999999998 ], [ 53.0, 26301.249999999964 ], [ 54.0, 7103.6666666666615 ], [ 55.0, 864.7500000000001 ], [ 56.0, 237.25 ], [ 57.0, 134.41666666666669 ], [ 58.0, 39.75 ], [ 59.0, 20.666666666666668 ], [ 60.0, 11.083333333333334 ], [ 61.0, 7.0 ], [ 62.0, 4.833333333333333 ], [ 63.0, 4.833333333333333 ], [ 64.0, 2.75 ], [ 65.0, 2.333333333333333 ], [ 66.0, 2.0 ], [ 67.0, 4.333333333333333 ], [ 68.0, 1.25 ], [ 69.0, 2.083333333333333 ], [ 70.0, 2.75 ], [ 71.0, 2.5 ], [ 72.0, 1.25 ], [ 73.0, 0.75 ], [ 74.0, 2.5 ], [ 75.0, 2.25 ], [ 76.0, 0.25 ], [ 77.0, 0.75 ], [ 78.0, 1.0 ], [ 79.0, 0.5 ], [ 80.0, 2.0 ], [ 81.0, 1.5 ], [ 82.0, 0.25 ], [ 83.0, 0.75 ], [ 84.0, 1.3333333333333333 ], [ 85.0, 1.25 ], [ 86.0, 0.5 ], [ 87.0, 0.75 ], [ 88.0, 1.0833333333333333 ], [ 89.0, 1.3333333333333333 ], [ 90.0, 1.25 ], [ 91.0, 2.0 ], [ 92.0, 1.5 ], [ 93.0, 2.4166666666666665 ], [ 94.0, 3.25 ], [ 95.0, 1.75 ], [ 96.0, 1.5 ], [ 97.0, 3.5 ], [ 98.0, 5.5 ], [ 99.0, 7.083333333333333 ], [ 100.0, 48.666666666666735 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVFS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.25 ], [ 3.0, 0.25 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.25 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.25 ], [ 13.0, 0.25 ], [ 14.0, 0.25 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.5 ], [ 19.0, 0.25 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.5 ], [ 23.0, 0.25 ], [ 24.0, 0.0 ], [ 25.0, 0.5 ], [ 26.0, 0.75 ], [ 27.0, 1.5 ], [ 28.0, 0.25 ], [ 29.0, 1.0 ], [ 30.0, 1.0 ], [ 31.0, 1.0 ], [ 32.0, 1.5833333333333333 ], [ 33.0, 3.583333333333333 ], [ 34.0, 2.5 ], [ 35.0, 3.25 ], [ 36.0, 5.5 ], [ 37.0, 7.75 ], [ 38.0, 12.166666666666668 ], [ 39.0, 11.5 ], [ 40.0, 14.916666666666668 ], [ 41.0, 22.91666666666666 ], [ 42.0, 28.333333333333318 ], [ 43.0, 27.08333333333333 ], [ 44.0, 37.83333333333334 ], [ 45.0, 51.250000000000036 ], [ 46.0, 40.00000000000001 ], [ 47.0, 42.75 ], [ 48.0, 61.66666666666668 ], [ 49.0, 82.58333333333333 ], [ 50.0, 144.41666666666663 ], [ 51.0, 527.0833333333323 ], [ 52.0, 8268.49999999995 ], [ 53.0, 25737.16666666665 ], [ 54.0, 5599.249999999998 ], [ 55.0, 665.9166666666669 ], [ 56.0, 174.25 ], [ 57.0, 61.50000000000001 ], [ 58.0, 34.08333333333333 ], [ 59.0, 30.0 ], [ 60.0, 22.5 ], [ 61.0, 12.25 ], [ 62.0, 6.583333333333333 ], [ 63.0, 4.75 ], [ 64.0, 3.3333333333333335 ], [ 65.0, 2.583333333333333 ], [ 66.0, 3.333333333333333 ], [ 67.0, 1.5833333333333333 ], [ 68.0, 0.8333333333333333 ], [ 69.0, 1.3333333333333333 ], [ 70.0, 0.5 ], [ 71.0, 1.5833333333333333 ], [ 72.0, 1.5833333333333333 ], [ 73.0, 1.0 ], [ 74.0, 2.333333333333333 ], [ 75.0, 1.3333333333333333 ], [ 76.0, 0.5 ], [ 77.0, 1.0 ], [ 78.0, 0.0 ], [ 79.0, 0.8333333333333333 ], [ 80.0, 0.5833333333333333 ], [ 81.0, 1.0 ], [ 82.0, 1.0 ], [ 83.0, 0.5 ], [ 84.0, 0.25 ], [ 85.0, 0.75 ], [ 86.0, 0.0 ], [ 87.0, 0.25 ], [ 88.0, 0.5 ], [ 89.0, 0.75 ], [ 90.0, 0.25 ], [ 91.0, 0.25 ], [ 92.0, 0.75 ], [ 93.0, 1.25 ], [ 94.0, 0.5 ], [ 95.0, 0.5 ], [ 96.0, 1.75 ], [ 97.0, 2.25 ], [ 98.0, 2.5 ], [ 99.0, 4.333333333333333 ], [ 100.0, 27.999999999999968 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVMS1_R2", "pairs": [ [ 0.0, 0.5 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.25 ], [ 10.0, 0.0 ], [ 11.0, 0.25 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.25 ], [ 20.0, 0.5 ], [ 21.0, 0.25 ], [ 22.0, 0.5833333333333333 ], [ 23.0, 1.0833333333333333 ], [ 24.0, 1.0 ], [ 25.0, 0.75 ], [ 26.0, 0.5 ], [ 27.0, 0.75 ], [ 28.0, 1.0 ], [ 29.0, 2.25 ], [ 30.0, 2.0 ], [ 31.0, 2.5 ], [ 32.0, 3.25 ], [ 33.0, 5.5 ], [ 34.0, 5.833333333333334 ], [ 35.0, 10.25 ], [ 36.0, 12.75 ], [ 37.0, 15.833333333333332 ], [ 38.0, 19.583333333333336 ], [ 39.0, 25.75 ], [ 40.0, 25.5 ], [ 41.0, 26.75 ], [ 42.0, 39.5 ], [ 43.0, 47.91666666666667 ], [ 44.0, 78.16666666666666 ], [ 45.0, 141.41666666666666 ], [ 46.0, 370.9166666666664 ], [ 47.0, 4417.5 ], [ 48.0, 5777.666666666663 ], [ 49.0, 948.6666666666673 ], [ 50.0, 514.2499999999983 ], [ 51.0, 1966.7499999999911 ], [ 52.0, 12965.583333333358 ], [ 53.0, 16010.083333333392 ], [ 54.0, 5655.5833333333285 ], [ 55.0, 1837.5833333333312 ], [ 56.0, 715.2500000000002 ], [ 57.0, 264.0 ], [ 58.0, 66.41666666666667 ], [ 59.0, 32.83333333333333 ], [ 60.0, 26.833333333333332 ], [ 61.0, 16.5 ], [ 62.0, 7.333333333333333 ], [ 63.0, 9.416666666666668 ], [ 64.0, 6.916666666666666 ], [ 65.0, 3.8333333333333335 ], [ 66.0, 2.25 ], [ 67.0, 0.75 ], [ 68.0, 2.5 ], [ 69.0, 3.0 ], [ 70.0, 1.5 ], [ 71.0, 0.5833333333333333 ], [ 72.0, 1.5 ], [ 73.0, 1.0 ], [ 74.0, 1.3333333333333333 ], [ 75.0, 1.5 ], [ 76.0, 2.0 ], [ 77.0, 1.0 ], [ 78.0, 1.25 ], [ 79.0, 1.25 ], [ 80.0, 1.25 ], [ 81.0, 1.25 ], [ 82.0, 0.75 ], [ 83.0, 1.5833333333333333 ], [ 84.0, 1.0 ], [ 85.0, 1.0 ], [ 86.0, 1.5833333333333333 ], [ 87.0, 1.3333333333333333 ], [ 88.0, 1.25 ], [ 89.0, 0.5 ], [ 90.0, 0.25 ], [ 91.0, 1.25 ], [ 92.0, 1.0 ], [ 93.0, 1.0 ], [ 94.0, 0.5 ], [ 95.0, 1.5833333333333333 ], [ 96.0, 2.0 ], [ 97.0, 3.0833333333333335 ], [ 98.0, 5.249999999999999 ], [ 99.0, 6.666666666666666 ], [ 100.0, 32.66666666666663 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVMS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.5 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.5 ], [ 25.0, 0.3333333333333333 ], [ 26.0, 1.0833333333333333 ], [ 27.0, 1.25 ], [ 28.0, 0.25 ], [ 29.0, 0.75 ], [ 30.0, 1.3333333333333333 ], [ 31.0, 1.5833333333333333 ], [ 32.0, 1.5 ], [ 33.0, 1.75 ], [ 34.0, 3.0 ], [ 35.0, 4.833333333333333 ], [ 36.0, 6.333333333333333 ], [ 37.0, 8.25 ], [ 38.0, 11.75 ], [ 39.0, 9.25 ], [ 40.0, 12.0 ], [ 41.0, 17.416666666666664 ], [ 42.0, 22.083333333333332 ], [ 43.0, 23.916666666666664 ], [ 44.0, 26.916666666666664 ], [ 45.0, 43.58333333333336 ], [ 46.0, 73.99999999999999 ], [ 47.0, 854.3333333333335 ], [ 48.0, 1155.0833333333333 ], [ 49.0, 224.66666666666669 ], [ 50.0, 187.5000000000001 ], [ 51.0, 601.7500000000003 ], [ 52.0, 7105.083333333311 ], [ 53.0, 19998.000000000007 ], [ 54.0, 4475.083333333334 ], [ 55.0, 723.0000000000002 ], [ 56.0, 227.91666666666669 ], [ 57.0, 68.5 ], [ 58.0, 16.166666666666668 ], [ 59.0, 8.666666666666666 ], [ 60.0, 5.5 ], [ 61.0, 2.75 ], [ 62.0, 3.25 ], [ 63.0, 3.583333333333333 ], [ 64.0, 2.9166666666666665 ], [ 65.0, 1.3333333333333333 ], [ 66.0, 1.3333333333333333 ], [ 67.0, 0.75 ], [ 68.0, 1.25 ], [ 69.0, 1.25 ], [ 70.0, 1.0 ], [ 71.0, 0.5 ], [ 72.0, 0.75 ], [ 73.0, 0.25 ], [ 74.0, 0.25 ], [ 75.0, 1.75 ], [ 76.0, 1.5833333333333333 ], [ 77.0, 1.3333333333333333 ], [ 78.0, 1.0 ], [ 79.0, 0.5 ], [ 80.0, 2.0 ], [ 81.0, 0.5 ], [ 82.0, 0.25 ], [ 83.0, 0.75 ], [ 84.0, 0.3333333333333333 ], [ 85.0, 0.25 ], [ 86.0, 1.3333333333333333 ], [ 87.0, 2.083333333333333 ], [ 88.0, 0.3333333333333333 ], [ 89.0, 1.25 ], [ 90.0, 0.75 ], [ 91.0, 0.75 ], [ 92.0, 1.0833333333333333 ], [ 93.0, 1.0 ], [ 94.0, 1.25 ], [ 95.0, 1.25 ], [ 96.0, 0.75 ], [ 97.0, 1.5 ], [ 98.0, 3.166666666666667 ], [ 99.0, 4.0 ], [ 100.0, 18.000000000000004 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAFS1_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.3333333333333333 ], [ 45.0, 5.999999999999998 ], [ 46.0, 32.66666666666666 ], [ 47.0, 941.25 ], [ 48.0, 965.5 ], [ 49.0, 84.91666666666667 ], [ 50.0, 80.25000000000001 ], [ 51.0, 692.3333333333328 ], [ 52.0, 7692.666666666663 ], [ 53.0, 3660.2500000000005 ], [ 54.0, 664.5833333333333 ], [ 55.0, 2379.166666666666 ], [ 56.0, 18926.000000000022 ], [ 57.0, 6637.916666666657 ], [ 58.0, 192.58333333333334 ], [ 59.0, 47.66666666666667 ], [ 60.0, 22.333333333333336 ], [ 61.0, 14.5 ], [ 62.0, 8.5 ], [ 63.0, 8.5 ], [ 64.0, 6.5 ], [ 65.0, 4.75 ], [ 66.0, 7.25 ], [ 67.0, 5.75 ], [ 68.0, 3.5 ], [ 69.0, 6.25 ], [ 70.0, 5.333333333333333 ], [ 71.0, 3.25 ], [ 72.0, 4.0 ], [ 73.0, 3.75 ], [ 74.0, 3.5 ], [ 75.0, 2.0 ], [ 76.0, 3.0833333333333335 ], [ 77.0, 3.3333333333333335 ], [ 78.0, 1.75 ], [ 79.0, 2.4166666666666665 ], [ 80.0, 1.5 ], [ 81.0, 0.9166666666666666 ], [ 82.0, 0.6666666666666666 ], [ 83.0, 2.25 ], [ 84.0, 2.083333333333333 ], [ 85.0, 1.0 ], [ 86.0, 0.5833333333333333 ], [ 87.0, 1.0833333333333333 ], [ 88.0, 0.75 ], [ 89.0, 1.25 ], [ 90.0, 2.25 ], [ 91.0, 1.25 ], [ 92.0, 1.25 ], [ 93.0, 1.0833333333333333 ], [ 94.0, 1.6666666666666665 ], [ 95.0, 1.3333333333333333 ], [ 96.0, 0.5 ], [ 97.0, 1.0 ], [ 98.0, 1.75 ], [ 99.0, 6.0 ], [ 100.0, 13.000000000000005 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAFS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.5 ], [ 43.0, 2.6666666666666665 ], [ 44.0, 3.416666666666667 ], [ 45.0, 5.083333333333333 ], [ 46.0, 29.916666666666664 ], [ 47.0, 898.25 ], [ 48.0, 908.9166666666666 ], [ 49.0, 68.16666666666666 ], [ 50.0, 44.166666666666664 ], [ 51.0, 245.4166666666667 ], [ 52.0, 2341.7500000000005 ], [ 53.0, 1063.0833333333335 ], [ 54.0, 395.8333333333333 ], [ 55.0, 2317.999999999999 ], [ 56.0, 13954.75000000003 ], [ 57.0, 4880.666666666667 ], [ 58.0, 130.91666666666663 ], [ 59.0, 33.58333333333333 ], [ 60.0, 13.583333333333334 ], [ 61.0, 8.083333333333332 ], [ 62.0, 6.583333333333333 ], [ 63.0, 6.75 ], [ 64.0, 5.75 ], [ 65.0, 4.0 ], [ 66.0, 3.25 ], [ 67.0, 3.5 ], [ 68.0, 3.5 ], [ 69.0, 2.5 ], [ 70.0, 2.25 ], [ 71.0, 1.0 ], [ 72.0, 1.25 ], [ 73.0, 1.25 ], [ 74.0, 0.75 ], [ 75.0, 0.5 ], [ 76.0, 1.3333333333333333 ], [ 77.0, 1.8333333333333333 ], [ 78.0, 1.25 ], [ 79.0, 1.75 ], [ 80.0, 1.25 ], [ 81.0, 0.25 ], [ 82.0, 1.0833333333333333 ], [ 83.0, 0.5 ], [ 84.0, 0.25 ], [ 85.0, 0.25 ], [ 86.0, 0.5 ], [ 87.0, 0.3333333333333333 ], [ 88.0, 0.5 ], [ 89.0, 0.25 ], [ 90.0, 0.5 ], [ 91.0, 0.5 ], [ 92.0, 0.5 ], [ 93.0, 0.5 ], [ 94.0, 0.5 ], [ 95.0, 0.5 ], [ 96.0, 0.75 ], [ 97.0, 0.5 ], [ 98.0, 0.5 ], [ 99.0, 4.25 ], [ 100.0, 5.666666666666665 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAMS1_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.8333333333333333 ], [ 44.0, 0.5 ], [ 45.0, 0.0 ], [ 46.0, 0.5 ], [ 47.0, 3.333333333333333 ], [ 48.0, 8.833333333333332 ], [ 49.0, 18.833333333333336 ], [ 50.0, 84.99999999999999 ], [ 51.0, 2698.000000000002 ], [ 52.0, 35528.833333333234 ], [ 53.0, 13118.91666666667 ], [ 54.0, 510.91666666666663 ], [ 55.0, 218.00000000000003 ], [ 56.0, 482.3333333333333 ], [ 57.0, 172.58333333333334 ], [ 58.0, 24.083333333333332 ], [ 59.0, 15.416666666666666 ], [ 60.0, 11.25 ], [ 61.0, 5.25 ], [ 62.0, 10.0 ], [ 63.0, 8.833333333333332 ], [ 64.0, 5.583333333333333 ], [ 65.0, 6.083333333333333 ], [ 66.0, 7.25 ], [ 67.0, 5.666666666666666 ], [ 68.0, 3.833333333333333 ], [ 69.0, 3.0 ], [ 70.0, 3.25 ], [ 71.0, 4.25 ], [ 72.0, 3.5 ], [ 73.0, 4.333333333333334 ], [ 74.0, 2.9166666666666665 ], [ 75.0, 2.0833333333333335 ], [ 76.0, 1.5833333333333333 ], [ 77.0, 2.0 ], [ 78.0, 2.1666666666666665 ], [ 79.0, 2.1666666666666665 ], [ 80.0, 1.0 ], [ 81.0, 1.0 ], [ 82.0, 2.75 ], [ 83.0, 2.25 ], [ 84.0, 1.75 ], [ 85.0, 0.75 ], [ 86.0, 1.25 ], [ 87.0, 1.25 ], [ 88.0, 1.5 ], [ 89.0, 1.25 ], [ 90.0, 0.75 ], [ 91.0, 1.25 ], [ 92.0, 1.75 ], [ 93.0, 1.25 ], [ 94.0, 1.0 ], [ 95.0, 1.0 ], [ 96.0, 1.25 ], [ 97.0, 0.5 ], [ 98.0, 2.0 ], [ 99.0, 10.333333333333332 ], [ 100.0, 16.50000000000001 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAMS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 2.333333333333333 ], [ 31.0, 1.9999999999999998 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.3333333333333333 ], [ 41.0, 0.0 ], [ 42.0, 1.8333333333333333 ], [ 43.0, 2.4166666666666665 ], [ 44.0, 4.0 ], [ 45.0, 8.666666666666666 ], [ 46.0, 12.25 ], [ 47.0, 16.416666666666664 ], [ 48.0, 22.58333333333333 ], [ 49.0, 49.75 ], [ 50.0, 128.41666666666657 ], [ 51.0, 2492.9999999999964 ], [ 52.0, 31403.749999999844 ], [ 53.0, 11475.750000000004 ], [ 54.0, 576.0833333333334 ], [ 55.0, 343.41666666666663 ], [ 56.0, 598.8333333333334 ], [ 57.0, 291.9166666666667 ], [ 58.0, 134.83333333333331 ], [ 59.0, 88.08333333333333 ], [ 60.0, 58.33333333333334 ], [ 61.0, 32.75 ], [ 62.0, 23.416666666666668 ], [ 63.0, 15.0 ], [ 64.0, 8.416666666666666 ], [ 65.0, 7.083333333333334 ], [ 66.0, 6.25 ], [ 67.0, 6.249999999999999 ], [ 68.0, 3.916666666666667 ], [ 69.0, 2.75 ], [ 70.0, 4.333333333333333 ], [ 71.0, 3.25 ], [ 72.0, 2.333333333333333 ], [ 73.0, 2.5833333333333335 ], [ 74.0, 2.25 ], [ 75.0, 3.0 ], [ 76.0, 3.0 ], [ 77.0, 1.0833333333333333 ], [ 78.0, 1.75 ], [ 79.0, 2.583333333333333 ], [ 80.0, 2.3333333333333335 ], [ 81.0, 0.8333333333333333 ], [ 82.0, 1.0 ], [ 83.0, 1.25 ], [ 84.0, 1.0 ], [ 85.0, 0.5 ], [ 86.0, 1.0 ], [ 87.0, 0.75 ], [ 88.0, 1.5 ], [ 89.0, 1.0 ], [ 90.0, 1.25 ], [ 91.0, 1.0 ], [ 92.0, 1.0 ], [ 93.0, 1.25 ], [ 94.0, 1.5 ], [ 95.0, 1.0 ], [ 96.0, 1.0 ], [ 97.0, 1.0 ], [ 98.0, 1.75 ], [ 99.0, 10.583333333333334 ], [ 100.0, 14.333333333333341 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCFS1_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.25 ], [ 2.0, 0.25 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.25 ], [ 6.0, 0.25 ], [ 7.0, 0.25 ], [ 8.0, 0.0 ], [ 9.0, 0.25 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.25 ], [ 16.0, 0.25 ], [ 17.0, 0.5 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.75 ], [ 21.0, 1.0 ], [ 22.0, 0.25 ], [ 23.0, 0.0 ], [ 24.0, 0.25 ], [ 25.0, 0.8333333333333333 ], [ 26.0, 1.3333333333333333 ], [ 27.0, 1.25 ], [ 28.0, 0.5 ], [ 29.0, 1.5 ], [ 30.0, 1.5 ], [ 31.0, 1.75 ], [ 32.0, 2.5 ], [ 33.0, 5.25 ], [ 34.0, 5.5 ], [ 35.0, 3.75 ], [ 36.0, 9.5 ], [ 37.0, 14.5 ], [ 38.0, 16.25 ], [ 39.0, 17.166666666666668 ], [ 40.0, 19.5 ], [ 41.0, 23.75 ], [ 42.0, 24.833333333333332 ], [ 43.0, 36.41666666666667 ], [ 44.0, 38.25 ], [ 45.0, 43.333333333333336 ], [ 46.0, 44.33333333333333 ], [ 47.0, 50.916666666666664 ], [ 48.0, 73.0 ], [ 49.0, 113.58333333333333 ], [ 50.0, 207.50000000000006 ], [ 51.0, 761.0000000000036 ], [ 52.0, 11989.000000000111 ], [ 53.0, 37988.33333333331 ], [ 54.0, 8431.583333333328 ], [ 55.0, 1161.4166666666665 ], [ 56.0, 265.91666666666674 ], [ 57.0, 64.83333333333334 ], [ 58.0, 23.916666666666664 ], [ 59.0, 18.083333333333336 ], [ 60.0, 11.083333333333332 ], [ 61.0, 4.0 ], [ 62.0, 2.0 ], [ 63.0, 3.25 ], [ 64.0, 3.6666666666666665 ], [ 65.0, 4.333333333333334 ], [ 66.0, 1.8333333333333333 ], [ 67.0, 1.25 ], [ 68.0, 1.0 ], [ 69.0, 2.5 ], [ 70.0, 2.5 ], [ 71.0, 1.75 ], [ 72.0, 1.0833333333333333 ], [ 73.0, 1.75 ], [ 74.0, 2.5 ], [ 75.0, 0.75 ], [ 76.0, 0.75 ], [ 77.0, 1.75 ], [ 78.0, 2.083333333333333 ], [ 79.0, 1.3333333333333333 ], [ 80.0, 1.5 ], [ 81.0, 0.5 ], [ 82.0, 0.6666666666666666 ], [ 83.0, 0.8333333333333333 ], [ 84.0, 1.5 ], [ 85.0, 1.5833333333333333 ], [ 86.0, 1.8333333333333333 ], [ 87.0, 0.5 ], [ 88.0, 1.0 ], [ 89.0, 1.0833333333333333 ], [ 90.0, 0.25 ], [ 91.0, 0.5 ], [ 92.0, 1.25 ], [ 93.0, 1.5 ], [ 94.0, 1.75 ], [ 95.0, 2.0 ], [ 96.0, 2.75 ], [ 97.0, 4.75 ], [ 98.0, 4.583333333333333 ], [ 99.0, 7.333333333333333 ], [ 100.0, 38.833333333333336 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCFS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.25 ], [ 8.0, 0.25 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.5 ], [ 22.0, 1.0 ], [ 23.0, 0.25 ], [ 24.0, 0.5 ], [ 25.0, 0.5 ], [ 26.0, 1.25 ], [ 27.0, 1.75 ], [ 28.0, 2.0 ], [ 29.0, 1.75 ], [ 30.0, 1.5 ], [ 31.0, 1.0 ], [ 32.0, 3.25 ], [ 33.0, 5.583333333333333 ], [ 34.0, 6.083333333333333 ], [ 35.0, 5.0 ], [ 36.0, 9.25 ], [ 37.0, 13.083333333333334 ], [ 38.0, 13.916666666666666 ], [ 39.0, 19.25 ], [ 40.0, 19.0 ], [ 41.0, 25.25 ], [ 42.0, 29.583333333333332 ], [ 43.0, 32.16666666666667 ], [ 44.0, 34.0 ], [ 45.0, 32.0 ], [ 46.0, 42.833333333333336 ], [ 47.0, 45.91666666666667 ], [ 48.0, 56.25 ], [ 49.0, 90.25 ], [ 50.0, 165.33333333333331 ], [ 51.0, 622.2500000000015 ], [ 52.0, 9751.166666666668 ], [ 53.0, 30957.083333333245 ], [ 54.0, 6869.249999999996 ], [ 55.0, 762.1666666666669 ], [ 56.0, 165.5 ], [ 57.0, 44.083333333333336 ], [ 58.0, 19.249999999999996 ], [ 59.0, 16.916666666666664 ], [ 60.0, 12.916666666666666 ], [ 61.0, 10.25 ], [ 62.0, 5.0 ], [ 63.0, 3.5 ], [ 64.0, 2.5 ], [ 65.0, 0.75 ], [ 66.0, 1.0 ], [ 67.0, 2.3333333333333335 ], [ 68.0, 2.8333333333333335 ], [ 69.0, 1.3333333333333333 ], [ 70.0, 1.5 ], [ 71.0, 1.8333333333333333 ], [ 72.0, 2.25 ], [ 73.0, 1.75 ], [ 74.0, 0.25 ], [ 75.0, 0.75 ], [ 76.0, 1.5 ], [ 77.0, 0.75 ], [ 78.0, 2.25 ], [ 79.0, 1.25 ], [ 80.0, 0.0 ], [ 81.0, 0.5 ], [ 82.0, 1.25 ], [ 83.0, 0.5 ], [ 84.0, 0.75 ], [ 85.0, 1.0 ], [ 86.0, 0.5 ], [ 87.0, 1.0833333333333333 ], [ 88.0, 0.5 ], [ 89.0, 0.5 ], [ 90.0, 2.0 ], [ 91.0, 2.75 ], [ 92.0, 1.0 ], [ 93.0, 0.75 ], [ 94.0, 1.5 ], [ 95.0, 2.25 ], [ 96.0, 2.0 ], [ 97.0, 2.333333333333333 ], [ 98.0, 4.75 ], [ 99.0, 6.75 ], [ 100.0, 25.666666666666643 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCMS1_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.25 ], [ 3.0, 0.0 ], [ 4.0, 0.25 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.25 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.5 ], [ 12.0, 0.25 ], [ 13.0, 0.0 ], [ 14.0, 0.25 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.25 ], [ 22.0, 0.0 ], [ 23.0, 0.5833333333333333 ], [ 24.0, 0.8333333333333333 ], [ 25.0, 0.5 ], [ 26.0, 0.0 ], [ 27.0, 0.5 ], [ 28.0, 1.25 ], [ 29.0, 2.0 ], [ 30.0, 2.0 ], [ 31.0, 2.333333333333333 ], [ 32.0, 1.0 ], [ 33.0, 2.25 ], [ 34.0, 2.75 ], [ 35.0, 5.25 ], [ 36.0, 5.75 ], [ 37.0, 8.0 ], [ 38.0, 13.25 ], [ 39.0, 14.083333333333334 ], [ 40.0, 18.5 ], [ 41.0, 19.583333333333332 ], [ 42.0, 25.499999999999993 ], [ 43.0, 41.50000000000001 ], [ 44.0, 39.25000000000001 ], [ 45.0, 38.166666666666664 ], [ 46.0, 42.75 ], [ 47.0, 58.66666666666667 ], [ 48.0, 140.33333333333331 ], [ 49.0, 281.1666666666667 ], [ 50.0, 390.5833333333333 ], [ 51.0, 791.1666666666688 ], [ 52.0, 9542.749999999995 ], [ 53.0, 29336.58333333328 ], [ 54.0, 8344.583333333325 ], [ 55.0, 2588.4166666666674 ], [ 56.0, 684.5833333333334 ], [ 57.0, 246.5833333333334 ], [ 58.0, 47.75 ], [ 59.0, 21.083333333333332 ], [ 60.0, 19.833333333333332 ], [ 61.0, 9.833333333333332 ], [ 62.0, 4.916666666666666 ], [ 63.0, 9.333333333333334 ], [ 64.0, 9.583333333333334 ], [ 65.0, 4.25 ], [ 66.0, 1.75 ], [ 67.0, 1.3333333333333333 ], [ 68.0, 2.583333333333333 ], [ 69.0, 1.25 ], [ 70.0, 1.3333333333333333 ], [ 71.0, 2.75 ], [ 72.0, 0.75 ], [ 73.0, 2.25 ], [ 74.0, 3.0 ], [ 75.0, 1.75 ], [ 76.0, 1.5 ], [ 77.0, 1.0833333333333333 ], [ 78.0, 1.0833333333333333 ], [ 79.0, 2.0 ], [ 80.0, 1.25 ], [ 81.0, 1.0 ], [ 82.0, 1.25 ], [ 83.0, 0.5833333333333333 ], [ 84.0, 1.5 ], [ 85.0, 0.75 ], [ 86.0, 0.75 ], [ 87.0, 1.25 ], [ 88.0, 0.5 ], [ 89.0, 0.75 ], [ 90.0, 0.75 ], [ 91.0, 0.5 ], [ 92.0, 0.25 ], [ 93.0, 0.8333333333333333 ], [ 94.0, 1.25 ], [ 95.0, 1.75 ], [ 96.0, 3.0 ], [ 97.0, 2.5 ], [ 98.0, 4.25 ], [ 99.0, 8.333333333333332 ], [ 100.0, 40.33333333333335 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCMS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.5 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.25 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.25 ], [ 19.0, 0.25 ], [ 20.0, 0.0 ], [ 21.0, 0.25 ], [ 22.0, 0.0 ], [ 23.0, 0.25 ], [ 24.0, 0.25 ], [ 25.0, 0.25 ], [ 26.0, 0.5 ], [ 27.0, 0.25 ], [ 28.0, 0.25 ], [ 29.0, 1.25 ], [ 30.0, 1.75 ], [ 31.0, 0.5 ], [ 32.0, 3.5000000000000004 ], [ 33.0, 8.249999999999996 ], [ 34.0, 4.999999999999999 ], [ 35.0, 5.25 ], [ 36.0, 5.499999999999999 ], [ 37.0, 10.833333333333334 ], [ 38.0, 13.25 ], [ 39.0, 14.5 ], [ 40.0, 15.583333333333334 ], [ 41.0, 21.416666666666668 ], [ 42.0, 21.833333333333332 ], [ 43.0, 25.5 ], [ 44.0, 33.41666666666666 ], [ 45.0, 41.91666666666668 ], [ 46.0, 34.50000000000001 ], [ 47.0, 71.66666666666667 ], [ 48.0, 174.16666666666677 ], [ 49.0, 286.3333333333333 ], [ 50.0, 368.5833333333333 ], [ 51.0, 745.5000000000013 ], [ 52.0, 7780.166666666633 ], [ 53.0, 21269.916666666664 ], [ 54.0, 6572.333333333328 ], [ 55.0, 2850.500000000001 ], [ 56.0, 910.3333333333337 ], [ 57.0, 306.33333333333326 ], [ 58.0, 74.16666666666667 ], [ 59.0, 26.166666666666668 ], [ 60.0, 21.25 ], [ 61.0, 8.916666666666666 ], [ 62.0, 6.416666666666666 ], [ 63.0, 7.5 ], [ 64.0, 5.0 ], [ 65.0, 1.5833333333333333 ], [ 66.0, 1.3333333333333333 ], [ 67.0, 1.25 ], [ 68.0, 1.5 ], [ 69.0, 1.3333333333333333 ], [ 70.0, 0.5833333333333333 ], [ 71.0, 0.5833333333333333 ], [ 72.0, 0.5833333333333333 ], [ 73.0, 0.0 ], [ 74.0, 0.5 ], [ 75.0, 0.0 ], [ 76.0, 1.3333333333333333 ], [ 77.0, 1.0 ], [ 78.0, 0.5 ], [ 79.0, 0.25 ], [ 80.0, 1.25 ], [ 81.0, 1.5 ], [ 82.0, 1.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.8333333333333333 ], [ 86.0, 0.8333333333333333 ], [ 87.0, 0.8333333333333333 ], [ 88.0, 1.0833333333333333 ], [ 89.0, 1.0 ], [ 90.0, 0.0 ], [ 91.0, 0.25 ], [ 92.0, 0.5 ], [ 93.0, 0.5 ], [ 94.0, 0.25 ], [ 95.0, 0.75 ], [ 96.0, 0.25 ], [ 97.0, 1.5 ], [ 98.0, 3.25 ], [ 99.0, 2.5 ], [ 100.0, 26.333333333333307 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPFS1_R2", "pairs": [ [ 0.0, 0.5 ], [ 1.0, 0.25 ], [ 2.0, 0.25 ], [ 3.0, 0.0 ], [ 4.0, 0.25 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.5 ], [ 9.0, 0.25 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.25 ], [ 13.0, 0.0 ], [ 14.0, 0.25 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.25 ], [ 18.0, 0.25 ], [ 19.0, 0.25 ], [ 20.0, 0.75 ], [ 21.0, 0.5 ], [ 22.0, 0.25 ], [ 23.0, 0.0 ], [ 24.0, 0.25 ], [ 25.0, 0.75 ], [ 26.0, 0.5833333333333333 ], [ 27.0, 1.0833333333333333 ], [ 28.0, 2.25 ], [ 29.0, 2.75 ], [ 30.0, 2.5 ], [ 31.0, 2.5 ], [ 32.0, 3.0833333333333335 ], [ 33.0, 5.0 ], [ 34.0, 6.416666666666666 ], [ 35.0, 9.666666666666666 ], [ 36.0, 11.0 ], [ 37.0, 13.0 ], [ 38.0, 16.5 ], [ 39.0, 22.5 ], [ 40.0, 25.833333333333332 ], [ 41.0, 32.33333333333333 ], [ 42.0, 32.166666666666664 ], [ 43.0, 47.66666666666667 ], [ 44.0, 53.50000000000002 ], [ 45.0, 58.66666666666667 ], [ 46.0, 55.833333333333336 ], [ 47.0, 73.75 ], [ 48.0, 100.16666666666666 ], [ 49.0, 120.66666666666667 ], [ 50.0, 229.50000000000003 ], [ 51.0, 903.1666666666692 ], [ 52.0, 15028.250000000111 ], [ 53.0, 47747.833333333416 ], [ 54.0, 9454.083333333334 ], [ 55.0, 752.6666666666667 ], [ 56.0, 687.5000000000001 ], [ 57.0, 328.16666666666663 ], [ 58.0, 34.33333333333333 ], [ 59.0, 20.333333333333332 ], [ 60.0, 11.0 ], [ 61.0, 6.833333333333333 ], [ 62.0, 5.083333333333332 ], [ 63.0, 4.333333333333333 ], [ 64.0, 3.0 ], [ 65.0, 3.5 ], [ 66.0, 1.25 ], [ 67.0, 2.1666666666666665 ], [ 68.0, 2.75 ], [ 69.0, 0.8333333333333333 ], [ 70.0, 2.25 ], [ 71.0, 1.25 ], [ 72.0, 2.5 ], [ 73.0, 2.0 ], [ 74.0, 1.0 ], [ 75.0, 1.0833333333333333 ], [ 76.0, 1.0 ], [ 77.0, 1.25 ], [ 78.0, 1.25 ], [ 79.0, 1.5 ], [ 80.0, 1.3333333333333333 ], [ 81.0, 1.3333333333333333 ], [ 82.0, 0.75 ], [ 83.0, 1.75 ], [ 84.0, 0.75 ], [ 85.0, 1.25 ], [ 86.0, 1.25 ], [ 87.0, 0.25 ], [ 88.0, 0.75 ], [ 89.0, 1.3333333333333333 ], [ 90.0, 0.75 ], [ 91.0, 0.8333333333333333 ], [ 92.0, 1.0 ], [ 93.0, 1.25 ], [ 94.0, 0.75 ], [ 95.0, 1.5833333333333333 ], [ 96.0, 2.833333333333333 ], [ 97.0, 3.333333333333333 ], [ 98.0, 3.75 ], [ 99.0, 6.5 ], [ 100.0, 35.33333333333331 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPFS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.5 ], [ 3.0, 0.25 ], [ 4.0, 0.25 ], [ 5.0, 0.5 ], [ 6.0, 0.25 ], [ 7.0, 0.5 ], [ 8.0, 0.25 ], [ 9.0, 0.0 ], [ 10.0, 0.25 ], [ 11.0, 0.25 ], [ 12.0, 0.25 ], [ 13.0, 0.75 ], [ 14.0, 0.5 ], [ 15.0, 0.0 ], [ 16.0, 0.25 ], [ 17.0, 0.5 ], [ 18.0, 1.0 ], [ 19.0, 0.0 ], [ 20.0, 0.5 ], [ 21.0, 0.25 ], [ 22.0, 0.0 ], [ 23.0, 0.5 ], [ 24.0, 0.75 ], [ 25.0, 0.75 ], [ 26.0, 0.5 ], [ 27.0, 0.75 ], [ 28.0, 1.0 ], [ 29.0, 0.75 ], [ 30.0, 2.25 ], [ 31.0, 2.25 ], [ 32.0, 2.0 ], [ 33.0, 2.75 ], [ 34.0, 3.25 ], [ 35.0, 6.75 ], [ 36.0, 11.5 ], [ 37.0, 14.75 ], [ 38.0, 18.5 ], [ 39.0, 20.0 ], [ 40.0, 21.25 ], [ 41.0, 25.5 ], [ 42.0, 30.0 ], [ 43.0, 33.416666666666664 ], [ 44.0, 31.916666666666664 ], [ 45.0, 43.916666666666664 ], [ 46.0, 44.08333333333333 ], [ 47.0, 60.416666666666664 ], [ 48.0, 79.66666666666666 ], [ 49.0, 112.41666666666667 ], [ 50.0, 225.75 ], [ 51.0, 914.8333333333358 ], [ 52.0, 13657.583333333409 ], [ 53.0, 40131.583333333314 ], [ 54.0, 7924.166666666665 ], [ 55.0, 769.4166666666667 ], [ 56.0, 895.3333333333334 ], [ 57.0, 457.9166666666666 ], [ 58.0, 49.25 ], [ 59.0, 19.25 ], [ 60.0, 8.333333333333332 ], [ 61.0, 7.666666666666667 ], [ 62.0, 3.9166666666666665 ], [ 63.0, 3.083333333333333 ], [ 64.0, 4.083333333333334 ], [ 65.0, 2.5 ], [ 66.0, 1.25 ], [ 67.0, 1.0 ], [ 68.0, 1.5 ], [ 69.0, 1.5 ], [ 70.0, 1.75 ], [ 71.0, 0.5 ], [ 72.0, 2.333333333333333 ], [ 73.0, 3.583333333333333 ], [ 74.0, 2.5 ], [ 75.0, 1.25 ], [ 76.0, 1.5 ], [ 77.0, 2.75 ], [ 78.0, 0.75 ], [ 79.0, 1.75 ], [ 80.0, 1.0 ], [ 81.0, 1.3333333333333333 ], [ 82.0, 0.5 ], [ 83.0, 0.25 ], [ 84.0, 1.5 ], [ 85.0, 2.0 ], [ 86.0, 1.9166666666666665 ], [ 87.0, 2.1666666666666665 ], [ 88.0, 1.5 ], [ 89.0, 0.5 ], [ 90.0, 0.0 ], [ 91.0, 0.5 ], [ 92.0, 1.5833333333333333 ], [ 93.0, 2.333333333333333 ], [ 94.0, 2.5 ], [ 95.0, 2.5 ], [ 96.0, 2.25 ], [ 97.0, 3.0 ], [ 98.0, 3.25 ], [ 99.0, 3.25 ], [ 100.0, 29.99999999999996 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPMS1_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.25 ], [ 4.0, 0.25 ], [ 5.0, 0.0 ], [ 6.0, 0.25 ], [ 7.0, 0.25 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.5 ], [ 14.0, 0.25 ], [ 15.0, 0.5833333333333333 ], [ 16.0, 0.25 ], [ 17.0, 0.0 ], [ 18.0, 0.3333333333333333 ], [ 19.0, 0.25 ], [ 20.0, 0.5 ], [ 21.0, 0.5 ], [ 22.0, 0.25 ], [ 23.0, 0.75 ], [ 24.0, 0.5 ], [ 25.0, 0.25 ], [ 26.0, 0.5 ], [ 27.0, 1.0 ], [ 28.0, 1.25 ], [ 29.0, 2.25 ], [ 30.0, 2.0 ], [ 31.0, 2.5 ], [ 32.0, 3.5 ], [ 33.0, 3.0 ], [ 34.0, 4.0 ], [ 35.0, 9.75 ], [ 36.0, 15.5 ], [ 37.0, 17.0 ], [ 38.0, 19.0 ], [ 39.0, 25.75 ], [ 40.0, 27.5 ], [ 41.0, 31.083333333333332 ], [ 42.0, 28.416666666666668 ], [ 43.0, 34.41666666666667 ], [ 44.0, 42.91666666666667 ], [ 45.0, 51.5 ], [ 46.0, 58.333333333333336 ], [ 47.0, 106.83333333333333 ], [ 48.0, 321.8333333333333 ], [ 49.0, 1062.3333333333335 ], [ 50.0, 1409.25 ], [ 51.0, 2538.3333333333408 ], [ 52.0, 23230.166666666584 ], [ 53.0, 27997.833333333307 ], [ 54.0, 7752.1666666666615 ], [ 55.0, 3100.583333333335 ], [ 56.0, 1002.0833333333336 ], [ 57.0, 409.41666666666663 ], [ 58.0, 52.41666666666667 ], [ 59.0, 20.583333333333332 ], [ 60.0, 12.583333333333332 ], [ 61.0, 7.5 ], [ 62.0, 4.5 ], [ 63.0, 3.0 ], [ 64.0, 6.083333333333334 ], [ 65.0, 2.583333333333333 ], [ 66.0, 2.583333333333333 ], [ 67.0, 1.75 ], [ 68.0, 2.333333333333333 ], [ 69.0, 2.0 ], [ 70.0, 2.083333333333333 ], [ 71.0, 2.333333333333333 ], [ 72.0, 3.0 ], [ 73.0, 1.75 ], [ 74.0, 1.5 ], [ 75.0, 0.8333333333333333 ], [ 76.0, 0.0 ], [ 77.0, 0.25 ], [ 78.0, 0.75 ], [ 79.0, 2.25 ], [ 80.0, 1.25 ], [ 81.0, 1.0 ], [ 82.0, 1.25 ], [ 83.0, 1.25 ], [ 84.0, 1.25 ], [ 85.0, 1.5 ], [ 86.0, 0.75 ], [ 87.0, 0.5 ], [ 88.0, 0.5 ], [ 89.0, 1.5833333333333333 ], [ 90.0, 1.0 ], [ 91.0, 0.5 ], [ 92.0, 1.5 ], [ 93.0, 1.5 ], [ 94.0, 1.0 ], [ 95.0, 2.25 ], [ 96.0, 3.5 ], [ 97.0, 2.0 ], [ 98.0, 4.25 ], [ 99.0, 5.75 ], [ 100.0, 35.33333333333331 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPMS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.25 ], [ 5.0, 0.25 ], [ 6.0, 0.0 ], [ 7.0, 0.25 ], [ 8.0, 0.25 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.5 ], [ 13.0, 0.5 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.25 ], [ 20.0, 0.25 ], [ 21.0, 0.75 ], [ 22.0, 0.75 ], [ 23.0, 0.5 ], [ 24.0, 0.25 ], [ 25.0, 0.5 ], [ 26.0, 0.5 ], [ 27.0, 1.0 ], [ 28.0, 1.5 ], [ 29.0, 2.25 ], [ 30.0, 0.5 ], [ 31.0, 0.75 ], [ 32.0, 1.5 ], [ 33.0, 2.0 ], [ 34.0, 3.25 ], [ 35.0, 4.333333333333334 ], [ 36.0, 8.5 ], [ 37.0, 11.0 ], [ 38.0, 13.75 ], [ 39.0, 16.75 ], [ 40.0, 18.833333333333336 ], [ 41.0, 20.083333333333336 ], [ 42.0, 22.166666666666664 ], [ 43.0, 30.666666666666668 ], [ 44.0, 32.75 ], [ 45.0, 30.75 ], [ 46.0, 32.166666666666664 ], [ 47.0, 51.41666666666667 ], [ 48.0, 143.83333333333334 ], [ 49.0, 366.91666666666663 ], [ 50.0, 512.1666666666665 ], [ 51.0, 1350.8333333333312 ], [ 52.0, 13326.66666666671 ], [ 53.0, 20744.41666666665 ], [ 54.0, 4969.666666666667 ], [ 55.0, 1443.8333333333333 ], [ 56.0, 552.0833333333334 ], [ 57.0, 221.33333333333337 ], [ 58.0, 39.583333333333336 ], [ 59.0, 21.666666666666664 ], [ 60.0, 15.916666666666668 ], [ 61.0, 10.583333333333334 ], [ 62.0, 4.75 ], [ 63.0, 5.5 ], [ 64.0, 4.25 ], [ 65.0, 2.0 ], [ 66.0, 1.25 ], [ 67.0, 2.0 ], [ 68.0, 1.25 ], [ 69.0, 1.5 ], [ 70.0, 1.5 ], [ 71.0, 1.8333333333333333 ], [ 72.0, 0.5 ], [ 73.0, 0.25 ], [ 74.0, 1.25 ], [ 75.0, 1.0 ], [ 76.0, 0.75 ], [ 77.0, 0.75 ], [ 78.0, 0.5 ], [ 79.0, 0.5 ], [ 80.0, 1.0 ], [ 81.0, 1.3333333333333333 ], [ 82.0, 1.0833333333333333 ], [ 83.0, 1.5833333333333333 ], [ 84.0, 1.5 ], [ 85.0, 1.0 ], [ 86.0, 1.5 ], [ 87.0, 1.5 ], [ 88.0, 0.75 ], [ 89.0, 0.75 ], [ 90.0, 1.25 ], [ 91.0, 1.5833333333333333 ], [ 92.0, 1.75 ], [ 93.0, 0.75 ], [ 94.0, 0.3333333333333333 ], [ 95.0, 2.083333333333333 ], [ 96.0, 2.583333333333333 ], [ 97.0, 2.583333333333333 ], [ 98.0, 3.75 ], [ 99.0, 6.5 ], [ 100.0, 23.499999999999986 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVFS1_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.25 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.25 ], [ 16.0, 0.25 ], [ 17.0, 0.0 ], [ 18.0, 0.25 ], [ 19.0, 0.0 ], [ 20.0, 0.25 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.5 ], [ 24.0, 0.75 ], [ 25.0, 0.25 ], [ 26.0, 0.0 ], [ 27.0, 0.25 ], [ 28.0, 1.25 ], [ 29.0, 1.75 ], [ 30.0, 1.5 ], [ 31.0, 2.25 ], [ 32.0, 1.5 ], [ 33.0, 2.0 ], [ 34.0, 2.0 ], [ 35.0, 2.833333333333333 ], [ 36.0, 6.583333333333333 ], [ 37.0, 9.25 ], [ 38.0, 10.0 ], [ 39.0, 12.083333333333334 ], [ 40.0, 10.833333333333334 ], [ 41.0, 13.0 ], [ 42.0, 21.166666666666664 ], [ 43.0, 26.999999999999996 ], [ 44.0, 24.66666666666666 ], [ 45.0, 31.749999999999996 ], [ 46.0, 30.416666666666668 ], [ 47.0, 37.083333333333336 ], [ 48.0, 64.08333333333334 ], [ 49.0, 86.49999999999999 ], [ 50.0, 132.99999999999994 ], [ 51.0, 550.6666666666666 ], [ 52.0, 7569.583333333282 ], [ 53.0, 21432.416666666646 ], [ 54.0, 4727.666666666667 ], [ 55.0, 741.916666666667 ], [ 56.0, 203.00000000000009 ], [ 57.0, 78.33333333333334 ], [ 58.0, 37.08333333333333 ], [ 59.0, 21.75 ], [ 60.0, 17.75 ], [ 61.0, 10.25 ], [ 62.0, 6.75 ], [ 63.0, 6.75 ], [ 64.0, 3.25 ], [ 65.0, 2.0 ], [ 66.0, 1.3333333333333333 ], [ 67.0, 1.0 ], [ 68.0, 1.0 ], [ 69.0, 1.3333333333333333 ], [ 70.0, 0.75 ], [ 71.0, 0.75 ], [ 72.0, 0.75 ], [ 73.0, 1.0 ], [ 74.0, 1.25 ], [ 75.0, 1.0 ], [ 76.0, 0.5833333333333333 ], [ 77.0, 0.75 ], [ 78.0, 1.25 ], [ 79.0, 1.25 ], [ 80.0, 0.25 ], [ 81.0, 0.5 ], [ 82.0, 0.5 ], [ 83.0, 0.75 ], [ 84.0, 0.5 ], [ 85.0, 0.25 ], [ 86.0, 0.5 ], [ 87.0, 1.0 ], [ 88.0, 0.5833333333333333 ], [ 89.0, 0.8333333333333333 ], [ 90.0, 0.25 ], [ 91.0, 0.5833333333333333 ], [ 92.0, 0.3333333333333333 ], [ 93.0, 1.0 ], [ 94.0, 0.75 ], [ 95.0, 0.25 ], [ 96.0, 1.0 ], [ 97.0, 2.5 ], [ 98.0, 3.75 ], [ 99.0, 5.416666666666666 ], [ 100.0, 24.66666666666665 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVFS2_R2", "pairs": [ [ 0.0, 0.5 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.75 ], [ 4.0, 0.5 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.25 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.25 ], [ 12.0, 0.25 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.25 ], [ 24.0, 0.25 ], [ 25.0, 0.75 ], [ 26.0, 0.75 ], [ 27.0, 0.25 ], [ 28.0, 0.8333333333333333 ], [ 29.0, 1.3333333333333333 ], [ 30.0, 2.5 ], [ 31.0, 2.0 ], [ 32.0, 2.333333333333333 ], [ 33.0, 3.4166666666666665 ], [ 34.0, 4.5 ], [ 35.0, 8.0 ], [ 36.0, 11.75 ], [ 37.0, 13.583333333333334 ], [ 38.0, 16.75 ], [ 39.0, 18.083333333333332 ], [ 40.0, 28.333333333333332 ], [ 41.0, 30.25 ], [ 42.0, 35.25 ], [ 43.0, 41.5 ], [ 44.0, 45.91666666666667 ], [ 45.0, 59.333333333333336 ], [ 46.0, 124.91666666666664 ], [ 47.0, 872.5833333333334 ], [ 48.0, 1180.1666666666667 ], [ 49.0, 412.99999999999994 ], [ 50.0, 680.0000000000011 ], [ 51.0, 3780.500000000015 ], [ 52.0, 20851.916666666653 ], [ 53.0, 15854.333333333348 ], [ 54.0, 3989.083333333335 ], [ 55.0, 826.6666666666667 ], [ 56.0, 515.3333333333333 ], [ 57.0, 233.5 ], [ 58.0, 44.75 ], [ 59.0, 15.250000000000002 ], [ 60.0, 10.583333333333334 ], [ 61.0, 5.833333333333333 ], [ 62.0, 4.333333333333333 ], [ 63.0, 1.75 ], [ 64.0, 3.5 ], [ 65.0, 2.5 ], [ 66.0, 2.75 ], [ 67.0, 2.5833333333333335 ], [ 68.0, 1.0833333333333333 ], [ 69.0, 1.5 ], [ 70.0, 2.0 ], [ 71.0, 1.25 ], [ 72.0, 1.0 ], [ 73.0, 1.25 ], [ 74.0, 1.8333333333333333 ], [ 75.0, 1.0 ], [ 76.0, 0.25 ], [ 77.0, 0.75 ], [ 78.0, 1.25 ], [ 79.0, 0.75 ], [ 80.0, 1.0 ], [ 81.0, 1.0 ], [ 82.0, 2.0 ], [ 83.0, 0.75 ], [ 84.0, 0.5 ], [ 85.0, 1.0833333333333333 ], [ 86.0, 0.8333333333333333 ], [ 87.0, 0.25 ], [ 88.0, 0.5 ], [ 89.0, 0.5 ], [ 90.0, 0.75 ], [ 91.0, 0.5 ], [ 92.0, 0.25 ], [ 93.0, 2.5833333333333335 ], [ 94.0, 2.75 ], [ 95.0, 2.25 ], [ 96.0, 1.5833333333333333 ], [ 97.0, 4.166666666666666 ], [ 98.0, 5.083333333333333 ], [ 99.0, 5.75 ], [ 100.0, 24.66666666666665 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVMS1_R2", "pairs": [ [ 0.0, 0.5 ], [ 1.0, 0.25 ], [ 2.0, 0.25 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.25 ], [ 7.0, 0.25 ], [ 8.0, 0.25 ], [ 9.0, 0.5 ], [ 10.0, 0.5 ], [ 11.0, 0.0 ], [ 12.0, 0.25 ], [ 13.0, 0.5 ], [ 14.0, 0.25 ], [ 15.0, 0.0 ], [ 16.0, 0.5 ], [ 17.0, 0.75 ], [ 18.0, 0.5 ], [ 19.0, 0.5 ], [ 20.0, 0.5 ], [ 21.0, 1.3333333333333333 ], [ 22.0, 2.083333333333333 ], [ 23.0, 0.75 ], [ 24.0, 1.25 ], [ 25.0, 1.0 ], [ 26.0, 1.0 ], [ 27.0, 1.0 ], [ 28.0, 0.75 ], [ 29.0, 1.5 ], [ 30.0, 4.25 ], [ 31.0, 3.5 ], [ 32.0, 3.333333333333333 ], [ 33.0, 4.583333333333333 ], [ 34.0, 6.416666666666666 ], [ 35.0, 10.25 ], [ 36.0, 16.583333333333336 ], [ 37.0, 22.5 ], [ 38.0, 33.5 ], [ 39.0, 39.25 ], [ 40.0, 39.5 ], [ 41.0, 45.50000000000001 ], [ 42.0, 50.16666666666667 ], [ 43.0, 60.50000000000001 ], [ 44.0, 65.41666666666666 ], [ 45.0, 74.74999999999997 ], [ 46.0, 89.16666666666666 ], [ 47.0, 265.16666666666663 ], [ 48.0, 405.4166666666667 ], [ 49.0, 500.58333333333286 ], [ 50.0, 721.4166666666673 ], [ 51.0, 1718.416666666659 ], [ 52.0, 20634.083333333267 ], [ 53.0, 64604.58333333363 ], [ 54.0, 16150.500000000027 ], [ 55.0, 4951.166666666666 ], [ 56.0, 2112.33333333333 ], [ 57.0, 722.7500000000005 ], [ 58.0, 149.41666666666666 ], [ 59.0, 54.833333333333336 ], [ 60.0, 43.58333333333333 ], [ 61.0, 26.0 ], [ 62.0, 15.5 ], [ 63.0, 17.5 ], [ 64.0, 9.75 ], [ 65.0, 5.0 ], [ 66.0, 4.416666666666666 ], [ 67.0, 3.083333333333333 ], [ 68.0, 3.0 ], [ 69.0, 1.75 ], [ 70.0, 2.5 ], [ 71.0, 3.0 ], [ 72.0, 1.75 ], [ 73.0, 1.75 ], [ 74.0, 3.3333333333333335 ], [ 75.0, 2.5 ], [ 76.0, 2.25 ], [ 77.0, 1.25 ], [ 78.0, 1.75 ], [ 79.0, 2.25 ], [ 80.0, 2.25 ], [ 81.0, 1.5 ], [ 82.0, 3.833333333333333 ], [ 83.0, 2.833333333333333 ], [ 84.0, 2.0 ], [ 85.0, 1.25 ], [ 86.0, 0.25 ], [ 87.0, 1.0833333333333333 ], [ 88.0, 1.75 ], [ 89.0, 2.5 ], [ 90.0, 2.5833333333333335 ], [ 91.0, 3.3333333333333335 ], [ 92.0, 3.25 ], [ 93.0, 3.75 ], [ 94.0, 2.5 ], [ 95.0, 2.0 ], [ 96.0, 4.5 ], [ 97.0, 3.5833333333333335 ], [ 98.0, 4.166666666666667 ], [ 99.0, 12.25 ], [ 100.0, 67.83333333333346 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVMS2_R2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.25 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.25 ], [ 7.0, 0.25 ], [ 8.0, 0.25 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.25 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.25 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.5 ], [ 22.0, 0.75 ], [ 23.0, 0.25 ], [ 24.0, 0.0 ], [ 25.0, 0.25 ], [ 26.0, 1.0 ], [ 27.0, 1.0 ], [ 28.0, 0.5 ], [ 29.0, 0.5 ], [ 30.0, 0.25 ], [ 31.0, 0.75 ], [ 32.0, 1.75 ], [ 33.0, 1.5 ], [ 34.0, 1.0 ], [ 35.0, 4.5 ], [ 36.0, 5.666666666666666 ], [ 37.0, 7.166666666666666 ], [ 38.0, 9.0 ], [ 39.0, 10.75 ], [ 40.0, 14.0 ], [ 41.0, 16.333333333333336 ], [ 42.0, 18.5 ], [ 43.0, 25.333333333333332 ], [ 44.0, 35.83333333333333 ], [ 45.0, 45.416666666666664 ], [ 46.0, 97.0 ], [ 47.0, 725.0 ], [ 48.0, 984.1666666666666 ], [ 49.0, 351.9166666666666 ], [ 50.0, 358.91666666666663 ], [ 51.0, 901.8333333333345 ], [ 52.0, 6648.249999999985 ], [ 53.0, 18620.00000000001 ], [ 54.0, 5773.416666666668 ], [ 55.0, 2244.5833333333326 ], [ 56.0, 946.0833333333338 ], [ 57.0, 538.1666666666666 ], [ 58.0, 118.16666666666667 ], [ 59.0, 29.499999999999996 ], [ 60.0, 16.25 ], [ 61.0, 6.75 ], [ 62.0, 4.25 ], [ 63.0, 9.333333333333332 ], [ 64.0, 6.083333333333333 ], [ 65.0, 2.5 ], [ 66.0, 1.25 ], [ 67.0, 2.1666666666666665 ], [ 68.0, 1.0833333333333333 ], [ 69.0, 1.0 ], [ 70.0, 2.0 ], [ 71.0, 2.5 ], [ 72.0, 1.8333333333333333 ], [ 73.0, 1.3333333333333333 ], [ 74.0, 1.0 ], [ 75.0, 0.75 ], [ 76.0, 0.3333333333333333 ], [ 77.0, 0.75 ], [ 78.0, 1.25 ], [ 79.0, 1.0 ], [ 80.0, 0.25 ], [ 81.0, 1.0 ], [ 82.0, 0.5 ], [ 83.0, 1.0 ], [ 84.0, 0.25 ], [ 85.0, 1.75 ], [ 86.0, 0.25 ], [ 87.0, 0.75 ], [ 88.0, 1.5 ], [ 89.0, 0.5 ], [ 90.0, 0.8333333333333333 ], [ 91.0, 1.1666666666666665 ], [ 92.0, 1.3333333333333333 ], [ 93.0, 1.25 ], [ 94.0, 1.25 ], [ 95.0, 1.25 ], [ 96.0, 2.5 ], [ 97.0, 2.5833333333333335 ], [ 98.0, 3.8333333333333335 ], [ 99.0, 6.75 ], [ 100.0, 21.166666666666657 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null } ] } ], "pconfig": { "id": "fastqc_per_sequence_gc_content_plot", "title": "FastQC: Per Sequence GC Content", "anchor": null, "table_title": null, "height": null, "width": null, "square": false, "logswitch": false, "logswitch_active": false, "logswitch_label": "Log10", "cpswitch": true, "cpswitch_c_active": true, "cpswitch_counts_label": "Counts", "cpswitch_percent_label": "Percentages", "xLog": null, "yLog": null, "xlog": false, "ylog": false, "data_labels": [ { "name": "Percentages", "ylab": "Percentage", "tt_suffix": "%", "title": "FastQC: Per Sequence GC Content
Percentages, 64 samples" }, { "name": "Counts", "ylab": "Count", "tt_suffix": "", "title": "FastQC: Per Sequence GC Content
Counts, 64 samples" } ], "xTitle": null, "yTitle": null, "xlab": "% GC", "ylab": "Percentage", "xsuffix": null, "ysuffix": null, "tt_suffix": null, "xLabFormat": null, "yLabFormat": null, "xLabelFormat": null, "yLabelFormat": null, "xlab_format": null, "ylab_format": null, "tt_label": "{point.x}% GC: {point.y}", "xDecimals": null, "yDecimals": null, "decimalPlaces": null, "x_decimals": null, "y_decimals": null, "tt_decimals": null, "xmin": 0, "xmax": 100, "ymin": 0, "ymax": null, "xFloor": null, "xCeiling": null, "yFloor": null, "yCeiling": null, "x_clipmin": null, "x_clipmax": null, "y_clipmin": null, "y_clipmax": null, "save_data_file": true, "showlegend": false, "xMinRange": null, "yMinRange": null, "x_minrange": null, "y_minrange": null, "xPlotBands": null, "yPlotBands": null, "xPlotLines": null, "yPlotLines": null, "x_bands": null, "y_bands": null, "x_lines": null, "y_lines": null, "categories": false, "smooth_points": 500, "smooth_points_sumcounts": null, "extra_series": null, "style": null, "hide_zero_cats": false, "hide_empty": false, "colors": { "CAFS1_R2": "#d9534f", "CAFS2_R2": "#d9534f", "CAMS1_R2": "#d9534f", "CAMS2_R2": "#d9534f", "CCFS1_R2": "#d9534f", "CCFS2_R2": "#d9534f", "CCMS1_R2": "#d9534f", "CCMS2_R2": "#d9534f", "CPFS1_R2": "#d9534f", "CPFS2_R2": "#d9534f", "CPMS1_R2": "#d9534f", "CPMS2_R2": "#d9534f", "CVFS1_R2": "#d9534f", "CVFS2_R2": "#d9534f", "CVMS1_R2": "#d9534f", "CVMS2_R2": "#d9534f", "DAFS1_R2": "#d9534f", "DAFS2_R2": "#d9534f", "DAMS1_R2": "#d9534f", "DAMS2_R2": "#d9534f", "DCFS1_R2": "#d9534f", "DCFS2_R2": "#d9534f", "DCMS1_R2": "#d9534f", "DCMS2_R2": "#d9534f", "DPFS1_R2": "#d9534f", "DPFS2_R2": "#d9534f", "DPMS1_R2": "#d9534f", "DPMS2_R2": "#d9534f", "DVFS1_R2": "#d9534f", "DVFS2_R2": "#d9534f", "DVMS1_R2": "#d9534f", "DVMS2_R2": "#d9534f", "IAFS1_R2": "#d9534f", "IAFS2_R2": "#d9534f", "IAMS1_R2": "#d9534f", "IAMS2_R2": "#d9534f", "ICFS1_R2": "#d9534f", "ICFS2_R2": "#d9534f", "ICMS1_R2": "#d9534f", "ICMS2_R2": "#d9534f", "IPFS1_R2": "#d9534f", "IPFS2_R2": "#d9534f", "IPMS1_R2": "#d9534f", "IPMS2_R2": "#d9534f", "IVFS1_R2": "#d9534f", "IVFS2_R2": "#d9534f", "IVMS1_R2": "#d9534f", "IVMS2_R2": "#d9534f", "JAFS1_R2": "#d9534f", "JAFS2_R2": "#d9534f", "JAMS1_R2": "#d9534f", "JAMS2_R2": "#d9534f", "JCFS1_R2": "#d9534f", "JCFS2_R2": "#d9534f", "JCMS1_R2": "#d9534f", "JCMS2_R2": "#d9534f", "JPFS1_R2": "#d9534f", "JPFS2_R2": "#d9534f", "JPMS1_R2": "#d9534f", "JPMS2_R2": "#d9534f", "JVFS1_R2": "#d9534f", "JVFS2_R2": "#d9534f", "JVMS1_R2": "#d9534f", "JVMS2_R2": "#d9534f" } }, "add_log_tab": false, "add_pct_tab": false, "l_active": false, "p_active": false, "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "yaxis" ], "square": false, "flat": false, "defer_render": false }, "fastqc_per_base_n_content_plot": { "id": "fastqc_per_base_n_content_plot", "anchor": "fastqc_per_base_n_content_plot", "plot_type": "xy_line", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 500, "hoverlabel": { "namelength": -1 }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "white", "plot_bgcolor": "white", "showlegend": false, "title": { "font": { "size": 20 }, "text": "FastQC: Per Base N Content", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "shapes": [ { "fillcolor": "#e6c3c3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 20, "y1": 100 }, { "fillcolor": "#e6dcc3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 5, "y1": 20 }, { "fillcolor": "#c3e6c3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 0, "y1": 5 }, { "fillcolor": "#e6c3c3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 20, "y1": 100 }, { "fillcolor": "#e6dcc3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 5, "y1": 20 }, { "fillcolor": "#c3e6c3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 0, "y1": 5 } ], "hoverdistance": -1 }, "datasets": [ { "plot_id": "fastqc_per_base_n_content_plot", "label": "1", "uid": "fastqc_per_base_n_content_plot", "dconfig": { "title": "FastQC: Per Base N Content
64 samples" }, "layout": { "title": { "text": "FastQC: Per Base N Content
64 samples" }, "xaxis": { "hoverformat": null, "ticksuffix": " bp", "title": { "text": "Position in Read (bp)" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": null } }, "yaxis": { "hoverformat": null, "ticksuffix": "%", "title": { "text": "Percentage N-Count" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": 100, "minallowed": 0, "maxallowed": null }, "range": [ 0, 5 ] } }, "trace_params": { "hovertemplate": "%{text}
Base %{x}: %{y:.2f}%", "mode": "lines", "line": { "width": 2 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "n_samples": 64, "lines": [ { "name": "CAFS1_R2", "pairs": [ [ 1, 0.0012199510799616935 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0002439917042820544 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.00024399616926014264 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.630001951981261 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0001219995730014945 ], [ 245, 1.8818434135480524 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.00012200031720082471 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAFS2_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.00013206201632286522 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.6509336784554027 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 1.9311556163044843 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.00013206376038351315 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.00013206376038351315 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0005978787262791615 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAMS1_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.00013607849007307414 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.6420183161647638 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 1.900880427830773 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAMS2_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.00023913004489666592 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.00047826237713140615 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.6334706371174575 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0003587100785575072 ], [ 245, 1.906785487529429 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0003587186569573484 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCFS1_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 9.230286415787481e-05 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.00027690859247362444 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.00018461714557892707 ], [ 190, 9.231138476308284e-05 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.00018462362166927446 ], [ 210, 1.9019925504368658 ], [ 215, 0.0003692472433385489 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 9.231479344564967e-05 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 9.23152195486709e-05 ], [ 265, 0.0 ], [ 270, 0.0003692608781946836 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 9.231735012278208e-05 ], [ 290, 0.00055390768020694 ], [ 295, 9.234445960945681e-05 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCFS2_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 9.853187506158242e-05 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.000295601741685462 ], [ 140, 9.853469061585167e-05 ], [ 145, 0.0 ], [ 150, 0.0005912128040927692 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 9.853944829733687e-05 ], [ 170, 0.00039416633819471815 ], [ 175, 0.0 ], [ 180, 0.00029562621021979806 ], [ 185, 0.00029562883208873595 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 9.854449776796713e-05 ], [ 205, 0.0005912669866078027 ], [ 210, 1.928023098830277 ], [ 215, 0.0003941779910718685 ], [ 220, 0.0 ], [ 225, 0.0001970990955122507 ], [ 230, 0.0 ], [ 235, 0.0002956681657042668 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0003942339344743778 ], [ 255, 0.0 ], [ 260, 9.855858075643711e-05 ], [ 265, 0.00019711832717502826 ], [ 270, 0.0003942401513882181 ], [ 275, 0.00019713251050223452 ], [ 280, 0.00019713795122412812 ], [ 285, 0.0002957095501370614 ], [ 290, 0.0006899957515975866 ], [ 295, 0.00029587958095561215 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCMS1_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.00019049342559564913 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 9.524852721964787e-05 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 1.8991603842325586 ], [ 215, 9.524852721964787e-05 ], [ 220, 0.00019049705443929574 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 9.525052316349847e-05 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 9.525079534414113e-05 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 9.525215627068757e-05 ], [ 275, 0.0 ], [ 280, 9.52525191910013e-05 ], [ 285, 9.525260992151186e-05 ], [ 290, 9.525342650388492e-05 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCMS2_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.00010156841953445099 ], [ 140, 0.00010156924483266466 ], [ 145, 0.0 ], [ 150, 0.00030470897246040305 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.00010156976065085902 ], [ 170, 0.0003047092819525771 ], [ 175, 0.0 ], [ 180, 0.00010156976065085902 ], [ 185, 0.0004062827565472466 ], [ 190, 0.00010157130813687751 ], [ 195, 0.00010157130813687751 ], [ 200, 0.00020314261627375502 ], [ 205, 0.0006094284678257319 ], [ 210, 1.933216525735761 ], [ 215, 0.0006094328008922097 ], [ 220, 0.0005078616991021005 ], [ 225, 0.00010157326835352779 ], [ 230, 0.0001015744032503809 ], [ 235, 0.000101574609597988 ], [ 240, 0.0002031498382419413 ], [ 245, 0.0 ], [ 250, 0.00030472692404579844 ], [ 255, 0.0 ], [ 260, 0.00010157646676418009 ], [ 265, 0.0003047297098262127 ], [ 270, 0.0006094637531590538 ], [ 275, 0.00010157749855252064 ], [ 280, 0.00040631329599314145 ], [ 285, 0.00010157925264080663 ], [ 290, 0.0011173808592658807 ], [ 295, 0.00020321589148271396 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPFS1_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.00013361570786261633 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 1.9096679361261444 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPFS2_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.00033483637662395645 ], [ 35, 0.0003348408612999862 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.00011162084630925673 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.00011162520720429088 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 1.8956298487470002 ], [ 215, 0.0 ], [ 220, 0.00011162583021711224 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.00011162894538553847 ], [ 255, 0.0 ], [ 260, 0.00011162944382862202 ], [ 265, 0.0 ], [ 270, 0.00011162956844008841 ], [ 275, 0.00011163131302983013 ], [ 280, 0.00033491375412641653 ], [ 285, 0.0 ], [ 290, 0.00011164078461143426 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPMS1_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.00035410608132931424 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 8.852777426125785e-05 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 8.852894985189106e-05 ], [ 210, 1.8958541745974131 ], [ 215, 0.00017705852669599935 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 8.853435797096957e-05 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.00017707561394328798 ], [ 275, 0.0 ], [ 280, 8.854062908116962e-05 ], [ 285, 8.854133463666178e-05 ], [ 290, 0.0002656270613766742 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPMS2_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.00019533443697290222 ], [ 35, 9.766779082293903e-05 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.00029301596448646507 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.00019534397632431008 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0002930294162463322 ], [ 190, 9.767952519936391e-05 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0002930388618370606 ], [ 210, 1.883165405785564 ], [ 215, 0.00039071848244941415 ], [ 220, 0.00019535924122470708 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.00019536592036885084 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 9.768343728479119e-05 ], [ 265, 9.768343728479119e-05 ], [ 270, 0.00039073374913916475 ], [ 275, 9.768391438981744e-05 ], [ 280, 0.00019537718053144545 ], [ 285, 0.0 ], [ 290, 0.0003907711575716308 ], [ 295, 9.771570007924743e-05 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVFS1_R2", "pairs": [ [ 1, 0.00045578435930392617 ], [ 2, 0.00045578435930392617 ], [ 3, 0.00045578435930392617 ], [ 4, 0.00045578435930392617 ], [ 5, 0.00045578435930392617 ], [ 6, 0.00045578435930392617 ], [ 7, 0.00045578435930392617 ], [ 8, 0.00045578435930392617 ], [ 9, 0.00045578435930392617 ], [ 10, 0.00045578435930392617 ], [ 15, 0.00045578435930392617 ], [ 20, 0.00045578435930392617 ], [ 25, 0.00045578435930392617 ], [ 30, 0.00045578435930392617 ], [ 35, 9.115720424500868e-05 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.00018232787109419513 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 9.116601331023794e-05 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 9.116975352257135e-05 ], [ 210, 1.9009805306991354 ], [ 215, 9.116975352257135e-05 ], [ 220, 0.0 ], [ 225, 9.11710834498044e-05 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 9.117532285181822e-05 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 9.118205683012873e-05 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVFS2_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.00019348890486247292 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0001934909639719825 ], [ 210, 1.890019736078325 ], [ 215, 0.00029023644595797376 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 9.674894519462502e-05 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0001934984520123839 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0001935012601769569 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 9.67559659728619e-05 ], [ 290, 0.00019351474050157086 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVMS1_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0003272376236003774 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 1.8937183312152635 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.00010908694229300753 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVMS2_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 8.758599850227943e-05 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.00017517353127942368 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.00043793421177097094 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 8.758914385115452e-05 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 1.9081361840779896 ], [ 215, 0.000350357802906218 ], [ 220, 0.000175178901453109 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.000262782392528571 ], [ 240, 8.75958188763734e-05 ], [ 245, 0.0 ], [ 250, 8.759597233719193e-05 ], [ 255, 0.0 ], [ 260, 8.759635599159076e-05 ], [ 265, 0.0 ], [ 270, 0.0001751934792987005 ], [ 275, 8.759727677585959e-05 ], [ 280, 8.759965555815435e-05 ], [ 285, 0.0002628074847571659 ], [ 290, 0.0005256232577779101 ], [ 295, 8.762521643428459e-05 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAFS1_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.6403479290520314 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 1.8829243535864375 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAFS2_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.6420382981448669 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 1.8732988205155576 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAMS1_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.6139774224900685 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 1.886062451440812 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAMS2_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.6576699269530767 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 1.907898810039748 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCFS1_R2", "pairs": [ [ 1, 0.002444270629644114 ], [ 2, 0.002444270629644114 ], [ 3, 0.002444270629644114 ], [ 4, 0.002444270629644114 ], [ 5, 0.002444270629644114 ], [ 6, 0.002444270629644114 ], [ 7, 0.002444270629644114 ], [ 8, 0.002444270629644114 ], [ 9, 0.002444270629644114 ], [ 10, 0.002444270629644114 ], [ 15, 0.002444270629644114 ], [ 20, 0.002444270629644114 ], [ 25, 0.002444270629644114 ], [ 30, 0.002444270629644114 ], [ 35, 0.0004888652785065491 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0001630502129435781 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0004895161948274456 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.00016328983292184296 ], [ 190, 0.00016335011483513073 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 1.8793361280674659 ], [ 215, 0.0006538020222096547 ], [ 220, 0.00032690314840422226 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0001634689417184182 ], [ 240, 0.000163479898511679 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.00032699775189045575 ], [ 275, 0.00016350315315830866 ], [ 280, 0.00016350636121498308 ], [ 285, 0.0001635093020441933 ], [ 290, 0.0004905375310264988 ], [ 295, 0.00016397367238716153 ], [ 300, 0.0007851882096138443 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCFS2_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0005636295488427276 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.00028236622899901174 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 1.8873318369784575 ], [ 215, 0.0008493747186446245 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.00028322995439997736 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.00028336318092172375 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.00028348769238183526 ], [ 290, 0.00028355521528929725 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCMS1_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.00016563215582673222 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.00016566110376680217 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 1.8911530815109343 ], [ 215, 8.283665853486801e-05 ], [ 220, 0.00033134773204902953 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.00016568292430361396 ], [ 245, 0.0 ], [ 250, 8.284413869434324e-05 ], [ 255, 0.0 ], [ 260, 8.284660950250611e-05 ], [ 265, 0.0 ], [ 270, 0.00016569335627634007 ], [ 275, 8.284825678982889e-05 ], [ 280, 0.00016569829819562838 ], [ 285, 0.0 ], [ 290, 0.000165701181118019 ], [ 295, 8.297453760364557e-05 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCMS2_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 1.9233281436381977 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0004287631469499933 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0006433847183261703 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPFS1_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0001409830749818484 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.00014100215874305035 ], [ 170, 0.00014101170256119555 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.00028207153334085526 ], [ 190, 0.00014105267612189772 ], [ 195, 0.0 ], [ 200, 0.00014106063491391775 ], [ 205, 0.00028213599519240264 ], [ 210, 1.8906682731444968 ], [ 215, 0.00014108551192878002 ], [ 220, 0.00014108710435648762 ], [ 225, 0.0 ], [ 230, 0.0001410994468901682 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.00028220088469977354 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.00014110442432922483 ], [ 275, 0.0 ], [ 280, 0.0001411090038833198 ], [ 285, 0.0 ], [ 290, 0.0002822259726918149 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPFS2_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0007569621594616486 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.00015143255194136532 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.00015147842947164323 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.00015155143200948104 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.00015167602002123465 ], [ 135, 0.0 ], [ 140, 0.00015180980053710306 ], [ 145, 0.00015185752119930998 ], [ 150, 0.00015189212014059137 ], [ 155, 0.0 ], [ 160, 0.0001519218878421471 ], [ 165, 0.00030389686955834667 ], [ 170, 0.00045599219341364877 ], [ 175, 0.00030409602135970454 ], [ 180, 0.00015210675460465174 ], [ 185, 0.0006086705114353972 ], [ 190, 0.0006090282345489537 ], [ 195, 0.0003046551303923958 ], [ 200, 0.0007617654676478206 ], [ 205, 0.00045718047656492875 ], [ 210, 1.9242495381069395 ], [ 215, 0.0006098769573238599 ], [ 220, 0.0006099355450612757 ], [ 225, 0.0 ], [ 230, 0.0006099774003373175 ], [ 235, 0.000152508304077157 ], [ 240, 0.0006100583368284592 ], [ 245, 0.0001525194691102319 ], [ 250, 0.0007626299140058508 ], [ 255, 0.0003050584797105605 ], [ 260, 0.0007626729551594063 ], [ 265, 0.0004576219219205477 ], [ 270, 0.0006101653548111538 ], [ 275, 0.000305101293629485 ], [ 280, 0.000610231445531504 ], [ 285, 0.0001525671715114372 ], [ 290, 0.0010680418977578748 ], [ 295, 0.0004597510907594628 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPMS1_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPMS2_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0006919537313604963 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0002307055205524013 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.00023091435155786366 ], [ 210, 1.922952576253025 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.00023095755000230954 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.00023096288426449868 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.00023098529085667822 ], [ 285, 0.0 ], [ 290, 0.0004620164708871871 ], [ 295, 0.0 ], [ 300, 0.0010963950530655205 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVFS1_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.00027821751601837347 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 1.923344482349864 ], [ 215, 0.0 ], [ 220, 0.0005565604563795742 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0002783631135470976 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVFS2_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.00019779028691459022 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 1.9182843716534934 ], [ 215, 0.0 ], [ 220, 0.00019800098208487115 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.00019805117642398795 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.00019807079050052488 ], [ 275, 0.0 ], [ 280, 0.00039616198271149103 ], [ 285, 0.0 ], [ 290, 0.00019811866515568162 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVMS1_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.00012058435176867099 ], [ 30, 0.0006029217588433549 ], [ 35, 0.00012058507880234899 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.00012067602710383569 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 1.919695476590729 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.00024160104178369218 ], [ 255, 0.0 ], [ 260, 0.00012080358545041616 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVMS2_R2", "pairs": [ [ 1, 0.0006208904811280338 ], [ 2, 0.0006208904811280338 ], [ 3, 0.0006208904811280338 ], [ 4, 0.0006208904811280338 ], [ 5, 0.0006208904811280338 ], [ 6, 0.0006208904811280338 ], [ 7, 0.0006208904811280338 ], [ 8, 0.0006208904811280338 ], [ 9, 0.0006208904811280338 ], [ 10, 0.0006208904811280338 ], [ 15, 0.0006208904811280338 ], [ 20, 0.0006208904811280338 ], [ 25, 0.0006208904811280338 ], [ 30, 0.0007450685773536406 ], [ 35, 0.00024835865970765706 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.00012436310544623348 ], [ 190, 0.00024873549094789365 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.00012437006561764663 ], [ 210, 1.916210115231302 ], [ 215, 0.0003731236544228212 ], [ 220, 0.0004975043935856758 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0003732053487790587 ], [ 245, 0.0 ], [ 250, 0.00012440286624203822 ], [ 255, 0.0 ], [ 260, 0.00024880789915318233 ], [ 265, 0.00012440828310348903 ], [ 270, 0.0002488171853053547 ], [ 275, 0.0002488184235113505 ], [ 280, 0.000248828329602982 ], [ 285, 0.0 ], [ 290, 0.0004976758537629272 ], [ 295, 0.00012475719131640046 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAFS1_R2", "pairs": [ [ 1, 0.0006079692610741601 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.00024318918294514262 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.00012159533073929961 ], [ 150, 0.00036478599221789884 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.00012159607001501712 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.6488366296001313 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.00024319214003003424 ], [ 245, 1.9232850394275258 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.00024319214003003424 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.00012159607001501712 ], [ 290, 0.0 ], [ 295, 0.00012165020942083552 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAFS2_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.00015651411757340513 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.6390471420522131 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 1.906185437926501 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAMS1_R2", "pairs": [ [ 1, 0.0006590654451987082 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.00013181308903974164 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0002636331281388819 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.00039545490495900454 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0001318183016530015 ], [ 180, 0.0001318183016530015 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.00013181917046196028 ], [ 205, 0.0 ], [ 210, 0.6377411466949638 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.00039545751138588084 ], [ 245, 1.8960869479248368 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.00026363834092392056 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAMS2_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.6228200309893515 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 1.913214339876435 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICFS1_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.00014295006039640053 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0001429858301042367 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0002860186913214779 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0002860677837613622 ], [ 170, 0.00028606860211147233 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0007152154944284713 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.00028609438253679887 ], [ 205, 0.00042914157380519836 ], [ 210, 1.8743473471898378 ], [ 215, 0.0005721887650735977 ], [ 220, 0.00028609438253679887 ], [ 225, 0.0 ], [ 230, 0.00028610461415216475 ], [ 235, 0.0 ], [ 240, 0.00014305230707608237 ], [ 245, 0.0 ], [ 250, 0.00042915814906951364 ], [ 255, 0.0 ], [ 260, 0.00014305333028152896 ], [ 265, 0.0 ], [ 270, 0.0004291722697490773 ], [ 275, 0.0 ], [ 280, 0.0001430672473289345 ], [ 285, 0.0 ], [ 290, 0.0005722820892874516 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICFS2_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0003471900749930562 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0003472057460236262 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.00034722624104445654 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.00011576351828484772 ], [ 140, 0.0003472905548545431 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0003473432295278795 ], [ 165, 0.00034734483816625084 ], [ 170, 0.0004631264508883344 ], [ 175, 0.0 ], [ 180, 0.0001157816127220836 ], [ 185, 0.0006947524191858196 ], [ 190, 0.00011579904234191984 ], [ 195, 0.0 ], [ 200, 0.0003473971270257595 ], [ 205, 0.0011579904234191984 ], [ 210, 1.9174005430975087 ], [ 215, 0.0008105932963934387 ], [ 220, 0.0012737894657611183 ], [ 225, 0.0001158042722512119 ], [ 230, 0.00034742528908679265 ], [ 235, 0.00011580856381167675 ], [ 240, 0.0003474273008372998 ], [ 245, 0.0 ], [ 250, 0.0008106637019536996 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.00011580936851467536 ], [ 270, 0.00046324552128439454 ], [ 275, 0.0 ], [ 280, 0.0004632541052999744 ], [ 285, 0.00011581580654127676 ], [ 290, 0.0009265468409964549 ], [ 295, 0.0001158877464932368 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICMS1_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.00010262883767709889 ], [ 35, 0.00010262936431371744 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.00010263252424693386 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.00030790073280374407 ], [ 140, 0.0 ], [ 145, 0.00010263357760124802 ], [ 150, 0.00020526820857302673 ], [ 155, 0.00010263410428651336 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.00030790515700083955 ], [ 175, 0.00020527031534652194 ], [ 180, 0.000307905789039375 ], [ 185, 0.000307910845441072 ], [ 190, 0.0004105511649389305 ], [ 195, 0.00010263779123473263 ], [ 200, 0.0003079133737041979 ], [ 205, 0.0006158267474083958 ], [ 210, 1.8908960279174793 ], [ 215, 0.0007184645386431284 ], [ 220, 0.0005131889561736631 ], [ 225, 0.00020527726800589557 ], [ 230, 0.00010263884469716409 ], [ 235, 0.00041055537878865637 ], [ 240, 0.00030791653409149226 ], [ 245, 0.0 ], [ 250, 0.00010263884469716409 ], [ 255, 0.00010263884469716409 ], [ 260, 0.00010263884469716409 ], [ 265, 0.00041055622156898166 ], [ 270, 0.0005131989641592108 ], [ 275, 0.0004105646495625434 ], [ 280, 0.0005132126599298952 ], [ 285, 0.00041057560647149265 ], [ 290, 0.0009238064933331964 ], [ 295, 0.0005134450726730156 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICMS2_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.00015915330442048303 ], [ 35, 0.0001591543176179055 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.00015916343697525804 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.00015916343697525804 ], [ 170, 0.0003183268739505161 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0003183283939377541 ], [ 190, 0.00015916470363532182 ], [ 195, 0.0004774941109059655 ], [ 200, 0.0004774941109059655 ], [ 205, 0.00047749563091497714 ], [ 210, 1.9357765309776769 ], [ 215, 0.00047749791094663964 ], [ 220, 0.0006366638812621861 ], [ 225, 0.0 ], [ 230, 0.00015917002382775255 ], [ 235, 0.0 ], [ 240, 0.0003183430878961183 ], [ 245, 0.00015917331745844782 ], [ 250, 0.000318347141640602 ], [ 255, 0.0001591758511132759 ], [ 260, 0.00031835220896638997 ], [ 265, 0.00031835220896638997 ], [ 270, 0.0004775397153863296 ], [ 275, 0.00031836437120648955 ], [ 280, 0.0006367459733776509 ], [ 285, 0.0 ], [ 290, 0.0017511211154959893 ], [ 295, 0.00047787517581824175 ], [ 300, 0.0010857468581200293 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPFS1_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0001242645094347829 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.00012427223074867806 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 1.8790194799142512 ], [ 215, 0.00012427470177178444 ], [ 220, 0.00024855218353093234 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.00012427763623935873 ], [ 245, 0.0 ], [ 250, 0.00024855527247871745 ], [ 255, 0.0 ], [ 260, 0.0003728329087180762 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.000124280570845518 ], [ 280, 0.0002485701004968916 ], [ 285, 0.0 ], [ 290, 0.0001242886031079608 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPFS2_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 8.911941109893145e-05 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.00026735942464251814 ], [ 155, 0.0 ], [ 160, 8.912092015567643e-05 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0001782419991622626 ], [ 180, 0.0 ], [ 185, 8.912147613683355e-05 ], [ 190, 0.00017824358768693297 ], [ 195, 8.912179384346648e-05 ], [ 200, 0.00026736657293982915 ], [ 205, 0.0 ], [ 210, 1.9045497081235239 ], [ 215, 0.000267367764359877 ], [ 220, 0.00017824517623991803 ], [ 225, 0.0 ], [ 230, 8.912377956124364e-05 ], [ 235, 8.912385899179525e-05 ], [ 240, 0.00017824835343083518 ], [ 245, 0.0 ], [ 250, 0.00035649670686167036 ], [ 255, 0.0 ], [ 260, 0.00017824835343083518 ], [ 265, 8.912417671541759e-05 ], [ 270, 0.0002673730067342348 ], [ 275, 8.912687745767365e-05 ], [ 280, 8.912830732866419e-05 ], [ 285, 8.912918116129975e-05 ], [ 290, 0.0002673899267084211 ], [ 295, 0.00017831398775161218 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPMS1_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.00011569353938352698 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0003470936690114772 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.00011570076773244429 ], [ 190, 5.78507854690397e-05 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0001157015709380794 ], [ 210, 1.8928777005469792 ], [ 215, 0.00034710471281423823 ], [ 220, 0.0001157015709380794 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0002314098354965332 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0001735573766223999 ], [ 255, 0.0 ], [ 260, 0.0001157049177482666 ], [ 265, 0.0 ], [ 270, 0.0002892661433649289 ], [ 275, 0.0 ], [ 280, 0.00011571027304731683 ], [ 285, 0.0002314220188794083 ], [ 290, 0.0004628485900764105 ], [ 295, 5.7898850707813445e-05 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPMS2_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 8.19373261392361e-05 ], [ 35, 8.193759468913287e-05 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.00016387800920994412 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.00016388767794104633 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.00016389815368729872 ], [ 210, 1.9269505929015711 ], [ 215, 0.00016389815368729872 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.00016389882525517 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.00016390164590032814 ], [ 270, 0.0001639021831770799 ], [ 275, 0.0 ], [ 280, 0.0002458619386869497 ], [ 285, 0.00016391010841834122 ], [ 290, 0.0004917387883556255 ], [ 295, 0.0 ], [ 300, 0.0003482306401175627 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVFS1_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 8.736065974770242e-05 ], [ 135, 8.736065974770242e-05 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.00034944569177142756 ], [ 155, 0.0 ], [ 160, 8.736142294285689e-05 ], [ 165, 8.736142294285689e-05 ], [ 170, 0.00017472284588571378 ], [ 175, 0.00017472284588571378 ], [ 180, 8.736142294285689e-05 ], [ 185, 0.00017472284588571378 ], [ 190, 0.00017472284588571378 ], [ 195, 0.00017472284588571378 ], [ 200, 0.00034944569177142756 ], [ 205, 0.00017472284588571378 ], [ 210, 1.8965291306664804 ], [ 215, 0.00034944569177142756 ], [ 220, 0.00034944569177142756 ], [ 225, 0.00017472284588571378 ], [ 230, 8.736142294285689e-05 ], [ 235, 8.736142294285689e-05 ], [ 240, 0.00017472284588571378 ], [ 245, 0.0 ], [ 250, 0.0002620842688285707 ], [ 255, 0.0 ], [ 260, 8.736142294285689e-05 ], [ 265, 0.0002620842688285707 ], [ 270, 0.00034944569177142756 ], [ 275, 8.736142294285689e-05 ], [ 280, 0.0002620854136363041 ], [ 285, 8.736241511649341e-05 ], [ 290, 0.000698906037325077 ], [ 295, 0.0002622425761312052 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVFS2_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.00015696123057604773 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0001570055893989826 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0003140284352748141 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.00031403090064062303 ], [ 170, 0.00015701545032031152 ], [ 175, 0.00031403090064062303 ], [ 180, 0.0 ], [ 185, 0.0007850957424257889 ], [ 190, 0.00031403829697031557 ], [ 195, 0.00015701914848515779 ], [ 200, 0.0004710574454554733 ], [ 205, 0.0004710574454554733 ], [ 210, 1.9489216709977781 ], [ 215, 0.0004710596644170951 ], [ 220, 0.0006280815249819426 ], [ 225, 0.0 ], [ 230, 0.00031404569364842585 ], [ 235, 0.0 ], [ 240, 0.0004710685404726388 ], [ 245, 0.0 ], [ 250, 0.0006280913872968517 ], [ 255, 0.0 ], [ 260, 0.00015702284682421293 ], [ 265, 0.00015702284682421293 ], [ 270, 0.00047107075953879034 ], [ 275, 0.00015702753163712195 ], [ 280, 0.00047108925256979185 ], [ 285, 0.0 ], [ 290, 0.00047112180383116257 ], [ 295, 0.00015716277191124076 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVMS1_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.00012814499862884852 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.00012818212115774092 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0001281857360040404 ], [ 200, 0.00012818622895342354 ], [ 205, 0.00012818672190659803 ], [ 210, 1.9083206214508213 ], [ 215, 0.0 ], [ 220, 0.0002563750870072951 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.00012819280197416916 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.00012819444533468364 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.00012819691045445804 ], [ 285, 0.0 ], [ 290, 0.0002564099276795799 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVMS2_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0005467767510525453 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.00018226057794829266 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.00018226057794829266 ], [ 210, 1.9058988636052967 ], [ 215, 0.0001822619067147109 ], [ 220, 0.0 ], [ 225, 0.00018226456430567227 ], [ 230, 0.0 ], [ 235, 0.00018226556092226375 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.00018227021194380246 ], [ 275, 0.0 ], [ 280, 0.00018227785342308695 ], [ 285, 0.0 ], [ 290, 0.00018231307895797137 ], [ 295, 0.00018238589938134704 ], [ 300, 0.0008402231632721651 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAFS1_R2", "pairs": [ [ 1, 0.002266374556168316 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0003021832741557755 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0006043939439726814 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.00015110076910291472 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0009066183136899365 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0003022061045633122 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.6506546589200584 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0007555209694845081 ], [ 245, 1.918267741521166 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0006044167755876065 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAFS2_R2", "pairs": [ [ 1, 0.0011883682515537914 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0002376736503107583 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0004753642478549188 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.00047542074736141483 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.00023771037368070742 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.6446858582737063 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.00047543204887441463 ], [ 245, 1.8950721468134166 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.00047543204887441463 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAMS1_R2", "pairs": [ [ 1, 0.0006118340950667817 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.00012236756769985684 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.00024474681553799635 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.6205601071998923 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.00012237430629065123 ], [ 245, 1.907937809377543 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.00012237430629065123 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAMS2_R2", "pairs": [ [ 1, 0.0013536837118007378 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0004061106109934143 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.00013537075341946522 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0006768730091472619 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.00013538028321555249 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.00013538303244454373 ], [ 205, 0.0 ], [ 210, 0.6409041432679342 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.00040617109280332523 ], [ 245, 1.9401439199572168 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0002707836614554351 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCFS1_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.00031876641647044825 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0001062660860287726 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.00010627105495276251 ], [ 210, 1.8873739359610624 ], [ 215, 0.0 ], [ 220, 0.00021254323926523804 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.00010627218431847647 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.00010627218431847647 ], [ 275, 0.0 ], [ 280, 0.00021254572389885372 ], [ 285, 0.0 ], [ 290, 0.0002125536299377537 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCFS2_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.00013141588791801753 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.00013142590536020554 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 1.8997739459573126 ], [ 215, 0.00013142711446513107 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0002628587200094629 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.00013143333307046666 ], [ 275, 0.0 ], [ 280, 0.00013143799741067145 ], [ 285, 0.0 ], [ 290, 0.0005257872349375102 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCMS1_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.00024785143784815383 ], [ 35, 0.00012392633323047447 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.00024787294033078644 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0002478806206930742 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.00012394952775229926 ], [ 210, 1.900642058553757 ], [ 215, 0.0002478990555045985 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.00024791595649074964 ], [ 275, 0.0 ], [ 280, 0.0001239582855577441 ], [ 285, 0.0 ], [ 290, 0.00024792917159425896 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCMS2_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.00015695507161075142 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0001569575351388682 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.00031391999748864004 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0004708873872813317 ], [ 210, 1.9133724169864776 ], [ 215, 0.0004708873872813317 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.00015696985393955093 ], [ 270, 0.0003139416790542821 ], [ 275, 0.0 ], [ 280, 0.0003139702638763083 ], [ 285, 0.00015699499028985986 ], [ 290, 0.0006280105254564066 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPFS1_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 8.560800948536745e-05 ], [ 110, 0.0 ], [ 115, 8.560837592350036e-05 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0004280492085370134 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.00017121968341480537 ], [ 175, 0.0 ], [ 180, 8.56099882885536e-05 ], [ 185, 0.0 ], [ 190, 0.00017122085607003618 ], [ 195, 8.561057461817683e-05 ], [ 200, 8.561057461817683e-05 ], [ 205, 8.561057461817683e-05 ], [ 210, 1.9119409629477433 ], [ 215, 0.0002568317238545305 ], [ 220, 0.00017122114923635365 ], [ 225, 0.0 ], [ 230, 8.561130754150008e-05 ], [ 235, 0.0 ], [ 240, 0.00017122261508300017 ], [ 245, 0.0 ], [ 250, 8.561130754150008e-05 ], [ 255, 0.0 ], [ 260, 0.0002568339226245002 ], [ 265, 0.00017122261508300017 ], [ 270, 0.00017122261508300017 ], [ 275, 0.0002568339226245002 ], [ 280, 0.0002568339226245002 ], [ 285, 0.0 ], [ 290, 0.0005136757610106399 ], [ 295, 8.56374811276401e-05 ], [ 300, 0.0004160547195167108 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPFS2_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.00019825043986816345 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 9.912571122697807e-05 ], [ 180, 0.0 ], [ 185, 9.912659556646388e-05 ], [ 190, 0.000297381555404662 ], [ 195, 9.91273816592536e-05 ], [ 200, 9.912767644726408e-05 ], [ 205, 9.912767644726408e-05 ], [ 210, 1.8925455987311657 ], [ 215, 0.0003965130641141799 ], [ 220, 0.0003965166016544655 ], [ 225, 0.0 ], [ 230, 9.912915041361637e-05 ], [ 235, 9.912954347871343e-05 ], [ 240, 0.0002973889252364242 ], [ 245, 0.0 ], [ 250, 9.913013308220367e-05 ], [ 255, 0.0 ], [ 260, 0.00019826026616440734 ], [ 265, 9.913013308220367e-05 ], [ 270, 0.00019826085577315784 ], [ 275, 0.00019826301770191354 ], [ 280, 0.0001982667520535479 ], [ 285, 9.913406395138465e-05 ], [ 290, 0.00019827009343478154 ], [ 295, 9.915883559762536e-05 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPMS1_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 9.465260129011495e-05 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0001893123701435461 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0001893123701435461 ], [ 170, 9.465618507177305e-05 ], [ 175, 0.0 ], [ 180, 9.465618507177305e-05 ], [ 185, 0.00028397581283343495 ], [ 190, 9.466066518049423e-05 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0003786451697182312 ], [ 210, 1.9112169217006896 ], [ 215, 0.00037864624501251896 ], [ 220, 0.00018932312250625948 ], [ 225, 9.466362228457399e-05 ], [ 230, 0.0 ], [ 235, 9.466640033852705e-05 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 9.46669380452224e-05 ], [ 270, 0.0003786677521808896 ], [ 275, 0.0 ], [ 280, 0.00018933405532719764 ], [ 285, 9.466738613880132e-05 ], [ 290, 0.0004733396192834774 ], [ 295, 9.46932034900127e-05 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPMS2_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.00014905928684074804 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0004471938585376761 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0007453230975627934 ], [ 180, 0.0 ], [ 185, 0.0002981319054802607 ], [ 190, 0.0008944050492146377 ], [ 195, 0.0004472038578786139 ], [ 200, 0.0007453397631310232 ], [ 205, 0.0 ], [ 210, 1.8778089992323 ], [ 215, 0.0005962762547888436 ], [ 220, 0.0008944143821832656 ], [ 225, 0.0 ], [ 230, 0.0004472171910288232 ], [ 235, 0.0001490723970096077 ], [ 240, 0.0008944343820576464 ], [ 245, 0.0 ], [ 250, 0.0002981492386013819 ], [ 255, 0.0 ], [ 260, 0.0004472238579020729 ], [ 265, 0.0004472238579020729 ], [ 270, 0.0004472238579020729 ], [ 275, 0.0004472271914132379 ], [ 280, 0.0004472391924649141 ], [ 285, 0.00014908217558600475 ], [ 290, 0.0004472571952501286 ], [ 295, 0.0007457021456833539 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVFS1_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 1.9046924829157177 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVFS2_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.00013329068031563233 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0001332912133099274 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 1.9201983378541392 ], [ 215, 0.0002665831372836511 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0002665877566906862 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0001332981426236807 ], [ 290, 0.00026660303740840517 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVMS1_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.00011519589349678861 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 5.7600965852995426e-05 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 1.9097431230181243 ], [ 215, 0.00011520438698305632 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 5.7606241751506255e-05 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 5.760670634232555e-05 ], [ 275, 0.0 ], [ 280, 5.760810015974726e-05 ], [ 285, 5.760819972071545e-05 ], [ 290, 0.00023043585213161806 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVMS2_R2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0001704826363434884 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0001704899027355105 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.00017049135608824634 ], [ 170, 0.00017049135608824634 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0001704939721856134 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.00034099143259025617 ], [ 210, 1.9109159882357956 ], [ 215, 0.00034099143259025617 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.00017051752067524938 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.000170520428347316 ], [ 270, 0.00034104260133654594 ], [ 275, 0.0 ], [ 280, 0.00017053554984071978 ], [ 285, 0.0001705410756707807 ], [ 290, 0.0011938241769861397 ], [ 295, 0.0 ], [ 300, 0.0008102742778430498 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null } ] } ], "pconfig": { "id": "fastqc_per_base_n_content_plot", "title": "FastQC: Per Base N Content", "anchor": null, "table_title": null, "height": null, "width": null, "square": false, "logswitch": false, "logswitch_active": false, "logswitch_label": "Log10", "cpswitch": true, "cpswitch_c_active": true, "cpswitch_counts_label": "Counts", "cpswitch_percent_label": "Percentages", "xLog": null, "yLog": null, "xlog": false, "ylog": false, "data_labels": [], "xTitle": null, "yTitle": null, "xlab": "Position in Read (bp)", "ylab": "Percentage N-Count", "xsuffix": null, "ysuffix": null, "tt_suffix": null, "xLabFormat": null, "yLabFormat": null, "xLabelFormat": null, "yLabelFormat": null, "xlab_format": null, "ylab_format": null, "tt_label": "Base {point.x}: {point.y:.2f}%", "xDecimals": null, "yDecimals": null, "decimalPlaces": null, "x_decimals": null, "y_decimals": null, "tt_decimals": null, "xmin": 0, "xmax": null, "ymin": 0, "ymax": null, "xFloor": null, "xCeiling": null, "yFloor": null, "yCeiling": null, "x_clipmin": null, "x_clipmax": null, "y_clipmin": null, "y_clipmax": 100, "save_data_file": true, "showlegend": false, "xMinRange": null, "yMinRange": null, "x_minrange": null, "y_minrange": 5, "xPlotBands": null, "yPlotBands": null, "xPlotLines": null, "yPlotLines": null, "x_bands": null, "y_bands": [ { "from_": 20, "to": 100, "color": "#e6c3c3" }, { "from_": 5, "to": 20, "color": "#e6dcc3" }, { "from_": 0, "to": 5, "color": "#c3e6c3" } ], "x_lines": null, "y_lines": null, "categories": false, "smooth_points": 500, "smooth_points_sumcounts": null, "extra_series": null, "style": null, "hide_zero_cats": false, "hide_empty": false, "colors": { "CAFS1_R2": "#5cb85c", "CAFS2_R2": "#5cb85c", "CAMS1_R2": "#5cb85c", "CAMS2_R2": "#5cb85c", "CCFS1_R2": "#5cb85c", "CCFS2_R2": "#5cb85c", "CCMS1_R2": "#5cb85c", "CCMS2_R2": "#5cb85c", "CPFS1_R2": "#5cb85c", "CPFS2_R2": "#5cb85c", "CPMS1_R2": "#5cb85c", "CPMS2_R2": "#5cb85c", "CVFS1_R2": "#5cb85c", "CVFS2_R2": "#5cb85c", "CVMS1_R2": "#5cb85c", "CVMS2_R2": "#5cb85c", "DAFS1_R2": "#5cb85c", "DAFS2_R2": "#5cb85c", "DAMS1_R2": "#5cb85c", "DAMS2_R2": "#5cb85c", "DCFS1_R2": "#5cb85c", "DCFS2_R2": "#5cb85c", "DCMS1_R2": "#5cb85c", "DCMS2_R2": "#5cb85c", "DPFS1_R2": "#5cb85c", "DPFS2_R2": "#5cb85c", "DPMS1_R2": "#5cb85c", "DPMS2_R2": "#5cb85c", "DVFS1_R2": "#5cb85c", "DVFS2_R2": "#5cb85c", "DVMS1_R2": "#5cb85c", "DVMS2_R2": "#5cb85c", "IAFS1_R2": "#5cb85c", "IAFS2_R2": "#5cb85c", "IAMS1_R2": "#5cb85c", "IAMS2_R2": "#5cb85c", "ICFS1_R2": "#5cb85c", "ICFS2_R2": "#5cb85c", "ICMS1_R2": "#5cb85c", "ICMS2_R2": "#5cb85c", "IPFS1_R2": "#5cb85c", "IPFS2_R2": "#5cb85c", "IPMS1_R2": "#5cb85c", "IPMS2_R2": "#5cb85c", "IVFS1_R2": "#5cb85c", "IVFS2_R2": "#5cb85c", "IVMS1_R2": "#5cb85c", "IVMS2_R2": "#5cb85c", "JAFS1_R2": "#5cb85c", "JAFS2_R2": "#5cb85c", "JAMS1_R2": "#5cb85c", "JAMS2_R2": "#5cb85c", "JCFS1_R2": "#5cb85c", "JCFS2_R2": "#5cb85c", "JCMS1_R2": "#5cb85c", "JCMS2_R2": "#5cb85c", "JPFS1_R2": "#5cb85c", "JPFS2_R2": "#5cb85c", "JPMS1_R2": "#5cb85c", "JPMS2_R2": "#5cb85c", "JVFS1_R2": "#5cb85c", "JVFS2_R2": "#5cb85c", "JVMS1_R2": "#5cb85c", "JVMS2_R2": "#5cb85c" } }, "add_log_tab": false, "add_pct_tab": false, "l_active": false, "p_active": false, "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "yaxis" ], "square": false, "flat": false, "defer_render": false }, "fastqc_sequence_length_distribution_plot": { "id": "fastqc_sequence_length_distribution_plot", "anchor": "fastqc_sequence_length_distribution_plot", "plot_type": "xy_line", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 500, "hoverlabel": { "namelength": -1 }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "white", "plot_bgcolor": "white", "showlegend": false, "title": { "font": { "size": 20 }, "text": "FastQC: Sequence Length Distribution", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "hoverdistance": -1 }, "datasets": [ { "plot_id": "fastqc_sequence_length_distribution_plot", "label": "1", "uid": "fastqc_sequence_length_distribution_plot", "dconfig": { "title": "FastQC: Sequence Length Distribution
64 samples" }, "layout": { "title": { "text": "FastQC: Sequence Length Distribution
64 samples" }, "xaxis": { "hoverformat": null, "ticksuffix": " bp", "title": { "text": "Sequence Length (bp)" }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "yaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "Read Count" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": null } } }, "trace_params": { "hovertemplate": "%{text}
%{x}: %{y}", "mode": "lines", "line": { "width": 2 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "n_samples": 64, "lines": [ { "name": "CAFS1_R2", "pairs": [ [ 30, 1.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 2.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 1.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 1.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0 ], [ 210, 0.0 ], [ 220, 1.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0 ], [ 260, 1.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 299.0 ], [ 300, 163635.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAFS2_R2", "pairs": [ [ 224, 1.0 ], [ 226, 0.0 ], [ 228, 0.0 ], [ 230, 0.0 ], [ 232, 0.0 ], [ 234, 0.0 ], [ 236, 0.0 ], [ 238, 0.0 ], [ 240, 0.0 ], [ 242, 0.0 ], [ 244, 0.0 ], [ 246, 0.0 ], [ 248, 0.0 ], [ 250, 0.0 ], [ 252, 0.0 ], [ 254, 1.0 ], [ 256, 0.0 ], [ 258, 0.0 ], [ 260, 0.0 ], [ 262, 0.0 ], [ 264, 0.0 ], [ 266, 0.0 ], [ 268, 0.0 ], [ 270, 0.0 ], [ 272, 0.0 ], [ 274, 0.0 ], [ 276, 0.0 ], [ 278, 0.0 ], [ 280, 0.0 ], [ 282, 0.0 ], [ 284, 0.0 ], [ 286, 0.0 ], [ 288, 0.0 ], [ 290, 0.0 ], [ 292, 0.0 ], [ 294, 0.0 ], [ 296, 6.0 ], [ 298, 262.0 ], [ 300, 151174.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAMS1_R2", "pairs": [ [ 100, 3.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 1.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 1.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 343.0 ], [ 300, 146630.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAMS2_R2", "pairs": [ [ 65, 1.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 2.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 1.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 1.0 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 3.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 1.0 ], [ 250, 0.0 ], [ 255, 2.0 ], [ 260, 0.0 ], [ 265, 1.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 1.0 ], [ 295, 381.0 ], [ 300, 166880.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCFS1_R2", "pairs": [ [ 40, 1.0 ], [ 50, 2.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 1.0 ], [ 90, 0.0 ], [ 100, 3.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 2.0 ], [ 140, 0.0 ], [ 150, 3.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 17.0 ], [ 190, 0.0 ], [ 200, 1.0 ], [ 210, 0.0 ], [ 220, 7.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 1.0 ], [ 260, 0.0 ], [ 270, 3.0 ], [ 280, 3.0 ], [ 290, 551.0 ], [ 300, 216092.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCFS2_R2", "pairs": [ [ 40, 6.0 ], [ 50, 3.0 ], [ 60, 0.0 ], [ 70, 1.0 ], [ 80, 1.0 ], [ 90, 0.0 ], [ 100, 8.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 5.0 ], [ 140, 2.0 ], [ 150, 4.0 ], [ 160, 9.0 ], [ 170, 1.0 ], [ 180, 3.0 ], [ 190, 2.0 ], [ 200, 0.0 ], [ 210, 0.0 ], [ 220, 22.0 ], [ 230, 5.0 ], [ 240, 1.0 ], [ 250, 1.0 ], [ 260, 3.0 ], [ 270, 15.0 ], [ 280, 7.0 ], [ 290, 731.0 ], [ 300, 202169.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCMS1_R2", "pairs": [ [ 95, 1.0 ], [ 100, 4.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 1.0 ], [ 145, 3.0 ], [ 150, 0.0 ], [ 155, 1.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 1.0 ], [ 185, 2.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 4.0 ], [ 230, 0.0 ], [ 235, 1.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 1.0 ], [ 265, 2.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 1.0 ], [ 285, 1.0 ], [ 290, 2.0 ], [ 295, 431.0 ], [ 300, 209534.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCMS2_R2", "pairs": [ [ 50, 1.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 1.0 ], [ 75, 0.0 ], [ 80, 1.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 1.0 ], [ 100, 5.0 ], [ 105, 0.0 ], [ 110, 1.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 1.0 ], [ 135, 2.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 1.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 3.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 1.0 ], [ 210, 0.0 ], [ 215, 1.0 ], [ 220, 0.0 ], [ 225, 4.0 ], [ 230, 0.0 ], [ 235, 1.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 2.0 ], [ 255, 1.0 ], [ 260, 0.0 ], [ 265, 1.0 ], [ 270, 1.0 ], [ 275, 1.0 ], [ 280, 2.0 ], [ 285, 1.0 ], [ 290, 2.0 ], [ 295, 441.0 ], [ 300, 196447.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPFS1_R2", "pairs": [ [ 30, 1.0 ], [ 40, 13.0 ], [ 50, 1.0 ], [ 60, 0.0 ], [ 70, 1.0 ], [ 80, 1.0 ], [ 90, 0.0 ], [ 100, 1.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 1.0 ], [ 150, 9.0 ], [ 160, 1.0 ], [ 170, 0.0 ], [ 180, 3.0 ], [ 190, 0.0 ], [ 200, 0.0 ], [ 210, 1.0 ], [ 220, 1.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0 ], [ 260, 0.0 ], [ 270, 16.0 ], [ 280, 2.0 ], [ 290, 926.0 ], [ 300, 148724.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPFS2_R2", "pairs": [ [ 30, 3.0 ], [ 40, 1.0 ], [ 50, 3.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 1.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 1.0 ], [ 120, 0.0 ], [ 130, 5.0 ], [ 140, 0.0 ], [ 150, 1.0 ], [ 160, 1.0 ], [ 170, 0.0 ], [ 180, 5.0 ], [ 190, 1.0 ], [ 200, 0.0 ], [ 210, 0.0 ], [ 220, 4.0 ], [ 230, 1.0 ], [ 240, 0.0 ], [ 250, 0.0 ], [ 260, 1.0 ], [ 270, 9.0 ], [ 280, 9.0 ], [ 290, 583.0 ], [ 300, 178563.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPMS1_R2", "pairs": [ [ 50, 2.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 1.0 ], [ 75, 0.0 ], [ 80, 3.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 2.0 ], [ 100, 11.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 3.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 1.0 ], [ 150, 0.0 ], [ 155, 1.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 1.0 ], [ 185, 2.0 ], [ 190, 0.0 ], [ 195, 1.0 ], [ 200, 1.0 ], [ 205, 1.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 1.0 ], [ 225, 11.0 ], [ 230, 0.0 ], [ 235, 4.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 1.0 ], [ 260, 0.0 ], [ 265, 4.0 ], [ 270, 1.0 ], [ 275, 5.0 ], [ 280, 3.0 ], [ 285, 2.0 ], [ 290, 3.0 ], [ 295, 607.0 ], [ 300, 225272.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPMS2_R2", "pairs": [ [ 30, 2.0 ], [ 40, 1.0 ], [ 50, 1.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 2.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 3.0 ], [ 140, 1.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 1.0 ], [ 180, 14.0 ], [ 190, 1.0 ], [ 200, 0.0 ], [ 210, 0.0 ], [ 220, 7.0 ], [ 230, 0.0 ], [ 240, 1.0 ], [ 250, 0.0 ], [ 260, 0.0 ], [ 270, 4.0 ], [ 280, 15.0 ], [ 290, 434.0 ], [ 300, 204290.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVFS1_R2", "pairs": [ [ 30, 1.0 ], [ 40, 4.0 ], [ 50, 4.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 1.0 ], [ 90, 0.0 ], [ 100, 5.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 1.0 ], [ 140, 1.0 ], [ 150, 0.0 ], [ 160, 3.0 ], [ 170, 1.0 ], [ 180, 2.0 ], [ 190, 1.0 ], [ 200, 7.0 ], [ 210, 0.0 ], [ 220, 6.0 ], [ 230, 3.0 ], [ 240, 0.0 ], [ 250, 2.0 ], [ 260, 2.0 ], [ 270, 6.0 ], [ 280, 10.0 ], [ 290, 561.0 ], [ 300, 218781.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVFS2_R2", "pairs": [ [ 40, 1.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 1.0 ], [ 100, 1.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 1.0 ], [ 140, 0.0 ], [ 150, 1.0 ], [ 160, 1.0 ], [ 170, 0.0 ], [ 180, 3.0 ], [ 190, 1.0 ], [ 200, 0.0 ], [ 210, 0.0 ], [ 220, 7.0 ], [ 230, 1.0 ], [ 240, 0.0 ], [ 250, 0.0 ], [ 260, 3.0 ], [ 270, 5.0 ], [ 280, 8.0 ], [ 290, 444.0 ], [ 300, 206260.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVMS1_R2", "pairs": [ [ 30, 1.0 ], [ 40, 1.0 ], [ 50, 1.0 ], [ 60, 0.0 ], [ 70, 1.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 1.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 6.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 1.0 ], [ 180, 4.0 ], [ 190, 1.0 ], [ 200, 4.0 ], [ 210, 1.0 ], [ 220, 4.0 ], [ 230, 2.0 ], [ 240, 0.0 ], [ 250, 0.0 ], [ 260, 0.0 ], [ 270, 1.0 ], [ 280, 3.0 ], [ 290, 311.0 ], [ 300, 183021.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVMS2_R2", "pairs": [ [ 50, 3.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 1.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 4.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 2.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 1.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 1.0 ], [ 170, 0.0 ], [ 175, 1.0 ], [ 180, 1.0 ], [ 185, 2.0 ], [ 190, 1.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 10.0 ], [ 230, 0.0 ], [ 235, 6.0 ], [ 240, 1.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 1.0 ], [ 260, 0.0 ], [ 265, 1.0 ], [ 270, 0.0 ], [ 275, 5.0 ], [ 280, 8.0 ], [ 285, 5.0 ], [ 290, 3.0 ], [ 295, 497.0 ], [ 300, 227801.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAFS1_R2", "pairs": [ [ 75, 6.0 ], [ 80, 0.0 ], [ 85, 3.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 4.0 ], [ 110, 3.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 2.0 ], [ 130, 0.0 ], [ 135, 1.0 ], [ 140, 2.0 ], [ 145, 3.0 ], [ 150, 0.0 ], [ 155, 1.0 ], [ 160, 2.0 ], [ 165, 0.0 ], [ 170, 6.0 ], [ 175, 1.0 ], [ 180, 0.0 ], [ 185, 5.0 ], [ 190, 8.0 ], [ 195, 6.0 ], [ 200, 2.0 ], [ 205, 4.0 ], [ 210, 4.0 ], [ 215, 3.0 ], [ 220, 0.0 ], [ 225, 1.0 ], [ 230, 1.0 ], [ 235, 0.0 ], [ 240, 1.0 ], [ 245, 1.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 2.0 ], [ 265, 0.0 ], [ 270, 1.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 1.0 ], [ 290, 0.0 ], [ 295, 618.0 ], [ 300, 89227.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAFS2_R2", "pairs": [ [ 30, 1.0 ], [ 40, 0.0 ], [ 50, 1.0 ], [ 60, 1.0 ], [ 70, 13.0 ], [ 80, 5.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 4.0 ], [ 120, 2.0 ], [ 130, 2.0 ], [ 140, 6.0 ], [ 150, 0.0 ], [ 160, 3.0 ], [ 170, 1.0 ], [ 180, 5.0 ], [ 190, 0.0 ], [ 200, 1.0 ], [ 210, 1.0 ], [ 220, 0.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0 ], [ 260, 1.0 ], [ 270, 1.0 ], [ 280, 0.0 ], [ 290, 253.0 ], [ 300, 37219.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAMS1_R2", "pairs": [ [ 75, 7.0 ], [ 80, 0.0 ], [ 85, 4.0 ], [ 90, 0.0 ], [ 95, 1.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 2.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 1.0 ], [ 135, 1.0 ], [ 140, 4.0 ], [ 145, 0.0 ], [ 150, 1.0 ], [ 155, 1.0 ], [ 160, 0.0 ], [ 165, 4.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 3.0 ], [ 190, 5.0 ], [ 195, 0.0 ], [ 200, 4.0 ], [ 205, 2.0 ], [ 210, 1.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 1.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 3.0 ], [ 250, 0.0 ], [ 255, 1.0 ], [ 260, 0.0 ], [ 265, 1.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 745.0 ], [ 300, 62834.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAMS2_R2", "pairs": [ [ 40, 1.0 ], [ 50, 0.0 ], [ 60, 1.0 ], [ 70, 1.0 ], [ 80, 4.0 ], [ 90, 0.0 ], [ 100, 1.0 ], [ 110, 5.0 ], [ 120, 1.0 ], [ 130, 0.0 ], [ 140, 3.0 ], [ 150, 2.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 10.0 ], [ 190, 8.0 ], [ 200, 6.0 ], [ 210, 12.0 ], [ 220, 1.0 ], [ 230, 0.0 ], [ 240, 5.0 ], [ 250, 1.0 ], [ 260, 1.0 ], [ 270, 2.0 ], [ 280, 1.0 ], [ 290, 935.0 ], [ 300, 79818.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCFS1_R2", "pairs": [ [ 30, 4.0 ], [ 40, 2.0 ], [ 50, 0.0 ], [ 60, 11.0 ], [ 70, 0.0 ], [ 80, 8.0 ], [ 90, 1.0 ], [ 100, 11.0 ], [ 110, 19.0 ], [ 120, 4.0 ], [ 130, 23.0 ], [ 140, 83.0 ], [ 150, 4.0 ], [ 160, 15.0 ], [ 170, 34.0 ], [ 180, 41.0 ], [ 190, 72.0 ], [ 200, 15.0 ], [ 210, 28.0 ], [ 220, 5.0 ], [ 230, 12.0 ], [ 240, 8.0 ], [ 250, 7.0 ], [ 260, 3.0 ], [ 270, 6.0 ], [ 280, 3.0 ], [ 290, 1766.0 ], [ 300, 120551.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCFS2_R2", "pairs": [ [ 40, 4.0 ], [ 50, 2.0 ], [ 60, 11.0 ], [ 70, 3.0 ], [ 80, 19.0 ], [ 90, 5.0 ], [ 100, 19.0 ], [ 110, 49.0 ], [ 120, 27.0 ], [ 130, 48.0 ], [ 140, 128.0 ], [ 150, 21.0 ], [ 160, 29.0 ], [ 170, 51.0 ], [ 180, 48.0 ], [ 190, 107.0 ], [ 200, 22.0 ], [ 210, 55.0 ], [ 220, 16.0 ], [ 230, 9.0 ], [ 240, 13.0 ], [ 250, 9.0 ], [ 260, 6.0 ], [ 270, 15.0 ], [ 280, 27.0 ], [ 290, 3118.0 ], [ 300, 67424.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCMS1_R2", "pairs": [ [ 30, 1.0 ], [ 40, 19.0 ], [ 50, 0.0 ], [ 60, 5.0 ], [ 70, 11.0 ], [ 80, 12.0 ], [ 90, 2.0 ], [ 100, 9.0 ], [ 110, 15.0 ], [ 120, 30.0 ], [ 130, 42.0 ], [ 140, 34.0 ], [ 150, 6.0 ], [ 160, 8.0 ], [ 170, 6.0 ], [ 180, 16.0 ], [ 190, 13.0 ], [ 200, 8.0 ], [ 210, 3.0 ], [ 220, 13.0 ], [ 230, 1.0 ], [ 240, 5.0 ], [ 250, 10.0 ], [ 260, 0.0 ], [ 270, 6.0 ], [ 280, 2.0 ], [ 290, 1946.0 ], [ 300, 239456.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCMS2_R2", "pairs": [ [ 30, 1.0 ], [ 40, 24.0 ], [ 50, 2.0 ], [ 60, 20.0 ], [ 70, 50.0 ], [ 80, 42.0 ], [ 90, 9.0 ], [ 100, 18.0 ], [ 110, 72.0 ], [ 120, 16.0 ], [ 130, 73.0 ], [ 140, 105.0 ], [ 150, 22.0 ], [ 160, 39.0 ], [ 170, 64.0 ], [ 180, 69.0 ], [ 190, 129.0 ], [ 200, 30.0 ], [ 210, 48.0 ], [ 220, 9.0 ], [ 230, 27.0 ], [ 240, 12.0 ], [ 250, 18.0 ], [ 260, 7.0 ], [ 270, 16.0 ], [ 280, 14.0 ], [ 290, 3967.0 ], [ 300, 89298.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPFS1_R2", "pairs": [ [ 40, 7.0 ], [ 50, 1.0 ], [ 60, 2.0 ], [ 70, 2.0 ], [ 80, 15.0 ], [ 90, 2.0 ], [ 100, 4.0 ], [ 110, 13.0 ], [ 120, 18.0 ], [ 130, 13.0 ], [ 140, 28.0 ], [ 150, 3.0 ], [ 160, 14.0 ], [ 170, 10.0 ], [ 180, 27.0 ], [ 190, 16.0 ], [ 200, 22.0 ], [ 210, 3.0 ], [ 220, 14.0 ], [ 230, 0.0 ], [ 240, 1.0 ], [ 250, 1.0 ], [ 260, 3.0 ], [ 270, 4.0 ], [ 280, 3.0 ], [ 290, 991.0 ], [ 300, 140741.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPFS2_R2", "pairs": [ [ 30, 2.0 ], [ 40, 17.0 ], [ 50, 0.0 ], [ 60, 21.0 ], [ 70, 33.0 ], [ 80, 48.0 ], [ 90, 3.0 ], [ 100, 26.0 ], [ 110, 61.0 ], [ 120, 23.0 ], [ 130, 54.0 ], [ 140, 146.0 ], [ 150, 17.0 ], [ 160, 42.0 ], [ 170, 82.0 ], [ 180, 120.0 ], [ 190, 136.0 ], [ 200, 44.0 ], [ 210, 70.0 ], [ 220, 6.0 ], [ 230, 20.0 ], [ 240, 7.0 ], [ 250, 9.0 ], [ 260, 8.0 ], [ 270, 13.0 ], [ 280, 14.0 ], [ 290, 2851.0 ], [ 300, 128234.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPMS1_R2", "pairs": [ [ 30, 1.0 ], [ 40, 3.0 ], [ 50, 8.0 ], [ 60, 31.0 ], [ 70, 3.0 ], [ 80, 14.0 ], [ 90, 2.0 ], [ 100, 11.0 ], [ 110, 10.0 ], [ 120, 5.0 ], [ 130, 7.0 ], [ 140, 33.0 ], [ 150, 4.0 ], [ 160, 1.0 ], [ 170, 18.0 ], [ 180, 25.0 ], [ 190, 21.0 ], [ 200, 5.0 ], [ 210, 20.0 ], [ 220, 8.0 ], [ 230, 1.0 ], [ 240, 2.0 ], [ 250, 2.0 ], [ 260, 11.0 ], [ 270, 7.0 ], [ 280, 4.0 ], [ 290, 276.0 ], [ 300, 81470.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPMS2_R2", "pairs": [ [ 40, 4.0 ], [ 50, 0.0 ], [ 60, 6.0 ], [ 70, 20.0 ], [ 80, 6.0 ], [ 90, 1.0 ], [ 100, 2.0 ], [ 110, 14.0 ], [ 120, 2.0 ], [ 130, 9.0 ], [ 140, 15.0 ], [ 150, 10.0 ], [ 160, 7.0 ], [ 170, 12.0 ], [ 180, 28.0 ], [ 190, 33.0 ], [ 200, 9.0 ], [ 210, 11.0 ], [ 220, 2.0 ], [ 230, 1.0 ], [ 240, 2.0 ], [ 250, 1.0 ], [ 260, 1.0 ], [ 270, 6.0 ], [ 280, 11.0 ], [ 290, 666.0 ], [ 300, 85911.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVFS1_R2", "pairs": [ [ 40, 2.0 ], [ 50, 0.0 ], [ 60, 3.0 ], [ 70, 1.0 ], [ 80, 6.0 ], [ 90, 1.0 ], [ 100, 1.0 ], [ 110, 6.0 ], [ 120, 3.0 ], [ 130, 5.0 ], [ 140, 16.0 ], [ 150, 3.0 ], [ 160, 2.0 ], [ 170, 12.0 ], [ 180, 6.0 ], [ 190, 14.0 ], [ 200, 3.0 ], [ 210, 6.0 ], [ 220, 3.0 ], [ 230, 5.0 ], [ 240, 6.0 ], [ 250, 0.0 ], [ 260, 1.0 ], [ 270, 5.0 ], [ 280, 7.0 ], [ 290, 621.0 ], [ 300, 71222.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVFS2_R2", "pairs": [ [ 30, 1.0 ], [ 40, 1.0 ], [ 50, 0.0 ], [ 60, 5.0 ], [ 70, 2.0 ], [ 80, 22.0 ], [ 90, 3.0 ], [ 100, 6.0 ], [ 110, 28.0 ], [ 120, 7.0 ], [ 130, 49.0 ], [ 140, 127.0 ], [ 150, 10.0 ], [ 160, 9.0 ], [ 170, 22.0 ], [ 180, 51.0 ], [ 190, 63.0 ], [ 200, 22.0 ], [ 210, 46.0 ], [ 220, 10.0 ], [ 230, 11.0 ], [ 240, 5.0 ], [ 250, 5.0 ], [ 260, 5.0 ], [ 270, 2.0 ], [ 280, 17.0 ], [ 290, 1918.0 ], [ 300, 99037.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVMS1_R2", "pairs": [ [ 30, 2.0 ], [ 40, 12.0 ], [ 50, 0.0 ], [ 60, 2.0 ], [ 70, 54.0 ], [ 80, 3.0 ], [ 90, 4.0 ], [ 100, 4.0 ], [ 110, 2.0 ], [ 120, 3.0 ], [ 130, 15.0 ], [ 140, 25.0 ], [ 150, 2.0 ], [ 160, 4.0 ], [ 170, 11.0 ], [ 180, 37.0 ], [ 190, 39.0 ], [ 200, 28.0 ], [ 210, 7.0 ], [ 220, 33.0 ], [ 230, 9.0 ], [ 240, 0.0 ], [ 250, 4.0 ], [ 260, 4.0 ], [ 270, 5.0 ], [ 280, 10.0 ], [ 290, 2750.0 ], [ 300, 162790.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVMS2_R2", "pairs": [ [ 30, 2.0 ], [ 40, 9.0 ], [ 50, 1.0 ], [ 60, 6.0 ], [ 70, 45.0 ], [ 80, 16.0 ], [ 90, 0.0 ], [ 100, 5.0 ], [ 110, 12.0 ], [ 120, 5.0 ], [ 130, 12.0 ], [ 140, 42.0 ], [ 150, 15.0 ], [ 160, 12.0 ], [ 170, 9.0 ], [ 180, 54.0 ], [ 190, 1.0 ], [ 200, 4.0 ], [ 210, 5.0 ], [ 220, 27.0 ], [ 230, 7.0 ], [ 240, 2.0 ], [ 250, 0.0 ], [ 260, 7.0 ], [ 270, 4.0 ], [ 280, 6.0 ], [ 290, 2220.0 ], [ 300, 158531.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAFS1_R2", "pairs": [ [ 50, 1.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 1.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 1.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 5.0 ], [ 295, 435.0 ], [ 300, 164039.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAFS2_R2", "pairs": [ [ 50, 1.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 1.0 ], [ 270, 0.0 ], [ 275, 2.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 300.0 ], [ 300, 127481.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAMS1_R2", "pairs": [ [ 50, 4.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 2.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 1.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 1.0 ], [ 285, 0.0 ], [ 290, 1.0 ], [ 295, 375.0 ], [ 300, 151346.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAMS2_R2", "pairs": [ [ 50, 1.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 1.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 5.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 1.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 4.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 3.0 ], [ 295, 392.0 ], [ 300, 151266.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICFS1_R2", "pairs": [ [ 30, 3.0 ], [ 40, 31.0 ], [ 50, 0.0 ], [ 60, 1.0 ], [ 70, 0.0 ], [ 80, 6.0 ], [ 90, 0.0 ], [ 100, 1.0 ], [ 110, 0.0 ], [ 120, 7.0 ], [ 130, 9.0 ], [ 140, 16.0 ], [ 150, 7.0 ], [ 160, 1.0 ], [ 170, 2.0 ], [ 180, 11.0 ], [ 190, 0.0 ], [ 200, 0.0 ], [ 210, 0.0 ], [ 220, 5.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 1.0 ], [ 260, 0.0 ], [ 270, 13.0 ], [ 280, 1.0 ], [ 290, 899.0 ], [ 300, 138895.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICFS2_R2", "pairs": [ [ 30, 2.0 ], [ 40, 12.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 4.0 ], [ 80, 3.0 ], [ 90, 2.0 ], [ 100, 20.0 ], [ 110, 0.0 ], [ 120, 4.0 ], [ 130, 3.0 ], [ 140, 22.0 ], [ 150, 3.0 ], [ 160, 2.0 ], [ 170, 0.0 ], [ 180, 26.0 ], [ 190, 0.0 ], [ 200, 0.0 ], [ 210, 0.0 ], [ 220, 14.0 ], [ 230, 1.0 ], [ 240, 0.0 ], [ 250, 0.0 ], [ 260, 2.0 ], [ 270, 3.0 ], [ 280, 7.0 ], [ 290, 670.0 ], [ 300, 172016.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICMS1_R2", "pairs": [ [ 30, 2.0 ], [ 40, 1.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 1.0 ], [ 80, 3.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 2.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 1.0 ], [ 150, 0.0 ], [ 160, 1.0 ], [ 170, 1.0 ], [ 180, 5.0 ], [ 190, 0.0 ], [ 200, 0.0 ], [ 210, 0.0 ], [ 220, 2.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0 ], [ 260, 1.0 ], [ 270, 4.0 ], [ 280, 5.0 ], [ 290, 568.0 ], [ 300, 194280.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICMS2_R2", "pairs": [ [ 30, 2.0 ], [ 40, 2.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 1.0 ], [ 140, 3.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 1.0 ], [ 190, 0.0 ], [ 200, 1.0 ], [ 210, 0.0 ], [ 220, 3.0 ], [ 230, 1.0 ], [ 240, 2.0 ], [ 250, 2.0 ], [ 260, 0.0 ], [ 270, 6.0 ], [ 280, 5.0 ], [ 290, 422.0 ], [ 300, 125214.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPFS1_R2", "pairs": [ [ 40, 4.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 2.0 ], [ 80, 1.0 ], [ 90, 1.0 ], [ 100, 0.0 ], [ 110, 2.0 ], [ 120, 4.0 ], [ 130, 1.0 ], [ 140, 0.0 ], [ 150, 8.0 ], [ 160, 0.0 ], [ 170, 1.0 ], [ 180, 1.0 ], [ 190, 0.0 ], [ 200, 2.0 ], [ 210, 3.0 ], [ 220, 2.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0 ], [ 260, 0.0 ], [ 270, 5.0 ], [ 280, 9.0 ], [ 290, 650.0 ], [ 300, 160266.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPFS2_R2", "pairs": [ [ 40, 1.0 ], [ 50, 1.0 ], [ 60, 0.0 ], [ 70, 1.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 6.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 2.0 ], [ 140, 0.0 ], [ 150, 2.0 ], [ 160, 1.0 ], [ 170, 0.0 ], [ 180, 2.0 ], [ 190, 1.0 ], [ 200, 1.0 ], [ 210, 0.0 ], [ 220, 3.0 ], [ 230, 1.0 ], [ 240, 0.0 ], [ 250, 0.0 ], [ 260, 0.0 ], [ 270, 9.0 ], [ 280, 4.0 ], [ 290, 554.0 ], [ 300, 223839.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPMS1_R2", "pairs": [ [ 40, 9.0 ], [ 50, 2.0 ], [ 60, 0.0 ], [ 70, 2.0 ], [ 80, 4.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 1.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 13.0 ], [ 150, 2.0 ], [ 160, 1.0 ], [ 170, 1.0 ], [ 180, 7.0 ], [ 190, 0.0 ], [ 200, 0.0 ], [ 210, 0.0 ], [ 220, 10.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0 ], [ 260, 0.0 ], [ 270, 15.0 ], [ 280, 5.0 ], [ 290, 1252.0 ], [ 300, 344435.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPMS2_R2", "pairs": [ [ 30, 1.0 ], [ 40, 0.0 ], [ 50, 1.0 ], [ 60, 0.0 ], [ 70, 1.0 ], [ 80, 1.0 ], [ 90, 0.0 ], [ 100, 1.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 11.0 ], [ 150, 3.0 ], [ 160, 0.0 ], [ 170, 1.0 ], [ 180, 14.0 ], [ 190, 0.0 ], [ 200, 1.0 ], [ 210, 0.0 ], [ 220, 1.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 4.0 ], [ 260, 1.0 ], [ 270, 4.0 ], [ 280, 9.0 ], [ 290, 502.0 ], [ 300, 243533.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVFS1_R2", "pairs": [ [ 50, 2.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 2.0 ], [ 85, 1.0 ], [ 90, 0.0 ], [ 95, 1.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 1.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 2.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 2.0 ], [ 285, 1.0 ], [ 290, 21.0 ], [ 295, 667.0 ], [ 300, 228243.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVFS2_R2", "pairs": [ [ 40, 36.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 4.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 2.0 ], [ 130, 1.0 ], [ 140, 0.0 ], [ 150, 1.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 3.0 ], [ 190, 0.0 ], [ 200, 0.0 ], [ 210, 1.0 ], [ 220, 2.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0 ], [ 260, 0.0 ], [ 270, 4.0 ], [ 280, 7.0 ], [ 290, 596.0 ], [ 300, 126763.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVMS1_R2", "pairs": [ [ 30, 1.0 ], [ 40, 18.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 1.0 ], [ 80, 7.0 ], [ 90, 1.0 ], [ 100, 1.0 ], [ 110, 0.0 ], [ 120, 3.0 ], [ 130, 1.0 ], [ 140, 11.0 ], [ 150, 47.0 ], [ 160, 0.0 ], [ 170, 1.0 ], [ 180, 3.0 ], [ 190, 1.0 ], [ 200, 1.0 ], [ 210, 0.0 ], [ 220, 7.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 2.0 ], [ 260, 0.0 ], [ 270, 3.0 ], [ 280, 5.0 ], [ 290, 835.0 ], [ 300, 155170.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVMS2_R2", "pairs": [ [ 80, 1.0 ], [ 85, 1.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 1.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 1.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 2.0 ], [ 220, 0.0 ], [ 225, 1.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 2.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 2.0 ], [ 275, 1.0 ], [ 280, 7.0 ], [ 285, 16.0 ], [ 290, 4.0 ], [ 295, 314.0 ], [ 300, 109384.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAFS1_R2", "pairs": [ [ 30, 1.0 ], [ 40, 0.0 ], [ 50, 1.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 4.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 2.0 ], [ 120, 0.0 ], [ 130, 1.0 ], [ 140, 1.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 1.0 ], [ 190, 0.0 ], [ 200, 0.0 ], [ 210, 0.0 ], [ 220, 0.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0 ], [ 260, 0.0 ], [ 270, 2.0 ], [ 280, 0.0 ], [ 290, 337.0 ], [ 300, 132020.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAFS2_R2", "pairs": [ [ 75, 1.0 ], [ 80, 1.0 ], [ 85, 1.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 1.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 2.0 ], [ 145, 7.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 1.0 ], [ 190, 0.0 ], [ 195, 1.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 1.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 274.0 ], [ 300, 83859.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAMS1_R2", "pairs": [ [ 85, 1.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 3.0 ], [ 130, 3.0 ], [ 135, 1.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 1.0 ], [ 155, 1.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 2.0 ], [ 295, 495.0 ], [ 300, 162936.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAMS2_R2", "pairs": [ [ 80, 1.0 ], [ 85, 1.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 1.0 ], [ 125, 0.0 ], [ 130, 3.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 2.0 ], [ 155, 1.0 ], [ 160, 3.0 ], [ 165, 1.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 1.0 ], [ 190, 1.0 ], [ 195, 1.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 7.0 ], [ 215, 1.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 1.0 ], [ 270, 1.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 1.0 ], [ 290, 4.0 ], [ 295, 626.0 ], [ 300, 147088.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCFS1_R2", "pairs": [ [ 40, 3.0 ], [ 50, 1.0 ], [ 60, 0.0 ], [ 70, 2.0 ], [ 80, 4.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 1.0 ], [ 130, 1.0 ], [ 140, 4.0 ], [ 150, 9.0 ], [ 160, 2.0 ], [ 170, 0.0 ], [ 180, 9.0 ], [ 190, 2.0 ], [ 200, 8.0 ], [ 210, 1.0 ], [ 220, 1.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0 ], [ 260, 0.0 ], [ 270, 1.0 ], [ 280, 6.0 ], [ 290, 807.0 ], [ 300, 187382.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCFS2_R2", "pairs": [ [ 30, 1.0 ], [ 40, 6.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 3.0 ], [ 80, 3.0 ], [ 90, 1.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 1.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 7.0 ], [ 160, 1.0 ], [ 170, 0.0 ], [ 180, 4.0 ], [ 190, 1.0 ], [ 200, 0.0 ], [ 210, 2.0 ], [ 220, 1.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 2.0 ], [ 260, 2.0 ], [ 270, 4.0 ], [ 280, 10.0 ], [ 290, 740.0 ], [ 300, 151415.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCMS1_R2", "pairs": [ [ 30, 1.0 ], [ 40, 1.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 3.0 ], [ 80, 4.0 ], [ 90, 1.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 1.0 ], [ 130, 3.0 ], [ 140, 0.0 ], [ 150, 2.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 5.0 ], [ 190, 0.0 ], [ 200, 10.0 ], [ 210, 0.0 ], [ 220, 9.0 ], [ 230, 1.0 ], [ 240, 0.0 ], [ 250, 1.0 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 7.0 ], [ 290, 574.0 ], [ 300, 160764.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCMS2_R2", "pairs": [ [ 30, 1.0 ], [ 40, 7.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 1.0 ], [ 80, 6.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 5.0 ], [ 140, 7.0 ], [ 150, 1.0 ], [ 160, 1.0 ], [ 170, 0.0 ], [ 180, 4.0 ], [ 190, 0.0 ], [ 200, 0.0 ], [ 210, 0.0 ], [ 220, 6.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0 ], [ 260, 0.0 ], [ 270, 11.0 ], [ 280, 13.0 ], [ 290, 496.0 ], [ 300, 126893.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPFS1_R2", "pairs": [ [ 110, 1.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 1.0 ], [ 130, 0.0 ], [ 135, 2.0 ], [ 140, 1.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 1.0 ], [ 185, 0.0 ], [ 190, 1.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 2.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 3.0 ], [ 290, 1.0 ], [ 295, 555.0 ], [ 300, 233055.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPFS2_R2", "pairs": [ [ 70, 1.0 ], [ 75, 0.0 ], [ 80, 3.0 ], [ 85, 3.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 1.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 3.0 ], [ 190, 0.0 ], [ 195, 1.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 3.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 1.0 ], [ 240, 0.0 ], [ 245, 1.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 1.0 ], [ 275, 4.0 ], [ 280, 3.0 ], [ 285, 2.0 ], [ 290, 1.0 ], [ 295, 427.0 ], [ 300, 201317.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPMS1_R2", "pairs": [ [ 70, 1.0 ], [ 75, 0.0 ], [ 80, 2.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 1.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 8.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 10.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 1.0 ], [ 205, 1.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 1.0 ], [ 225, 9.0 ], [ 230, 0.0 ], [ 235, 1.0 ], [ 240, 1.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 1.0 ], [ 285, 0.0 ], [ 290, 5.0 ], [ 295, 504.0 ], [ 300, 210757.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPMS2_R2", "pairs": [ [ 40, 11.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 1.0 ], [ 80, 2.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 1.0 ], [ 120, 0.0 ], [ 130, 2.0 ], [ 140, 4.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 2.0 ], [ 190, 1.0 ], [ 200, 0.0 ], [ 210, 1.0 ], [ 220, 3.0 ], [ 230, 0.0 ], [ 240, 2.0 ], [ 250, 0.0 ], [ 260, 0.0 ], [ 270, 4.0 ], [ 280, 6.0 ], [ 290, 409.0 ], [ 300, 133742.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVFS1_R2", "pairs": [ [ 30, 1.0 ], [ 40, 31.0 ], [ 50, 1.0 ], [ 60, 0.0 ], [ 70, 2.0 ], [ 80, 1.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 2.0 ], [ 130, 3.0 ], [ 140, 3.0 ], [ 150, 1.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0 ], [ 210, 1.0 ], [ 220, 1.0 ], [ 230, 1.0 ], [ 240, 0.0 ], [ 250, 0.0 ], [ 260, 1.0 ], [ 270, 4.0 ], [ 280, 2.0 ], [ 290, 488.0 ], [ 300, 109252.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVFS2_R2", "pairs": [ [ 85, 4.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 1.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 1.0 ], [ 145, 1.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 1.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 1.0 ], [ 265, 0.0 ], [ 270, 2.0 ], [ 275, 1.0 ], [ 280, 1.0 ], [ 285, 3.0 ], [ 290, 12.0 ], [ 295, 470.0 ], [ 300, 149557.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVMS1_R2", "pairs": [ [ 30, 1.0 ], [ 40, 32.0 ], [ 50, 1.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 9.0 ], [ 90, 1.0 ], [ 100, 1.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 2.0 ], [ 140, 27.0 ], [ 150, 6.0 ], [ 160, 4.0 ], [ 170, 0.0 ], [ 180, 18.0 ], [ 190, 0.0 ], [ 200, 0.0 ], [ 210, 0.0 ], [ 220, 24.0 ], [ 230, 1.0 ], [ 240, 0.0 ], [ 250, 0.0 ], [ 260, 0.0 ], [ 270, 10.0 ], [ 280, 3.0 ], [ 290, 1201.0 ], [ 300, 345970.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVMS2_R2", "pairs": [ [ 30, 1.0 ], [ 40, 2.0 ], [ 50, 3.0 ], [ 60, 0.0 ], [ 70, 1.0 ], [ 80, 3.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 5.0 ], [ 150, 1.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 3.0 ], [ 190, 0.0 ], [ 200, 0.0 ], [ 210, 0.0 ], [ 220, 15.0 ], [ 230, 0.0 ], [ 240, 2.0 ], [ 250, 0.0 ], [ 260, 0.0 ], [ 270, 8.0 ], [ 280, 9.0 ], [ 290, 330.0 ], [ 300, 116941.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null } ] } ], "pconfig": { "id": "fastqc_sequence_length_distribution_plot", "title": "FastQC: Sequence Length Distribution", "anchor": null, "table_title": null, "height": null, "width": null, "square": false, "logswitch": false, "logswitch_active": false, "logswitch_label": "Log10", "cpswitch": true, "cpswitch_c_active": true, "cpswitch_counts_label": "Counts", "cpswitch_percent_label": "Percentages", "xLog": null, "yLog": null, "xlog": false, "ylog": false, "data_labels": [], "xTitle": null, "yTitle": null, "xlab": "Sequence Length (bp)", "ylab": "Read Count", "xsuffix": null, "ysuffix": null, "tt_suffix": null, "xLabFormat": null, "yLabFormat": null, "xLabelFormat": null, "yLabelFormat": null, "xlab_format": null, "ylab_format": null, "tt_label": "{point.x} bp: {point.y}", "xDecimals": null, "yDecimals": null, "decimalPlaces": null, "x_decimals": null, "y_decimals": null, "tt_decimals": null, "xmin": null, "xmax": null, "ymin": 0, "ymax": null, "xFloor": null, "xCeiling": null, "yFloor": null, "yCeiling": null, "x_clipmin": null, "x_clipmax": null, "y_clipmin": null, "y_clipmax": null, "save_data_file": true, "showlegend": false, "xMinRange": null, "yMinRange": null, "x_minrange": null, "y_minrange": null, "xPlotBands": null, "yPlotBands": null, "xPlotLines": null, "yPlotLines": null, "x_bands": null, "y_bands": null, "x_lines": null, "y_lines": null, "categories": false, "smooth_points": 500, "smooth_points_sumcounts": null, "extra_series": null, "style": null, "hide_zero_cats": false, "hide_empty": false, "colors": { "CAFS1_R2": "#f0ad4e", "CAFS2_R2": "#f0ad4e", "CAMS1_R2": "#f0ad4e", "CAMS2_R2": "#f0ad4e", "CCFS1_R2": "#f0ad4e", "CCFS2_R2": "#f0ad4e", "CCMS1_R2": "#f0ad4e", "CCMS2_R2": "#f0ad4e", "CPFS1_R2": "#f0ad4e", "CPFS2_R2": "#f0ad4e", "CPMS1_R2": "#f0ad4e", "CPMS2_R2": "#f0ad4e", "CVFS1_R2": "#f0ad4e", "CVFS2_R2": "#f0ad4e", "CVMS1_R2": "#f0ad4e", "CVMS2_R2": "#f0ad4e", "DAFS1_R2": "#f0ad4e", "DAFS2_R2": "#f0ad4e", "DAMS1_R2": "#f0ad4e", "DAMS2_R2": "#f0ad4e", "DCFS1_R2": "#f0ad4e", "DCFS2_R2": "#f0ad4e", "DCMS1_R2": "#f0ad4e", "DCMS2_R2": "#f0ad4e", "DPFS1_R2": "#f0ad4e", "DPFS2_R2": "#f0ad4e", "DPMS1_R2": "#f0ad4e", "DPMS2_R2": "#f0ad4e", "DVFS1_R2": "#f0ad4e", "DVFS2_R2": "#f0ad4e", "DVMS1_R2": "#f0ad4e", "DVMS2_R2": "#f0ad4e", "IAFS1_R2": "#f0ad4e", "IAFS2_R2": "#f0ad4e", "IAMS1_R2": "#f0ad4e", "IAMS2_R2": "#f0ad4e", "ICFS1_R2": "#f0ad4e", "ICFS2_R2": "#f0ad4e", "ICMS1_R2": "#f0ad4e", "ICMS2_R2": "#f0ad4e", "IPFS1_R2": "#f0ad4e", "IPFS2_R2": "#f0ad4e", "IPMS1_R2": "#f0ad4e", "IPMS2_R2": "#f0ad4e", "IVFS1_R2": "#f0ad4e", "IVFS2_R2": "#f0ad4e", "IVMS1_R2": "#f0ad4e", "IVMS2_R2": "#f0ad4e", "JAFS1_R2": "#f0ad4e", "JAFS2_R2": "#f0ad4e", "JAMS1_R2": "#f0ad4e", "JAMS2_R2": "#f0ad4e", "JCFS1_R2": "#f0ad4e", "JCFS2_R2": "#f0ad4e", "JCMS1_R2": "#f0ad4e", "JCMS2_R2": "#f0ad4e", "JPFS1_R2": "#f0ad4e", "JPFS2_R2": "#f0ad4e", "JPMS1_R2": "#f0ad4e", "JPMS2_R2": "#f0ad4e", "JVFS1_R2": "#f0ad4e", "JVFS2_R2": "#f0ad4e", "JVMS1_R2": "#f0ad4e", "JVMS2_R2": "#f0ad4e" } }, "add_log_tab": false, "add_pct_tab": false, "l_active": false, "p_active": false, "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "yaxis" ], "square": false, "flat": false, "defer_render": false }, "fastqc_sequence_duplication_levels_plot": { "id": "fastqc_sequence_duplication_levels_plot", "anchor": "fastqc_sequence_duplication_levels_plot", "plot_type": "xy_line", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 500, "hoverlabel": { "namelength": -1 }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "white", "plot_bgcolor": "white", "showlegend": false, "title": { "font": { "size": 20 }, "text": "FastQC: Sequence Duplication Levels", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "hoverdistance": -1 }, "datasets": [ { "plot_id": "fastqc_sequence_duplication_levels_plot", "label": "1", "uid": "fastqc_sequence_duplication_levels_plot", "dconfig": { "title": "FastQC: Sequence Duplication Levels
64 samples" }, "layout": { "title": { "text": "FastQC: Sequence Duplication Levels
64 samples" }, "xaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "Sequence Duplication Level" }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null }, "type": "category" }, "yaxis": { "hoverformat": ",.2f", "ticksuffix": "%", "title": { "text": "% of Library" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": 100 } } }, "trace_params": { "hovertemplate": "%{text}
%{x}: %{y}", "mode": "lines", "line": { "width": 2 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "n_samples": 64, "lines": [ { "name": "CAFS1_R2", "pairs": [ [ 1.0, 4.0093692242941055 ], [ 2.0, 1.723790875985873 ], [ 3.0, 1.0888063388658114 ], [ 4.0, 0.75636966957625 ], [ 5.0, 0.6374244392799848 ], [ 6.0, 0.5343385730232217 ], [ 7.0, 0.43552253554632453 ], [ 8.0, 0.3220670851098871 ], [ 9.0, 0.3403663513093125 ], [ ">10", 2.210551356890589 ], [ ">50", 0.4593115816055776 ], [ ">100", 12.142173098858736 ], [ ">500", 21.0191471322 ], [ ">1k", 54.320761737454326 ], [ ">5k", 0.0 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAFS2_R2", "pairs": [ [ 1.0, 4.107789017722722 ], [ 2.0, 1.723409313013391 ], [ 3.0, 1.1291302395604976 ], [ 4.0, 0.8663268270779958 ], [ 5.0, 0.6801193840627558 ], [ 6.0, 0.53881302659729 ], [ 7.0, 0.41137318084572516 ], [ 8.0, 0.35920868439819337 ], [ 9.0, 0.31496790893003357 ], [ ">10", 2.0839386175748134 ], [ ">50", 0.8339716330788939 ], [ ">100", 13.603708301418346 ], [ ">500", 19.244737328649535 ], [ ">1k", 54.10250653706981 ], [ ">5k", 0.0 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAMS1_R2", "pairs": [ [ 1.0, 4.68777640191049 ], [ 2.0, 1.8996040223706951 ], [ 3.0, 1.2777422471390276 ], [ 4.0, 0.8736001306317952 ], [ 5.0, 0.7109907605219828 ], [ 6.0, 0.4368000653158976 ], [ 7.0, 0.4857869885288955 ], [ 8.0, 0.3102505136823198 ], [ 9.0, 0.36740192409748396 ], [ ">10", 3.3807780756303663 ], [ ">50", 0.6130169140959871 ], [ ">100", 14.044278735593082 ], [ ">500", 12.137870973887248 ], [ ">1k", 58.77410224659473 ], [ ">5k", 0.0 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAMS2_R2", "pairs": [ [ 1.0, 4.285184786637493 ], [ 2.0, 1.81020361801595 ], [ 3.0, 1.1639585350981025 ], [ 4.0, 0.8967323074715736 ], [ 5.0, 0.747276922892978 ], [ 6.0, 0.5416263137128304 ], [ 7.0, 0.4310293291246697 ], [ 8.0, 0.31086719992347883 ], [ 9.0, 0.3335844183794254 ], [ ">10", 3.2868228176524745 ], [ ">50", 0.39217092913423485 ], [ ">100", 11.782464698638162 ], [ ">500", 9.852696772959337 ], [ ">1k", 64.1653813503593 ], [ ">5k", 0.0 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCFS1_R2", "pairs": [ [ 1.0, 6.01189734501839 ], [ 2.0, 2.261326244767799 ], [ 3.0, 1.5229340015783135 ], [ 4.0, 1.0762066944486748 ], [ 5.0, 0.7753118553489596 ], [ 6.0, 0.6285563970150494 ], [ 7.0, 0.4134996561861118 ], [ 8.0, 0.3212006257874261 ], [ 9.0, 0.29489540212380067 ], [ ">10", 3.091094528051983 ], [ ">50", 1.4910908360907669 ], [ ">100", 10.539164786073922 ], [ ">500", 12.184856498082487 ], [ ">1k", 59.38796512942631 ], [ ">5k", 0.0 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCFS2_R2", "pairs": [ [ 1.0, 6.220227685850669 ], [ 2.0, 2.3724254799284727 ], [ 3.0, 1.6078896940379017 ], [ 4.0, 1.0955718993689623 ], [ 5.0, 0.7881812225675988 ], [ 6.0, 0.5822688781718137 ], [ 7.0, 0.3931053847555899 ], [ 8.0, 0.3507406440425815 ], [ 9.0, 0.31034635638599206 ], [ ">10", 3.4556820476948165 ], [ ">50", 1.8133094251695823 ], [ ">100", 14.159675663426913 ], [ ">500", 11.806462100798527 ], [ ">1k", 55.04411351780058 ], [ ">5k", 0.0 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCMS1_R2", "pairs": [ [ 1.0, 5.825039287585123 ], [ 2.0, 2.215343587789895 ], [ 3.0, 1.4157817038906615 ], [ 4.0, 1.0133815895995049 ], [ 5.0, 0.7881327682270585 ], [ 6.0, 0.594314014953093 ], [ 7.0, 0.5666936520786704 ], [ 8.0, 0.36573170150959566 ], [ 9.0, 0.29144244964045907 ], [ ">10", 3.300157150340492 ], [ ">50", 2.2829658555169297 ], [ ">100", 9.488547073670174 ], [ ">500", 14.587837516072193 ], [ ">1k", 57.26463164912615 ], [ ">5k", 0.0 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCMS2_R2", "pairs": [ [ 1.0, 5.846447596268592 ], [ 2.0, 2.191719606140471 ], [ 3.0, 1.4655474474794716 ], [ 4.0, 1.0887504252931348 ], [ 5.0, 0.8099612538911147 ], [ 6.0, 0.5392970856629241 ], [ 7.0, 0.44433611106879334 ], [ 8.0, 0.44687517456061504 ], [ 9.0, 0.3519141999664843 ], [ ">10", 3.2774231552434205 ], [ ">50", 2.113008637893999 ], [ ">100", 9.589027183213743 ], [ ">500", 16.14488911909731 ], [ ">1k", 55.69080300421992 ], [ ">5k", 0.0 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPFS1_R2", "pairs": [ [ 1.0, 5.1295239876554755 ], [ 2.0, 1.4522184072357083 ], [ 3.0, 1.030046358766082 ], [ 4.0, 0.8496880469198809 ], [ 5.0, 0.734793122336375 ], [ 6.0, 0.7294491723557468 ], [ 7.0, 0.7434770410548958 ], [ 8.0, 0.7214332473848044 ], [ 9.0, 0.6132182602770838 ], [ ">10", 7.037982124487314 ], [ ">50", 1.4976419820710478 ], [ ">100", 2.402773510039946 ], [ ">500", 3.9558589731600113 ], [ ">1k", 21.383815847483667 ], [ ">5k", 45.02411457428758 ], [ ">10k+", 6.693965344484376 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPFS2_R2", "pairs": [ [ 1.0, 7.9250189740613415 ], [ 2.0, 2.6619491941604534 ], [ 3.0, 1.759565159158891 ], [ 4.0, 1.1830885307379795 ], [ 5.0, 0.9849770079021386 ], [ 6.0, 0.7634269387026206 ], [ 7.0, 0.5586186883343006 ], [ 8.0, 0.41966159203535874 ], [ 9.0, 0.3465556498057949 ], [ ">10", 3.4465824367159246 ], [ ">50", 0.9420063395687307 ], [ ">100", 16.254631903209965 ], [ ">500", 14.873431849636146 ], [ ">1k", 47.88048573597036 ], [ ">5k", 0.0 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPMS1_R2", "pairs": [ [ 1.0, 5.5704068264702755 ], [ 2.0, 2.1049463583896895 ], [ 3.0, 1.4366391672272776 ], [ 4.0, 1.0781432567361824 ], [ 5.0, 0.761250575363807 ], [ 6.0, 0.6240484367807952 ], [ 7.0, 0.5452678539815176 ], [ 8.0, 0.42134334171299087 ], [ 9.0, 0.2748468647098396 ], [ ">10", 4.038168749778706 ], [ ">50", 1.3990192260029033 ], [ ">100", 8.04402860885883 ], [ ">500", 16.25137202138583 ], [ ">1k", 50.30228729242644 ], [ ">5k", 7.148231420174911 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPMS2_R2", "pairs": [ [ 1.0, 7.533560897952407 ], [ 2.0, 2.45730721711911 ], [ 3.0, 1.6495993202361594 ], [ 4.0, 1.2716271846935936 ], [ 5.0, 0.8912133686888665 ], [ 6.0, 0.6533936916743579 ], [ 7.0, 0.5640281867592553 ], [ 8.0, 0.5039628473900878 ], [ 9.0, 0.43950248318903007 ], [ ">10", 3.848576744458606 ], [ ">50", 1.3961528882638188 ], [ ">100", 10.670631955737218 ], [ ">500", 16.645424046645864 ], [ ">1k", 51.475019167191626 ], [ ">5k", 0.0 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVFS1_R2", "pairs": [ [ 1.0, 5.710978022078194 ], [ 2.0, 2.1731798251611196 ], [ 3.0, 1.5382722126507506 ], [ 4.0, 1.0683585382084029 ], [ 5.0, 0.6745608517698107 ], [ 6.0, 0.6180435912161238 ], [ 7.0, 0.4881450488145049 ], [ 8.0, 0.3646274874431409 ], [ 9.0, 0.32816473869882684 ], [ ">10", 3.708261547296743 ], [ ">50", 1.7602391956317627 ], [ ">100", 11.653494498682782 ], [ ">500", 18.636566667578236 ], [ ">1k", 51.277107774769604 ], [ ">5k", 0.0 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVFS2_R2", "pairs": [ [ 1.0, 5.908928208650562 ], [ 2.0, 2.1157213477928587 ], [ 3.0, 1.4627209318074086 ], [ 4.0, 1.0448006655767204 ], [ 5.0, 0.7328115779392275 ], [ 6.0, 0.5136936605752208 ], [ 7.0, 0.4571002911898151 ], [ 8.0, 0.2863527750099159 ], [ 9.0, 0.30473352745987675 ], [ ">10", 3.5479689268542796 ], [ ">50", 1.6750669930056399 ], [ ">100", 15.891127901014812 ], [ ">500", 11.454594704408478 ], [ ">1k", 54.60437848871519 ], [ ">5k", 0.0 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVMS1_R2", "pairs": [ [ 1.0, 5.90792085687485 ], [ 2.0, 2.057110446979778 ], [ 3.0, 1.459392247115028 ], [ 4.0, 1.0274644968478 ], [ 5.0, 0.7471477498309373 ], [ 6.0, 0.6020811064331058 ], [ 7.0, 0.47719290591391983 ], [ 8.0, 0.3141292729216204 ], [ 9.0, 0.28467965358521846 ], [ ">10", 3.61194127527759 ], [ ">50", 1.700442835016688 ], [ ">100", 9.702013481381295 ], [ ">500", 11.173949084880347 ], [ ">1k", 60.93453458694182 ], [ ">5k", 0.0 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVMS2_R2", "pairs": [ [ 1.0, 5.643844014801515 ], [ 2.0, 2.0660813207505857 ], [ 3.0, 1.4411771145803685 ], [ 4.0, 1.1455847255369929 ], [ 5.0, 0.8189003963127587 ], [ 6.0, 0.6463620240415143 ], [ 7.0, 0.49659521359287073 ], [ 8.0, 0.3713516235685665 ], [ 9.0, 0.33894593943640383 ], [ ">10", 3.8786100588995205 ], [ ">50", 1.4258501018151561 ], [ ">100", 8.06638786100589 ], [ ">500", 9.110376387642049 ], [ ">1k", 64.54993321801581 ], [ ">5k", 0.0 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAFS1_R2", "pairs": [ [ 1.0, 5.260289816390307 ], [ 2.0, 1.7682580989557268 ], [ 3.0, 1.2477896773763053 ], [ 4.0, 0.845205129060599 ], [ 5.0, 0.900810729656691 ], [ 6.0, 0.5071230774363593 ], [ 7.0, 0.48265661317407893 ], [ 8.0, 0.4181541164826121 ], [ 9.0, 0.3403062756480833 ], [ ">10", 6.609281686851499 ], [ ">50", 3.336336035765522 ], [ ">100", 13.548860641243788 ], [ ">500", 13.575551329529912 ], [ ">1k", 33.14983485136623 ], [ ">5k", 18.00954192106229 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAFS2_R2", "pairs": [ [ 1.0, 7.8971215351812365 ], [ 2.0, 2.8411513859275055 ], [ 3.0, 1.6551172707889126 ], [ 4.0, 1.1194029850746268 ], [ 5.0, 0.8128997867803838 ], [ 6.0, 0.5597014925373134 ], [ 7.0, 0.4850746268656716 ], [ 8.0, 0.5543710021321961 ], [ 9.0, 0.21588486140724947 ], [ ">10", 8.232942430703623 ], [ ">50", 8.054371002132196 ], [ ">100", 29.99733475479744 ], [ ">500", 1.4019189765458422 ], [ ">1k", 36.172707889125796 ], [ ">5k", 0.0 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAMS1_R2", "pairs": [ [ 1.0, 4.638041052399963 ], [ 2.0, 1.405085971143872 ], [ 3.0, 0.9147203973218495 ], [ 4.0, 0.7292616226071102 ], [ 5.0, 0.7386917297959953 ], [ 6.0, 0.7072580391663785 ], [ 7.0, 0.5060824191368308 ], [ 8.0, 0.6412472888441832 ], [ 9.0, 0.48093546663313735 ], [ ">10", 8.59868607173168 ], [ ">50", 2.588564423348945 ], [ ">100", 7.11973092760821 ], [ ">500", 0.0 ], [ ">1k", 36.3656366894037 ], [ ">5k", 34.56605790085814 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAMS2_R2", "pairs": [ [ 1.0, 3.8320196983382617 ], [ 2.0, 0.9131516103886463 ], [ 3.0, 0.6199037355077396 ], [ 4.0, 0.6038184090374787 ], [ 5.0, 0.5567997624321014 ], [ 6.0, 0.5790717529293854 ], [ 7.0, 0.5889704153726227 ], [ 8.0, 0.5939197465942414 ], [ 9.0, 0.3674878432051869 ], [ ">10", 7.181479602568702 ], [ ">50", 2.6516042019822073 ], [ ">100", 2.478377609225553 ], [ ">500", 0.0 ], [ ">1k", 0.0 ], [ ">5k", 79.03339561241786 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCFS1_R2", "pairs": [ [ 1.0, 5.056381175857124 ], [ 2.0, 0.9760787381045496 ], [ 3.0, 0.6037348455220962 ], [ 4.0, 0.5475166210402815 ], [ 5.0, 0.5173706166080041 ], [ 6.0, 0.5719593273367227 ], [ 7.0, 0.5760331117194629 ], [ 8.0, 0.5670707860774344 ], [ 9.0, 0.6012905748924521 ], [ ">10", 9.075576847868597 ], [ ">50", 1.6303285099726241 ], [ ">100", 5.7961804197627425 ], [ ">500", 0.0 ], [ ">1k", 0.0 ], [ ">5k", 45.788521705123195 ], [ ">10k+", 27.691956720114717 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCFS2_R2", "pairs": [ [ 1.0, 6.120502209440977 ], [ 2.0, 1.644104650347198 ], [ 3.0, 1.1152416356877324 ], [ 4.0, 0.9931963246124711 ], [ 5.0, 1.0871852423370976 ], [ 6.0, 0.9763624886020903 ], [ 7.0, 0.9917935049449393 ], [ 8.0, 0.7406887844567581 ], [ 9.0, 0.6943957354282106 ], [ ">10", 7.662201024058357 ], [ ">50", 3.742722872974679 ], [ ">100", 3.288209300694396 ], [ ">500", 0.0 ], [ ">1k", 6.695658273128989 ], [ ">5k", 64.2477379532861 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCMS1_R2", "pairs": [ [ 1.0, 4.676037222927933 ], [ 2.0, 0.9102983709796879 ], [ 3.0, 0.4555629574766529 ], [ 4.0, 0.33101758944715926 ], [ 5.0, 0.2875715308322196 ], [ 6.0, 0.23088476863939358 ], [ 7.0, 0.25198713996665 ], [ 8.0, 0.2648140715577274 ], [ 9.0, 0.23460871652067414 ], [ ">10", 8.03172803594851 ], [ ">50", 3.861320180901113 ], [ ">100", 7.149979932058639 ], [ ">500", 2.9915714646287017 ], [ ">1k", 0.0 ], [ ">5k", 0.0 ], [ ">10k+", 70.32261801811494 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCMS2_R2", "pairs": [ [ 1.0, 6.106092292013885 ], [ 2.0, 1.354550376322969 ], [ 3.0, 0.9936200252651246 ], [ 4.0, 0.8917102790840861 ], [ 5.0, 0.7165529028354264 ], [ 6.0, 0.8662328425388265 ], [ 7.0, 0.7951083321833101 ], [ 8.0, 0.772815575206208 ], [ 9.0, 0.5923503996772858 ], [ ">10", 8.409677179647774 ], [ ">50", 3.5710873557605542 ], [ ">100", 8.086962983407819 ], [ ">500", 0.0 ], [ ">1k", 0.0 ], [ ">5k", 66.84323945605672 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPFS1_R2", "pairs": [ [ 1.0, 4.531622029050846 ], [ 2.0, 1.0552416912044407 ], [ 3.0, 0.7861480156102509 ], [ 4.0, 0.6537144789303878 ], [ 5.0, 0.5670691331238817 ], [ 6.0, 0.5874977105904564 ], [ 7.0, 0.4931035940207667 ], [ 8.0, 0.473379450259936 ], [ 9.0, 0.49451246143225464 ], [ ">10", 7.944603333380296 ], [ ">50", 2.2041730652728275 ], [ ">100", 3.3157694529367845 ], [ ">500", 0.0 ], [ ">1k", 9.980416742980317 ], [ ">5k", 27.0699784443286 ], [ ">10k+", 39.84277039687795 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPFS2_R2", "pairs": [ [ 1.0, 5.315388283739695 ], [ 2.0, 1.3110584601875752 ], [ 3.0, 0.8833748400917438 ], [ 4.0, 0.6933773380668701 ], [ 5.0, 0.5980001059747023 ], [ 6.0, 0.7176001271696428 ], [ 7.0, 0.6517444192964793 ], [ 8.0, 0.6721823976019439 ], [ 9.0, 0.5790760519881611 ], [ ">10", 8.45375339686769 ], [ ">50", 1.3670736599877373 ], [ ">100", 4.741610966867766 ], [ ">500", 0.0 ], [ ">1k", 8.102522954877486 ], [ ">5k", 41.29455668511131 ], [ ">10k+", 24.618680312171197 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPMS1_R2", "pairs": [ [ 1.0, 7.20461446532444 ], [ 2.0, 2.3169884028633096 ], [ 3.0, 1.423118666390254 ], [ 4.0, 1.0097191566162214 ], [ 5.0, 0.8231406168067023 ], [ 6.0, 0.6511956879626355 ], [ 7.0, 0.4268136531590308 ], [ 8.0, 0.48778703218174946 ], [ 9.0, 0.46095874541175325 ], [ ">10", 6.20099264661049 ], [ ">50", 2.4194236796214774 ], [ ">100", 15.127495335536507 ], [ ">500", 12.873919246856822 ], [ ">1k", 48.57383266465861 ], [ ">5k", 0.0 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPMS2_R2", "pairs": [ [ 1.0, 7.427122940430925 ], [ 2.0, 2.018665744901486 ], [ 3.0, 1.1787072243346008 ], [ 4.0, 1.1337711717939856 ], [ 5.0, 0.8123055651572761 ], [ 6.0, 0.8641548565502939 ], [ 7.0, 0.8226754234358797 ], [ 8.0, 0.5991473672082037 ], [ 9.0, 0.46664362253715863 ], [ ">10", 5.848600069132388 ], [ ">50", 2.5025924645696507 ], [ ">100", 23.359834082267543 ], [ ">500", 3.2031340016130896 ], [ ">1k", 31.260513884088027 ], [ ">5k", 18.50213158197949 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVFS1_R2", "pairs": [ [ 1.0, 7.172040022234574 ], [ 2.0, 1.8816008893829905 ], [ 3.0, 1.3882712618121178 ], [ 4.0, 1.1006114508060034 ], [ 5.0, 0.9171762090050029 ], [ 6.0, 0.7504168982768205 ], [ 7.0, 0.9241245136186771 ], [ 8.0, 0.5892162312395776 ], [ 9.0, 0.500277932184547 ], [ ">10", 8.736798221234018 ], [ ">50", 4.962479155086159 ], [ ">100", 8.667315175097276 ], [ ">500", 8.005836575875486 ], [ ">1k", 47.34296831573096 ], [ ">5k", 7.060867148415786 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVFS2_R2", "pairs": [ [ 1.0, 6.237436443183162 ], [ 2.0, 1.5529541602617163 ], [ 3.0, 1.0109968073785032 ], [ 4.0, 0.8080091442986086 ], [ 5.0, 0.7883016041937646 ], [ 6.0, 0.7922431122147333 ], [ 7.0, 0.7518426549998029 ], [ 8.0, 0.622758267313074 ], [ 9.0, 0.6207875133025895 ], [ ">10", 8.658507745063261 ], [ ">50", 3.1610894328169956 ], [ ">100", 13.292735800717354 ], [ ">500", 0.0 ], [ ">1k", 0.0 ], [ ">5k", 61.70233731425644 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVMS1_R2", "pairs": [ [ 1.0, 7.10965338028084 ], [ 2.0, 2.4780084288461888 ], [ 3.0, 1.6170361572178777 ], [ 4.0, 1.2371954491465642 ], [ 5.0, 0.9224702910303331 ], [ 6.0, 0.7452112939303867 ], [ 7.0, 0.6541701083450401 ], [ 8.0, 0.4341036663672155 ], [ 9.0, 0.39611959556008414 ], [ ">10", 5.0838362705671685 ], [ ">50", 2.593769406544113 ], [ ">100", 14.67692437552379 ], [ ">500", 6.33489892016713 ], [ ">1k", 49.54931598526459 ], [ ">5k", 6.167286671208677 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVMS2_R2", "pairs": [ [ 1.0, 6.499481556448258 ], [ 2.0, 1.8875070626292227 ], [ 3.0, 1.154856294898143 ], [ 4.0, 0.9437535313146114 ], [ 5.0, 0.773008649004402 ], [ 6.0, 0.7115404913727268 ], [ 7.0, 0.5954339714017844 ], [ 8.0, 0.5314822518455969 ], [ 9.0, 0.458217175072489 ], [ ">10", 6.579576428513774 ], [ ">50", 2.8138756604722492 ], [ ">100", 12.333989407608392 ], [ ">500", 7.176252180877815 ], [ ">1k", 17.04592726888904 ], [ ">5k", 40.49509806965149 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAFS1_R2", "pairs": [ [ 1.0, 2.5242883719799125 ], [ 2.0, 0.6310720929949781 ], [ 3.0, 0.45962476137206504 ], [ 4.0, 0.4766479006821416 ], [ 5.0, 0.5289332571345192 ], [ 6.0, 0.4523291302391751 ], [ 7.0, 0.4723921158546224 ], [ 8.0, 0.4085553434418356 ], [ 9.0, 0.3118882309310441 ], [ ">10", 5.434637224741917 ], [ ">50", 0.7423304677715494 ], [ ">100", 2.30177162242677 ], [ ">500", 0.0 ], [ ">1k", 0.0 ], [ ">5k", 85.25552948042947 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAFS2_R2", "pairs": [ [ 1.0, 2.608287357671088 ], [ 2.0, 0.6839613413154908 ], [ 3.0, 0.4202371170325156 ], [ 4.0, 0.3912822318738506 ], [ 5.0, 0.35606683100520403 ], [ 6.0, 0.2770278201666862 ], [ 7.0, 0.36702273349767184 ], [ 8.0, 0.33806784833900694 ], [ 9.0, 0.2605939664279845 ], [ ">10", 5.823844739210393 ], [ ">50", 1.4328755331220409 ], [ ">100", 1.9157178072543726 ], [ ">500", 5.231443440153383 ], [ ">1k", 0.0 ], [ ">5k", 7.579136831396487 ], [ ">10k+", 72.31443440153382 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAMS1_R2", "pairs": [ [ 1.0, 2.822118236340869 ], [ 2.0, 0.7394714295129506 ], [ 3.0, 0.5377974032821459 ], [ 4.0, 0.43234693205035263 ], [ 5.0, 0.4185065577011798 ], [ 6.0, 0.5022078692414157 ], [ 7.0, 0.3921439398932314 ], [ 8.0, 0.42180188492717324 ], [ 9.0, 0.3558953404073024 ], [ ">10", 6.338232386475977 ], [ ">50", 0.7961510578000396 ], [ ">100", 1.9040400711790681 ], [ ">500", 0.0 ], [ ">1k", 23.369801621300994 ], [ ">5k", 31.015619851051206 ], [ ">10k+", 29.953865418836088 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAMS2_R2", "pairs": [ [ 1.0, 3.688197635703124 ], [ 2.0, 1.2579694474296677 ], [ 3.0, 0.834690419520943 ], [ 4.0, 0.6830484001766959 ], [ 5.0, 0.5439333302565387 ], [ 6.0, 0.5696465422323024 ], [ 7.0, 0.512286300132522 ], [ 8.0, 0.4219604016535573 ], [ 9.0, 0.39756581593296103 ], [ ">10", 4.6435423575718815 ], [ ">50", 0.8030433893969263 ], [ ">100", 6.352481984268789 ], [ ">500", 8.066036802858783 ], [ ">1k", 32.31359569600391 ], [ ">5k", 38.912001476861406 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICFS1_R2", "pairs": [ [ 1.0, 6.4327527178380235 ], [ 2.0, 1.9169603099157309 ], [ 3.0, 1.387330336147067 ], [ 4.0, 0.9806374143193075 ], [ 5.0, 0.9577654046558834 ], [ 6.0, 0.9005853804973233 ], [ 7.0, 0.7504878170811027 ], [ 8.0, 0.6461342729917304 ], [ 9.0, 0.5210529701448798 ], [ ">10", 5.964591270039811 ], [ ">50", 2.538793072640073 ], [ ">100", 7.401239377023637 ], [ ">500", 11.49961760858844 ], [ ">1k", 15.11839838752332 ], [ ">5k", 42.983653660593674 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICFS2_R2", "pairs": [ [ 1.0, 7.260901768354781 ], [ 2.0, 2.617813165447644 ], [ 3.0, 1.7012313674659754 ], [ 4.0, 1.3031200814739377 ], [ 5.0, 0.9894917137302102 ], [ 6.0, 0.7499305619850014 ], [ 7.0, 0.6035320803629294 ], [ 8.0, 0.4444032959911119 ], [ 9.0, 0.40621238774187574 ], [ ">10", 4.438825108786223 ], [ ">50", 1.1173733913526525 ], [ ">100", 15.831867419683363 ], [ ">500", 8.356286454957875 ], [ ">1k", 54.179011202666416 ], [ ">5k", 0.0 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICMS1_R2", "pairs": [ [ 1.0, 4.292964280033047 ], [ 2.0, 0.9996048789749431 ], [ 3.0, 0.8990286180513862 ], [ 4.0, 0.8702925435017985 ], [ 5.0, 0.9159623762681075 ], [ 6.0, 0.8035837990116843 ], [ 7.0, 0.8369381712567413 ], [ 8.0, 0.6978760962042725 ], [ 9.0, 0.5403408303699256 ], [ ">10", 6.575942774160111 ], [ ">50", 0.7748477244620966 ], [ ">100", 0.6706794542198412 ], [ ">500", 2.961355111172688 ], [ ">1k", 31.790821903046535 ], [ ">5k", 46.369761439266824 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICMS2_R2", "pairs": [ [ 1.0, 5.320494966776748 ], [ 2.0, 1.3655353519277444 ], [ 3.0, 1.1196434965980981 ], [ 4.0, 1.0854255361476943 ], [ 5.0, 1.0464329765646758 ], [ 6.0, 0.8451040464727648 ], [ 7.0, 0.7519993633867823 ], [ 8.0, 0.6811761429196673 ], [ 9.0, 0.6015994907094259 ], [ ">10", 6.353399912465682 ], [ ">50", 1.2199100783830024 ], [ ">100", 2.928420801336888 ], [ ">500", 4.077507659252775 ], [ ">1k", 23.90084749134604 ], [ ">5k", 48.70250268571201 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPFS1_R2", "pairs": [ [ 1.0, 4.469377865583181 ], [ 2.0, 0.9368670866415676 ], [ 3.0, 0.6020054422783018 ], [ 4.0, 0.43737031100508195 ], [ 5.0, 0.4131409897988345 ], [ 6.0, 0.4025794908114959 ], [ 7.0, 0.38704787465364493 ], [ 8.0, 0.4324001938345696 ], [ 9.0, 0.35784843627688523 ], [ ">10", 8.677203315068152 ], [ ">50", 2.2284762863284504 ], [ ">100", 1.0698177209527715 ], [ ">500", 8.977895403884146 ], [ ">1k", 0.0 ], [ ">5k", 0.0 ], [ ">10k+", 70.60796958288292 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPFS2_R2", "pairs": [ [ 1.0, 5.872707505302369 ], [ 2.0, 2.185110592261215 ], [ 3.0, 1.4677312991248863 ], [ 4.0, 1.0782968257080223 ], [ 5.0, 0.8332293653198353 ], [ 6.0, 0.6148965369739962 ], [ 7.0, 0.5084035860053113 ], [ 8.0, 0.3635909957759281 ], [ 9.0, 0.2887340260573547 ], [ ">10", 3.4376281034452028 ], [ ">50", 1.3443064145293813 ], [ ">100", 9.969789865792148 ], [ ">500", 21.020104443295846 ], [ ">1k", 51.01547044040851 ], [ ">5k", 0.0 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPMS1_R2", "pairs": [ [ 1.0, 4.541891895800254 ], [ 2.0, 1.0857273418768565 ], [ 3.0, 0.6143007123458826 ], [ 4.0, 0.3667294271443404 ], [ 5.0, 0.2877726971676804 ], [ 6.0, 0.22559065707617154 ], [ 7.0, 0.2125758114756232 ], [ 8.0, 0.19898252829282825 ], [ 9.0, 0.18220783840767701 ], [ ">10", 6.464039981605685 ], [ ">50", 3.6189947333258137 ], [ ">100", 5.789581760706156 ], [ ">500", 5.383518577969048 ], [ ">1k", 8.51113058517638 ], [ ">5k", 0.0 ], [ ">10k+", 62.516955451629606 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPMS2_R2", "pairs": [ [ 1.0, 5.156315933942128 ], [ 2.0, 1.496175575302451 ], [ 3.0, 1.1786684365129112 ], [ 4.0, 0.9521117297379235 ], [ 5.0, 0.8746809565363454 ], [ 6.0, 0.6784410604328749 ], [ 7.0, 0.6051071535382586 ], [ 8.0, 0.5047339290176944 ], [ 9.0, 0.45721027985693746 ], [ ">10", 5.390656686700343 ], [ ">50", 1.017251904018616 ], [ ">100", 4.706480013437721 ], [ ">500", 7.962259667580268 ], [ ">1k", 34.5701772714051 ], [ ">5k", 34.44972940198043 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVFS1_R2", "pairs": [ [ 1.0, 3.7782330099631785 ], [ 2.0, 0.7110940277711045 ], [ 3.0, 0.520216822527878 ], [ 4.0, 0.44028426289513106 ], [ 5.0, 0.41931834561441056 ], [ 6.0, 0.40621464731396023 ], [ 7.0, 0.2996379011369642 ], [ 8.0, 0.40534106742726356 ], [ 9.0, 0.3813176205431046 ], [ ">10", 7.607133653354765 ], [ ">50", 2.1385235626334937 ], [ ">100", 3.009919499613441 ], [ ">500", 0.0 ], [ ">1k", 11.828271665873165 ], [ ">5k", 7.008294641024185 ], [ ">10k+", 61.04619927230795 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVFS2_R2", "pairs": [ [ 1.0, 3.78276565688275 ], [ 2.0, 0.6356929838329932 ], [ 3.0, 0.4755925286454246 ], [ 4.0, 0.40495997488620317 ], [ 5.0, 0.41987129179092764 ], [ 6.0, 0.36258044263067024 ], [ 7.0, 0.516402448595197 ], [ 8.0, 0.5085543870663946 ], [ 9.0, 0.430858577931251 ], [ ">10", 9.361167791555486 ], [ ">50", 1.7297127609480458 ], [ ">100", 0.8742740543085858 ], [ ">500", 0.0 ], [ ">1k", 0.0 ], [ ">5k", 7.724846962800188 ], [ ">10k+", 72.77272013812588 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVMS1_R2", "pairs": [ [ 1.0, 5.805827605864757 ], [ 2.0, 1.7870983032174177 ], [ 3.0, 1.604545250738219 ], [ 4.0, 1.3195062740601722 ], [ 5.0, 1.1497639621058295 ], [ 6.0, 1.0222970938835119 ], [ 7.0, 0.9371056693932192 ], [ 8.0, 0.7788930239112472 ], [ 9.0, 0.7206041545231522 ], [ ">10", 6.052434360968236 ], [ ">50", 1.3047739224565875 ], [ ">100", 3.9899051364664135 ], [ ">500", 0.0 ], [ ">1k", 59.530230144953535 ], [ ">5k", 13.997015097457707 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVMS2_R2", "pairs": [ [ 1.0, 5.006515578155043 ], [ 2.0, 1.1481997867628968 ], [ 3.0, 0.790070805653517 ], [ 4.0, 0.7326608163153723 ], [ 5.0, 0.5422054548602567 ], [ 6.0, 0.546761803220427 ], [ 7.0, 0.6506465458323081 ], [ 8.0, 0.6998551081221466 ], [ 9.0, 0.48388419585007786 ], [ ">10", 7.223634690213874 ], [ ">50", 1.6102135104841577 ], [ ">100", 2.5205719128461688 ], [ ">500", 10.540656296417799 ], [ ">1k", 0.0 ], [ ">5k", 67.50412349526596 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAFS1_R2", "pairs": [ [ 1.0, 3.5393215985495203 ], [ 2.0, 1.05008687769132 ], [ 3.0, 0.745637228979376 ], [ 4.0, 0.6557377049180327 ], [ 5.0, 0.5892573846037622 ], [ 6.0, 0.6617813704011483 ], [ 7.0, 0.4494976203067161 ], [ 8.0, 0.59227921734532 ], [ 9.0, 0.4963360278008613 ], [ ">10", 5.6062551937750245 ], [ ">50", 1.0092921356802902 ], [ ">100", 3.4887059001284277 ], [ ">500", 5.458185389438695 ], [ ">1k", 20.30822693963889 ], [ ">5k", 55.34939941074262 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAFS2_R2", "pairs": [ [ 1.0, 3.9869754839629707 ], [ 2.0, 1.361870016280645 ], [ 3.0, 0.8377996173454231 ], [ 4.0, 0.6845001128949839 ], [ 5.0, 0.564474919488051 ], [ 6.0, 0.5704167607458199 ], [ 7.0, 0.42424746580470357 ], [ 8.0, 0.37077089448478295 ], [ 9.0, 0.38503131350342845 ], [ ">10", 5.188415786283854 ], [ ">50", 1.042198956612675 ], [ ">100", 8.420777430510167 ], [ ">500", 12.83794222153561 ], [ ">1k", 5.865785689669515 ], [ ">5k", 57.45879333087737 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAMS1_R2", "pairs": [ [ 1.0, 2.409402666372986 ], [ 2.0, 0.4429678848283499 ], [ 3.0, 0.3432389273324645 ], [ 4.0, 0.173760882998966 ], [ 5.0, 0.20190525137203796 ], [ 6.0, 0.20190525137203796 ], [ 7.0, 0.19272773994603623 ], [ 8.0, 0.22026027422404143 ], [ 9.0, 0.1982342468016373 ], [ ">10", 6.586394033393905 ], [ ">50", 1.712523632091922 ], [ ">100", 1.689273936479384 ], [ ">500", 0.0 ], [ ">1k", 0.0 ], [ ">5k", 0.0 ], [ ">10k+", 85.62740527278623 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAMS2_R2", "pairs": [ [ 1.0, 3.2914819452434942 ], [ 2.0, 0.8013807573860366 ], [ 3.0, 0.53199769873769 ], [ 4.0, 0.3411282953737859 ], [ 5.0, 0.32488409083217706 ], [ 6.0, 0.29645673288436153 ], [ 7.0, 0.3079630444346678 ], [ 8.0, 0.2869809469017564 ], [ 9.0, 0.2802125283427527 ], [ ">10", 6.82662695861112 ], [ ">50", 1.8295035364986973 ], [ ">100", 1.3428542421063319 ], [ ">500", 0.0 ], [ ">1k", 0.0 ], [ ">5k", 0.0 ], [ ">10k+", 83.53852922264713 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCFS1_R2", "pairs": [ [ 1.0, 3.51564990119207 ], [ 2.0, 0.49191474894286136 ], [ 3.0, 0.29323643781475106 ], [ 4.0, 0.18486644992669088 ], [ 5.0, 0.2576443339495548 ], [ 6.0, 0.2804870274749793 ], [ 7.0, 0.226833258961773 ], [ 8.0, 0.2549882067954357 ], [ 9.0, 0.27251864601262193 ], [ ">10", 9.087673445103164 ], [ ">50", 3.0449841694821616 ], [ ">100", 1.0114532202885618 ], [ ">500", 0.0 ], [ ">1k", 0.0 ], [ ">5k", 0.0 ], [ ">10k+", 81.07775015405537 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCFS2_R2", "pairs": [ [ 1.0, 3.644450868571128 ], [ 2.0, 0.4967017949593966 ], [ 3.0, 0.37843946282620694 ], [ 4.0, 0.28908570077001916 ], [ 5.0, 0.31208115424036165 ], [ 6.0, 0.30748206354629315 ], [ 7.0, 0.3357336206669996 ], [ 8.0, 0.3942077737772989 ], [ 9.0, 0.4493968621061207 ], [ ">10", 9.565451630706159 ], [ ">50", 2.0695908123308193 ], [ ">100", 0.9290163202018343 ], [ ">500", 0.0 ], [ ">1k", 0.0 ], [ ">5k", 0.0 ], [ ">10k+", 80.82836193529737 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCMS1_R2", "pairs": [ [ 1.0, 4.735201720088979 ], [ 2.0, 0.8303023167913154 ], [ 3.0, 0.48702807537162224 ], [ 4.0, 0.4213474443418615 ], [ 5.0, 0.3965623005570461 ], [ 6.0, 0.3680593852045084 ], [ 7.0, 0.3166302118510165 ], [ 8.0, 0.4659607031545292 ], [ 9.0, 0.4294026160719265 ], [ ">10", 9.25043528908772 ], [ ">50", 2.5274650374565484 ], [ ">100", 5.386431373035003 ], [ ">500", 3.411055413385217 ], [ ">1k", 0.0 ], [ ">5k", 0.0 ], [ ">10k+", 70.9741181136027 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCMS2_R2", "pairs": [ [ 1.0, 5.2608040674136145 ], [ 2.0, 1.2412516084486709 ], [ 3.0, 0.6826099237359947 ], [ 4.0, 0.5900260490223771 ], [ 5.0, 0.6119951040391677 ], [ 6.0, 0.5790415215139818 ], [ 7.0, 0.5711954304365565 ], [ 8.0, 0.5398110661268556 ], [ 9.0, 0.6284718953017606 ], [ ">10", 8.007720553620185 ], [ ">50", 2.783008505162728 ], [ ">100", 8.858236826413082 ], [ ">500", 5.005806107397294 ], [ ">1k", 0.0 ], [ ">5k", 40.20572450805009 ], [ ">10k+", 24.434296833317642 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPFS1_R2", "pairs": [ [ 1.0, 3.056205938627618 ], [ 2.0, 0.4194792464783005 ], [ 3.0, 0.22857338532593108 ], [ 4.0, 0.21230786352371128 ], [ 5.0, 0.2011788222906135 ], [ 6.0, 0.17977681991927166 ], [ 7.0, 0.18576938058324738 ], [ 8.0, 0.20888354314429658 ], [ 9.0, 0.1964703817689183 ], [ ">10", 6.860625880157348 ], [ ">50", 3.0069813331735316 ], [ ">100", 1.9411616150807067 ], [ ">500", 0.0 ], [ ">1k", 0.0 ], [ ">5k", 0.0 ], [ ">10k+", 83.30258578992651 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPFS2_R2", "pairs": [ [ 1.0, 3.1699145570247604 ], [ 2.0, 0.49164403386000044 ], [ 3.0, 0.2542473683167139 ], [ 4.0, 0.23987471006879052 ], [ 5.0, 0.24780445255040343 ], [ 6.0, 0.26168150189322603 ], [ 7.0, 0.246317625835101 ], [ 8.0, 0.25771663065241956 ], [ 9.0, 0.22302400729536306 ], [ ">10", 7.265130939872727 ], [ ">50", 2.615328192216958 ], [ ">100", 2.5727058263782885 ], [ ">500", 0.0 ], [ ">1k", 0.0 ], [ ">5k", 0.0 ], [ ">10k+", 82.15461015403524 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPMS1_R2", "pairs": [ [ 1.0, 4.363402317998324 ], [ 2.0, 0.9067547550200424 ], [ 3.0, 0.4642622206026417 ], [ 4.0, 0.36535212467404626 ], [ 5.0, 0.2579234558903565 ], [ 6.0, 0.3293848170636479 ], [ 7.0, 0.2882117149306919 ], [ 8.0, 0.2498781370827674 ], [ 9.0, 0.2938907635007548 ], [ ">10", 7.393647984174384 ], [ ">50", 2.4997278789226844 ], [ ">100", 10.033932315206126 ], [ ">500", 4.4003161337037335 ], [ ">1k", 0.0 ], [ ">5k", 0.0 ], [ ">10k+", 68.15331538122979 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPMS2_R2", "pairs": [ [ 1.0, 4.5733320416421375 ], [ 2.0, 0.8525161896103315 ], [ 3.0, 0.567847322100588 ], [ 4.0, 0.3904881847515854 ], [ 5.0, 0.49183626323672974 ], [ 6.0, 0.362170339292501 ], [ 7.0, 0.5164280763985662 ], [ 8.0, 0.4173156172917707 ], [ 9.0, 0.5834966577490294 ], [ ">10", 8.977502216989217 ], [ ">50", 3.0449135933110267 ], [ ">100", 6.252282194782064 ], [ ">500", 0.0 ], [ ">1k", 0.0 ], [ ">5k", 14.261761220946262 ], [ ">10k+", 58.70811008189819 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVFS1_R2", "pairs": [ [ 1.0, 4.218771346600483 ], [ 2.0, 0.7796347738968077 ], [ 3.0, 0.532811148048636 ], [ 4.0, 0.5282572066123229 ], [ 5.0, 0.5282572066123229 ], [ 6.0, 0.5737966209754543 ], [ 7.0, 0.4972904048453937 ], [ 8.0, 0.5100414408670704 ], [ 9.0, 0.532811148048636 ], [ ">10", 9.98952593469648 ], [ ">50", 1.311535133658181 ], [ ">100", 0.3105788059565554 ], [ ">500", 0.0 ], [ ">1k", 0.0 ], [ ">5k", 49.571474110842935 ], [ ">10k+", 30.115214718338724 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVFS2_R2", "pairs": [ [ 1.0, 6.127086734863883 ], [ 2.0, 1.2888607510579453 ], [ 3.0, 0.9596481290193595 ], [ 4.0, 0.7330645430008996 ], [ 5.0, 0.5764552997234347 ], [ 6.0, 0.5158108693479058 ], [ 7.0, 0.5551297857452268 ], [ 8.0, 0.4478357935423678 ], [ 9.0, 0.5457998733797608 ], [ ">10", 8.258305288061045 ], [ ">50", 1.8020059311585752 ], [ ">100", 2.635700243244144 ], [ ">500", 7.232014927859785 ], [ ">1k", 11.463796607910433 ], [ ">5k", 35.43967212022259 ], [ ">10k+", 21.41881310186265 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVMS1_R2", "pairs": [ [ 1.0, 4.122529951541989 ], [ 2.0, 0.85571721022369 ], [ 3.0, 0.42066044553728504 ], [ 4.0, 0.2407064561732856 ], [ 5.0, 0.26345264042889516 ], [ 6.0, 0.18139362127891143 ], [ 7.0, 0.13906844298049875 ], [ 8.0, 0.15893536340628428 ], [ 9.0, 0.13734088468260436 ], [ ">10", 6.847177313704432 ], [ ">50", 4.594729219633124 ], [ ">100", 6.211435860079295 ], [ ">500", 3.6992781685578633 ], [ ">1k", 0.938640008522621 ], [ ">5k", 0.0 ], [ ">10k+", 71.18893441324921 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVMS2_R2", "pairs": [ [ 1.0, 7.072721693771096 ], [ 2.0, 1.4677303876444716 ], [ 3.0, 0.7747775391224302 ], [ 4.0, 0.7671064743786438 ], [ 5.0, 0.5966383689611674 ], [ 6.0, 0.5727728342027206 ], [ 7.0, 0.5847056015819441 ], [ 8.0, 0.484129419385633 ], [ 9.0, 0.5369745320650506 ], [ ">10", 8.560908254065664 ], [ ">50", 3.3752684872660326 ], [ ">100", 12.830281954246361 ], [ ">500", 2.2075619651563194 ], [ ">1k", 0.0 ], [ ">5k", 60.16842248815246 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null } ] } ], "pconfig": { "id": "fastqc_sequence_duplication_levels_plot", "title": "FastQC: Sequence Duplication Levels", "anchor": null, "table_title": null, "height": null, "width": null, "square": false, "logswitch": false, "logswitch_active": false, "logswitch_label": "Log10", "cpswitch": true, "cpswitch_c_active": true, "cpswitch_counts_label": "Counts", "cpswitch_percent_label": "Percentages", "xLog": null, "yLog": null, "xlog": false, "ylog": false, "data_labels": [], "xTitle": null, "yTitle": null, "xlab": "Sequence Duplication Level", "ylab": "% of Library", "xsuffix": null, "ysuffix": null, "tt_suffix": "%", "xLabFormat": null, "yLabFormat": null, "xLabelFormat": null, "yLabelFormat": null, "xlab_format": null, "ylab_format": null, "tt_label": null, "xDecimals": null, "yDecimals": null, "decimalPlaces": null, "x_decimals": null, "y_decimals": null, "tt_decimals": 2, "xmin": null, "xmax": null, "ymin": 0, "ymax": 100, "xFloor": null, "xCeiling": null, "yFloor": null, "yCeiling": null, "x_clipmin": null, "x_clipmax": null, "y_clipmin": null, "y_clipmax": null, "save_data_file": true, "showlegend": false, "xMinRange": null, "yMinRange": null, "x_minrange": null, "y_minrange": null, "xPlotBands": null, "yPlotBands": null, "xPlotLines": null, "yPlotLines": null, "x_bands": null, "y_bands": null, "x_lines": null, "y_lines": null, "categories": true, "smooth_points": 500, "smooth_points_sumcounts": null, "extra_series": null, "style": null, "hide_zero_cats": false, "hide_empty": false, "colors": { "CAFS1_R2": "#d9534f", "CAFS2_R2": "#d9534f", "CAMS1_R2": "#d9534f", "CAMS2_R2": "#d9534f", "CCFS1_R2": "#d9534f", "CCFS2_R2": "#d9534f", "CCMS1_R2": "#d9534f", "CCMS2_R2": "#d9534f", "CPFS1_R2": "#d9534f", "CPFS2_R2": "#d9534f", "CPMS1_R2": "#d9534f", "CPMS2_R2": "#d9534f", "CVFS1_R2": "#d9534f", "CVFS2_R2": "#d9534f", "CVMS1_R2": "#d9534f", "CVMS2_R2": "#d9534f", "DAFS1_R2": "#d9534f", "DAFS2_R2": "#d9534f", "DAMS1_R2": "#d9534f", "DAMS2_R2": "#d9534f", "DCFS1_R2": "#d9534f", "DCFS2_R2": "#d9534f", "DCMS1_R2": "#d9534f", "DCMS2_R2": "#d9534f", "DPFS1_R2": "#d9534f", "DPFS2_R2": "#d9534f", "DPMS1_R2": "#d9534f", "DPMS2_R2": "#d9534f", "DVFS1_R2": "#d9534f", "DVFS2_R2": "#d9534f", "DVMS1_R2": "#d9534f", "DVMS2_R2": "#d9534f", "IAFS1_R2": "#d9534f", "IAFS2_R2": "#d9534f", "IAMS1_R2": "#d9534f", "IAMS2_R2": "#d9534f", "ICFS1_R2": "#d9534f", "ICFS2_R2": "#d9534f", "ICMS1_R2": "#d9534f", "ICMS2_R2": "#d9534f", "IPFS1_R2": "#d9534f", "IPFS2_R2": "#d9534f", "IPMS1_R2": "#d9534f", "IPMS2_R2": "#d9534f", "IVFS1_R2": "#d9534f", "IVFS2_R2": "#d9534f", "IVMS1_R2": "#d9534f", "IVMS2_R2": "#d9534f", "JAFS1_R2": "#d9534f", "JAFS2_R2": "#d9534f", "JAMS1_R2": "#d9534f", "JAMS2_R2": "#d9534f", "JCFS1_R2": "#d9534f", "JCFS2_R2": "#d9534f", "JCMS1_R2": "#d9534f", "JCMS2_R2": "#d9534f", "JPFS1_R2": "#d9534f", "JPFS2_R2": "#d9534f", "JPMS1_R2": "#d9534f", "JPMS2_R2": "#d9534f", "JVFS1_R2": "#d9534f", "JVFS2_R2": "#d9534f", "JVMS1_R2": "#d9534f", "JVMS2_R2": "#d9534f" } }, "add_log_tab": false, "add_pct_tab": false, "l_active": false, "p_active": false, "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "yaxis" ], "square": false, "flat": false, "defer_render": false }, "fastqc_overrepresented_sequences_plot": { "id": "fastqc_overrepresented_sequences_plot", "anchor": "fastqc_overrepresented_sequences_plot", "plot_type": "bar_graph", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 800, "hoverlabel": { "namelength": -1, "bgcolor": "rgba(255, 255, 255, 0.8)", "font": { "color": "black" } }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "white", "plot_bgcolor": "white", "showlegend": true, "title": { "font": { "size": 20 }, "text": "FastQC: Overrepresented sequences sample summary", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)", "showgrid": false, "categoryorder": "trace", "type": "category" }, "barmode": "relative", "bargroupgap": 0, "bargap": 0.2, "legend": { "tracegroupgap": 0, "traceorder": "normal" }, "hovermode": "y unified" }, "datasets": [ { "plot_id": "fastqc_overrepresented_sequences_plot", "label": "1", "uid": "fastqc_overrepresented_sequences_plot", "dconfig": { "title": "FastQC: Overrepresented sequences sample summary
64 samples" }, "layout": { "title": { "text": "FastQC: Overrepresented sequences sample summary
64 samples" }, "xaxis": { "title": { "text": "Percentage of Total Sequences" }, "hoverformat": ",.2f", "ticksuffix": "%", "autorangeoptions": { "minallowed": 0, "maxallowed": 87.12585625316417 } }, "yaxis": { "title": null, "hoverformat": null, "ticksuffix": "" }, "showlegend": true }, "trace_params": { "hovertemplate": "%{meta}: %{x}", "orientation": "h", "marker": { "line": { "width": 0 } }, "textposition": "inside", "insidetextanchor": "start" }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "n_samples": 64, "cats": [ { "name": "Top overrepresented sequence", "color": "124,181,236", "data": [ 7.7946541202141075, 9.105959788201352, 7.280663756622571, 10.134341272371238, 9.340417762741167, 8.642565415540716, 10.543088238209464, 10.657769140880822, 8.254087813451338, 9.092429997459522, 10.146251084071379, 10.308960710567137, 10.80713391316119, 11.033204236339273, 8.143887627898133, 7.059756742464304, 8.660706963011563, 3.647858364452757, 10.399466331816042, 7.837758743442691, 2.5449733498846734, 8.025532234880364, 2.175307893845688, 9.13383283010897, 6.18788047586838, 4.538247202081313, 2.0472641422090545, 5.53931484036052, 5.094512536839121, 7.827720292625058, 10.201510349415033, 5.778747826509892, 5.206787574739692, 3.1050470580432776, 7.8317764376650505, 7.060867148415786, 6.2714598456043325, 5.741253368779191, 8.368216672848524, 8.562391693317743, 8.534941242661967, 8.90189052420773, 9.021533281896613, 9.341187589623257, 10.255014291193902, 9.200641247288845, 4.584221748400854, 6.151091537939701, 1.8961704363819492, 2.1700006544359853, 1.9304627112577273, 1.901076562656676, 1.8903490138052612, 2.3943986120454626, 2.0324568061074153, 6.693965344484376, 2.0769539363101313, 2.0515262631553886, 1.9591229513445878, 1.760604004854929, 2.752968183937731, 3.1814285131108058, 2.285993502548797, 2.6204549197577176 ], "data_pct": [] }, { "name": "Sum of remaining overrepresented sequences", "color": "67,67,72", "data": [ 66.28822747263989, 67.7162543080985, 69.58648495551627, 69.66983924586731, 68.80044116222402, 70.74296152917846, 73.34813551929899, 73.59378143419096, 69.13661613784015, 68.77629548848421, 70.92651967096792, 70.9934978007267, 73.47186029984094, 75.61902314568381, 76.43941104469451, 76.67145123517417, 71.71418938006325, 72.80856269896682, 70.42771935331973, 73.50170129682932, 76.23121074689972, 70.29433796372622, 77.3281408736878, 70.59368049601767, 72.81104523932677, 76.68580694489343, 75.01215165262475, 70.24708917939516, 78.3468382638966, 77.67020365122252, 76.83922213092302, 81.08911613428826, 69.31186707976579, 70.81014596735778, 67.16329667730875, 66.6495275152863, 70.90563428966473, 71.8461519700499, 70.21353902518415, 71.14639541272771, 66.50141718240785, 68.35802862474605, 66.87942764957563, 68.7418524312345, 72.46563308132988, 70.10027347310847, 72.88113006396597, 73.19142784061212, 75.9006809572814, 76.47302633014112, 77.59579757954519, 77.14059124347101, 73.88329744063053, 76.88719328683213, 74.70646010982627, 72.48199756850275, 76.5187408276331, 77.07367017477013, 75.72746663776677, 76.30268544028945, 81.6636177768213, 80.64472233939779, 83.99870579224012, 84.50540133340645 ], "data_pct": [] } ], "samples": [ "JVMS2_R2", "JVMS1_R2", "JVFS2_R2", "JVFS1_R2", "JPMS2_R2", "JPMS1_R2", "JPFS2_R2", "JPFS1_R2", "JCMS2_R2", "JCMS1_R2", "JCFS2_R2", "JCFS1_R2", "JAMS2_R2", "JAMS1_R2", "JAFS2_R2", "JAFS1_R2", "IVMS2_R2", "IVMS1_R2", "IVFS2_R2", "IVFS1_R2", "IPMS2_R2", "IPMS1_R2", "IPFS2_R2", "IPFS1_R2", "ICMS2_R2", "ICMS1_R2", "ICFS2_R2", "ICFS1_R2", "IAMS2_R2", "IAMS1_R2", "IAFS2_R2", "IAFS1_R2", "DVMS2_R2", "DVMS1_R2", "DVFS2_R2", "DVFS1_R2", "DPMS2_R2", "DPMS1_R2", "DPFS2_R2", "DPFS1_R2", "DCMS2_R2", "DCMS1_R2", "DCFS2_R2", "DCFS1_R2", "DAMS2_R2", "DAMS1_R2", "DAFS2_R2", "DAFS1_R2", "CVMS2_R2", "CVMS1_R2", "CVFS2_R2", "CVFS1_R2", "CPMS2_R2", "CPMS1_R2", "CPFS2_R2", "CPFS1_R2", "CCMS2_R2", "CCMS1_R2", "CCFS2_R2", "CCFS1_R2", "CAMS2_R2", "CAMS1_R2", "CAFS2_R2", "CAFS1_R2" ] } ], "pconfig": { "id": "fastqc_overrepresented_sequences_plot", "title": "FastQC: Overrepresented sequences sample summary", "anchor": null, "table_title": null, "height": null, "width": null, "square": false, "logswitch": false, "logswitch_active": false, "logswitch_label": "Log10", "cpswitch": false, "cpswitch_c_active": true, "cpswitch_counts_label": "Counts", "cpswitch_percent_label": "Percentages", "xLog": null, "yLog": null, "xlog": false, "ylog": false, "data_labels": [], "xTitle": null, "yTitle": null, "xlab": null, "ylab": "Percentage of Total Sequences", "xsuffix": null, "ysuffix": null, "tt_suffix": "%", "xLabFormat": null, "yLabFormat": null, "xLabelFormat": null, "yLabelFormat": null, "xlab_format": null, "ylab_format": null, "tt_label": null, "xDecimals": null, "yDecimals": null, "decimalPlaces": null, "x_decimals": null, "y_decimals": null, "tt_decimals": 2, "xmin": null, "xmax": null, "ymin": 0, "ymax": null, "xFloor": null, "xCeiling": null, "yFloor": null, "yCeiling": null, "x_clipmin": null, "x_clipmax": null, "y_clipmin": null, "y_clipmax": 100, "save_data_file": true, "showlegend": null, "xMinRange": null, "yMinRange": null, "x_minrange": null, "y_minrange": null, "xPlotBands": null, "yPlotBands": null, "xPlotLines": null, "yPlotLines": null, "x_bands": null, "y_bands": null, "x_lines": null, "y_lines": null, "stacking": "relative", "hide_zero_cats": true, "sort_samples": true, "use_legend": true, "suffix": null, "lab_format": null }, "add_log_tab": false, "add_pct_tab": false, "l_active": false, "p_active": false, "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "xaxis" ], "square": false, "flat": false, "defer_render": false }, "fastqc_top_overrepresented_sequences_table": { "id": "fastqc_top_overrepresented_sequences_table", "anchor": "fastqc_top_overrepresented_sequences_table", "plot_type": "violin", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 500, "hoverlabel": { "namelength": -1 }, "margin": { "b": 40, "l": 60, "pad": 0, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "white", "plot_bgcolor": "white", "showlegend": false, "title": { "font": { "size": 20 }, "text": "FastQC: Top overrepresented sequences", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": false, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.1)", "tickfont": { "color": "rgba(0,0,0,0.5)", "size": 9 }, "zerolinecolor": "rgba(0,0,0,0.1)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.1)", "tickfont": { "color": "rgba(0,0,0,0.5)", "size": 9 }, "zerolinecolor": "rgba(0,0,0,0.1)" }, "violingap": 0, "grid": { "columns": 1, "roworder": "top to bottom", "ygap": 0.4 } }, "datasets": [ { "plot_id": "fastqc_top_overrepresented_sequences_table", "label": "1", "uid": "fastqc_top_overrepresented_sequences_table", "dconfig": { "ylab": "", "title": "FastQC: Top overrepresented sequences
20 samples" }, "layout": { "title": { "text": "FastQC: Top overrepresented sequences
20 samples" }, "xaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": null }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "yaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "" }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } } }, "trace_params": { "hovertemplate": "%{text}: %{x}", "orientation": "h", "box": { "visible": true }, "meanline": { "visible": true }, "fillcolor": "#b5b5b5", "line": { "width": 2, "color": "#b5b5b5" }, "opacity": 0.5, "points": false, "hoveron": "points" }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "n_samples": 20, "metrics": [ "fastqc-samples", "fastqc-total_count", "fastqc-total_percent" ], "header_by_metric": { "fastqc-samples": { "title": "Reports", "description": "Number of FastQC reports where this sequence is founds as overrepresented", "suffix": "", "dmin": 0.0, "dmax": 55, "hidden": false, "xaxis": { "ticksuffix": null, "tickvals": null, "range": [ -0.275, 55.276375 ] }, "show_only_outliers": false, "show_points": true, "namespace": "", "color": null, "hoverformat": null }, "fastqc-total_count": { "title": "Occurrences", "description": "Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)", "suffix": "", "dmin": 0.0, "dmax": 415755, "hidden": false, "xaxis": { "ticksuffix": null, "tickvals": null, "range": [ -2078.775, 417844.168875 ] }, "show_only_outliers": false, "show_points": true, "namespace": "", "color": null, "hoverformat": null }, "fastqc-total_percent": { "title": "% of all reads", "description": "Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)", "suffix": "%", "dmin": 0.0, "dmax": 100.0, "hidden": false, "xaxis": { "ticksuffix": "%", "tickvals": null, "range": [ -0.5, 100.5025 ] }, "show_only_outliers": false, "show_points": true, "namespace": "", "color": null, "hoverformat": ".2f" } }, "violin_value_by_sample_by_metric": { "fastqc-samples": { "GACTACTCGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG": 55, "GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG": 54, "GACTACTAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG": 53, "GACTACTGGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG": 53, "GACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG": 52, "GACTACAGGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG": 52, "GACTACACGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG": 51, "GACTACCGGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG": 51, "GACTACAAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG": 50, "GACTACCCGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG": 50, "GACTACTGGGGTATCTAATCCTGTTCGCTACCCATGCTTTCGAGCCTCAG": 50, "GACTACTAGGGTATCTAATCCTGTTCGCTACCCATGCTTTCGAGCCTCAG": 49, "GACTACTCGGGTATCTAATCCTGTTCGCTACCCATGCTTTCGAGCCTCAG": 49, "GACTACCAGGGTATCTAATCCTGTTCGCTACCCATGCTTTCGAGCCTCAG": 48, "GACTACAGGGGTATCTAATCCTGTTCGCTACCCATGCTTTCGAGCCTCAG": 48, "GACTACCGGGGTATCTAATCCTGTTCGCTACCCATGCTTTCGAGCCTCAG": 48, "GACTACACGGGTATCTAATCCTGTTCGCTACCCATGCTTTCGAGCCTCAG": 48, "GACTACAAGGGTATCTAATCCTGTTCGCTACCCATGCTTTCGAGCCTCAG": 48, "GACTACTGGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGAGCCTCAA": 47, "GACTACTCGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGAGCCTCAA": 47 }, "fastqc-total_count": { "GACTACTCGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG": 157305, "GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG": 10055, "GACTACTAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG": 154456, "GACTACTGGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG": 158648, "GACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG": 133324, "GACTACAGGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG": 136151, "GACTACACGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG": 125419, "GACTACCGGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG": 128085, "GACTACAAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG": 133748, "GACTACCCGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG": 115477, "GACTACTGGGGTATCTAATCCTGTTCGCTACCCATGCTTTCGAGCCTCAG": 415755, "GACTACTAGGGTATCTAATCCTGTTCGCTACCCATGCTTTCGAGCCTCAG": 402198, "GACTACTCGGGTATCTAATCCTGTTCGCTACCCATGCTTTCGAGCCTCAG": 408547, "GACTACCAGGGTATCTAATCCTGTTCGCTACCCATGCTTTCGAGCCTCAG": 345168, "GACTACAGGGGTATCTAATCCTGTTCGCTACCCATGCTTTCGAGCCTCAG": 356621, "GACTACCGGGGTATCTAATCCTGTTCGCTACCCATGCTTTCGAGCCTCAG": 338694, "GACTACACGGGTATCTAATCCTGTTCGCTACCCATGCTTTCGAGCCTCAG": 326976, "GACTACAAGGGTATCTAATCCTGTTCGCTACCCATGCTTTCGAGCCTCAG": 348820, "GACTACTGGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGAGCCTCAA": 81422, "GACTACTCGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGAGCCTCAA": 80441 }, "fastqc-total_percent": { "GACTACTCGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG": 1.529092118504858, "GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG": 0.09774019421866023, "GACTACTAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG": 1.501398253429874, "GACTACTGGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG": 1.542146825698857, "GACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG": 1.2959834563907167, "GACTACAGGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG": 1.3234634692257392, "GACTACACGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG": 1.2191424583500892, "GACTACCGGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG": 1.2450574616108498, "GACTACAAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG": 1.300104972288152, "GACTACCCGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG": 1.122500687000321, "GACTACTGGGGTATCTAATCCTGTTCGCTACCCATGCTTTCGAGCCTCAG": 4.041369910231634, "GACTACTAGGGTATCTAATCCTGTTCGCTACCCATGCTTTCGAGCCTCAG": 3.9095883276336854, "GACTACTCGGGTATCTAATCCTGTTCGCTACCCATGCTTTCGAGCCTCAG": 3.971304139975234, "GACTACCAGGGTATCTAATCCTGTTCGCTACCCATGCTTTCGAGCCTCAG": 3.3552249983159137, "GACTACAGGGGTATCTAATCCTGTTCGCTACCCATGCTTTCGAGCCTCAG": 3.4665545303284757, "GACTACCGGGGTATCTAATCCTGTTCGCTACCCATGCTTTCGAGCCTCAG": 3.29229411642913, "GACTACACGGGTATCTAATCCTGTTCGCTACCCATGCTTTCGAGCCTCAG": 3.178388636980671, "GACTACAAGGGTATCTAATCCTGTTCGCTACCCATGCTTTCGAGCCTCAG": 3.390724470149484, "GACTACTGGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGAGCCTCAA": 0.7914671400966437, "GACTACTCGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGAGCCTCAA": 0.7819312743056436 } }, "scatter_value_by_sample_by_metric": { "fastqc-samples": {}, "fastqc-total_count": {}, "fastqc-total_percent": {} }, "all_samples": [ "GACTACAAGGGTATCTAATCCTGTTCGCTACCCATGCTTTCGAGCCTCAG", "GACTACAAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG", "GACTACACGGGTATCTAATCCTGTTCGCTACCCATGCTTTCGAGCCTCAG", "GACTACACGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG", "GACTACAGGGGTATCTAATCCTGTTCGCTACCCATGCTTTCGAGCCTCAG", "GACTACAGGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG", "GACTACCAGGGTATCTAATCCTGTTCGCTACCCATGCTTTCGAGCCTCAG", "GACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG", "GACTACCCGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG", "GACTACCGGGGTATCTAATCCTGTTCGCTACCCATGCTTTCGAGCCTCAG", "GACTACCGGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG", "GACTACTAGGGTATCTAATCCTGTTCGCTACCCATGCTTTCGAGCCTCAG", "GACTACTAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG", "GACTACTCGGGTATCTAATCCTGTTCGCTACCCATGCTTTCGAGCCTCAG", "GACTACTCGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGAGCCTCAA", "GACTACTCGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG", "GACTACTGGGGTATCTAATCCTGTTCGCTACCCATGCTTTCGAGCCTCAG", "GACTACTGGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGAGCCTCAA", "GACTACTGGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG", "GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG" ], "scatter_trace_params": { "mode": "markers", "marker": { "size": 4, "color": "#0b79e6" }, "showlegend": false, "hovertemplate": "%{text}: %{x}", "hoverlabel": { "bgcolor": "white" } } } ], "pconfig": { "id": "fastqc_top_overrepresented_sequences_table", "title": "FastQC: Top overrepresented sequences", "anchor": null, "table_title": null, "height": null, "width": null, "square": false, "logswitch": false, "logswitch_active": false, "logswitch_label": "Log10", "cpswitch": true, "cpswitch_c_active": true, "cpswitch_counts_label": "Counts", "cpswitch_percent_label": "Percentages", "xLog": null, "yLog": null, "xlog": false, "ylog": false, "data_labels": [], "xTitle": null, "yTitle": null, "xlab": null, "ylab": null, "xsuffix": null, "ysuffix": null, "tt_suffix": null, "xLabFormat": null, "yLabFormat": null, "xLabelFormat": null, "yLabelFormat": null, "xlab_format": null, "ylab_format": null, "tt_label": null, "xDecimals": null, "yDecimals": null, "decimalPlaces": null, "x_decimals": null, "y_decimals": null, "tt_decimals": null, "xmin": null, "xmax": null, "ymin": null, "ymax": null, "xFloor": null, "xCeiling": null, "yFloor": null, "yCeiling": null, "x_clipmin": null, "x_clipmax": null, "y_clipmin": null, "y_clipmax": null, "save_data_file": true, "showlegend": null, "xMinRange": null, "yMinRange": null, "x_minrange": null, "y_minrange": null, "xPlotBands": null, "yPlotBands": null, "xPlotLines": null, "yPlotLines": null, "x_bands": null, "y_bands": null, "x_lines": null, "y_lines": null, "namespace": "FastQC", "save_file": false, "raw_data_fn": null, "defaultsort": null, "sortRows": true, "sort_rows": false, "only_defined_headers": true, "col1_header": "Overrepresented sequence", "no_beeswarm": false, "no_violin": false, "scale": "GnBu", "min": null }, "add_log_tab": false, "add_pct_tab": false, "l_active": false, "p_active": false, "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [], "square": false, "flat": false, "defer_render": false, "violin_height": 70, "extra_height": 63, "no_violin": false, "show_table": true, "show_table_by_default": true, "n_samples": 20, "main_table_dt": { "id": "fastqc_top_overrepresented_sequences_table", "anchor": "fastqc_top_overrepresented_sequences_table_table", "pconfig": { "id": "fastqc_top_overrepresented_sequences_table", "title": "FastQC: Top overrepresented sequences", "anchor": null, "table_title": null, "height": null, "width": null, "square": false, "logswitch": false, "logswitch_active": false, "logswitch_label": "Log10", "cpswitch": true, "cpswitch_c_active": true, "cpswitch_counts_label": "Counts", "cpswitch_percent_label": "Percentages", "xLog": null, "yLog": null, "xlog": false, "ylog": false, "data_labels": [], "xTitle": null, "yTitle": null, "xlab": null, "ylab": null, "xsuffix": null, "ysuffix": null, "tt_suffix": null, "xLabFormat": null, "yLabFormat": null, "xLabelFormat": null, "yLabelFormat": null, "xlab_format": null, "ylab_format": null, "tt_label": null, "xDecimals": null, "yDecimals": null, "decimalPlaces": null, "x_decimals": null, "y_decimals": null, "tt_decimals": null, "xmin": null, "xmax": null, "ymin": null, "ymax": null, "xFloor": null, "xCeiling": null, "yFloor": null, "yCeiling": null, "x_clipmin": null, "x_clipmax": null, "y_clipmin": null, "y_clipmax": null, "save_data_file": true, "showlegend": null, "xMinRange": null, "yMinRange": null, "x_minrange": null, "y_minrange": null, "xPlotBands": null, "yPlotBands": null, "xPlotLines": null, "yPlotLines": null, "x_bands": null, "y_bands": null, "x_lines": null, "y_lines": null, "namespace": "FastQC", "save_file": false, "raw_data_fn": null, "defaultsort": null, "sortRows": true, "sort_rows": false, "only_defined_headers": true, "col1_header": "Overrepresented sequence", "no_beeswarm": false, "no_violin": false, "scale": "GnBu", "min": null }, "sections": [ { "column_by_key": { "samples": { "rid": "fastqc-samples", "title": "Reports", "description": "Number of FastQC reports where this sequence is founds as overrepresented", "scale": "Greens", "hidden": false, "placement": 1000.0, "namespace": "", "colour": null, "color": null, "max": null, "dmax": 55, "min": 0.0, "dmin": 0.0, "ceiling": null, "floor": null, "minRange": null, "minrange": null, "shared_key": null, "tt_decimals": null, "suffix": null, "cond_formatting_colours": [ { "blue": "#337ab7" }, { "lbue": "#5bc0de" }, { "pass": "#5cb85c" }, { "warn": "#f0ad4e" }, { "fail": "#d9534f" } ], "cond_formatting_rules": {}, "bgcols": {}, "bars_zero_centrepoint": false }, "total_count": { "rid": "fastqc-total_count", "title": "Occurrences", "description": "Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)", "scale": "Blues", "hidden": false, "placement": 1000.0, "namespace": "", "colour": null, "color": null, "max": null, "dmax": 415755, "min": 0.0, "dmin": 0.0, "ceiling": null, "floor": null, "minRange": null, "minrange": null, "shared_key": null, "tt_decimals": null, "suffix": null, "cond_formatting_colours": [ { "blue": "#337ab7" }, { "lbue": "#5bc0de" }, { "pass": "#5cb85c" }, { "warn": "#f0ad4e" }, { "fail": "#d9534f" } ], "cond_formatting_rules": {}, "bgcols": {}, "bars_zero_centrepoint": false }, "total_percent": { "rid": "fastqc-total_percent", "title": "% of all reads", "description": "Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)", "scale": "Blues", "hidden": false, "placement": 1000.0, "namespace": "", "colour": null, "color": null, "max": 100.0, "dmax": 100.0, "min": 0.0, "dmin": 0.0, "ceiling": null, "floor": null, "minRange": null, "minrange": null, "shared_key": null, "tt_decimals": null, "suffix": "%", "cond_formatting_colours": [ { "blue": "#337ab7" }, { "lbue": "#5bc0de" }, { "pass": "#5cb85c" }, { "warn": "#f0ad4e" }, { "fail": "#d9534f" } ], "cond_formatting_rules": {}, "bgcols": {}, "bars_zero_centrepoint": false } }, "rows_by_sgroup": { "GACTACTCGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG": [ { "sample": "GACTACTCGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG", "raw_data": { "total_percent": 1.529092118504858, "total_count": 157305, "samples": 55 }, "formatted_data": { "total_percent": "1.5291", "total_count": "157,305", "samples": "55" } } ], "GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG": [ { "sample": "GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG", "raw_data": { "total_percent": 0.09774019421866023, "total_count": 10055, "samples": 54 }, "formatted_data": { "total_percent": "0.0977", "total_count": "10,055", "samples": "54" } } ], "GACTACTAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG": [ { "sample": "GACTACTAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG", "raw_data": { "total_percent": 1.501398253429874, "total_count": 154456, "samples": 53 }, "formatted_data": { "total_percent": "1.5014", "total_count": "154,456", "samples": "53" } } ], "GACTACTGGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG": [ { "sample": "GACTACTGGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG", "raw_data": { "total_percent": 1.542146825698857, "total_count": 158648, "samples": 53 }, "formatted_data": { "total_percent": "1.5421", "total_count": "158,648", "samples": "53" } } ], "GACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG": [ { "sample": "GACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG", "raw_data": { "total_percent": 1.2959834563907167, "total_count": 133324, "samples": 52 }, "formatted_data": { "total_percent": "1.2960", "total_count": "133,324", "samples": "52" } } ], "GACTACAGGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG": [ { "sample": "GACTACAGGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG", "raw_data": { "total_percent": 1.3234634692257392, "total_count": 136151, "samples": 52 }, "formatted_data": { "total_percent": "1.3235", "total_count": "136,151", "samples": "52" } } ], "GACTACACGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG": [ { "sample": "GACTACACGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG", "raw_data": { "total_percent": 1.2191424583500892, "total_count": 125419, "samples": 51 }, "formatted_data": { "total_percent": "1.2191", "total_count": "125,419", "samples": "51" } } ], "GACTACCGGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG": [ { "sample": "GACTACCGGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG", "raw_data": { "total_percent": 1.2450574616108498, "total_count": 128085, "samples": 51 }, "formatted_data": { "total_percent": "1.2451", "total_count": "128,085", "samples": "51" } } ], "GACTACAAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG": [ { "sample": "GACTACAAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG", "raw_data": { "total_percent": 1.300104972288152, "total_count": 133748, "samples": 50 }, "formatted_data": { "total_percent": "1.3001", "total_count": "133,748", "samples": "50" } } ], "GACTACCCGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG": [ { "sample": "GACTACCCGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGTGCCTCAG", "raw_data": { "total_percent": 1.122500687000321, "total_count": 115477, "samples": 50 }, "formatted_data": { "total_percent": "1.1225", "total_count": "115,477", "samples": "50" } } ], "GACTACTGGGGTATCTAATCCTGTTCGCTACCCATGCTTTCGAGCCTCAG": [ { "sample": "GACTACTGGGGTATCTAATCCTGTTCGCTACCCATGCTTTCGAGCCTCAG", "raw_data": { "total_percent": 4.041369910231634, "total_count": 415755, "samples": 50 }, "formatted_data": { "total_percent": "4.0414", "total_count": "415,755", "samples": "50" } } ], "GACTACTAGGGTATCTAATCCTGTTCGCTACCCATGCTTTCGAGCCTCAG": [ { "sample": "GACTACTAGGGTATCTAATCCTGTTCGCTACCCATGCTTTCGAGCCTCAG", "raw_data": { "total_percent": 3.9095883276336854, "total_count": 402198, "samples": 49 }, "formatted_data": { "total_percent": "3.9096", "total_count": "402,198", "samples": "49" } } ], "GACTACTCGGGTATCTAATCCTGTTCGCTACCCATGCTTTCGAGCCTCAG": [ { "sample": "GACTACTCGGGTATCTAATCCTGTTCGCTACCCATGCTTTCGAGCCTCAG", "raw_data": { "total_percent": 3.971304139975234, "total_count": 408547, "samples": 49 }, "formatted_data": { "total_percent": "3.9713", "total_count": "408,547", "samples": "49" } } ], "GACTACCAGGGTATCTAATCCTGTTCGCTACCCATGCTTTCGAGCCTCAG": [ { "sample": "GACTACCAGGGTATCTAATCCTGTTCGCTACCCATGCTTTCGAGCCTCAG", "raw_data": { "total_percent": 3.3552249983159137, "total_count": 345168, "samples": 48 }, "formatted_data": { "total_percent": "3.3552", "total_count": "345,168", "samples": "48" } } ], "GACTACAGGGGTATCTAATCCTGTTCGCTACCCATGCTTTCGAGCCTCAG": [ { "sample": "GACTACAGGGGTATCTAATCCTGTTCGCTACCCATGCTTTCGAGCCTCAG", "raw_data": { "total_percent": 3.4665545303284757, "total_count": 356621, "samples": 48 }, "formatted_data": { "total_percent": "3.4666", "total_count": "356,621", "samples": "48" } } ], "GACTACCGGGGTATCTAATCCTGTTCGCTACCCATGCTTTCGAGCCTCAG": [ { "sample": "GACTACCGGGGTATCTAATCCTGTTCGCTACCCATGCTTTCGAGCCTCAG", "raw_data": { "total_percent": 3.29229411642913, "total_count": 338694, "samples": 48 }, "formatted_data": { "total_percent": "3.2923", "total_count": "338,694", "samples": "48" } } ], "GACTACACGGGTATCTAATCCTGTTCGCTACCCATGCTTTCGAGCCTCAG": [ { "sample": "GACTACACGGGTATCTAATCCTGTTCGCTACCCATGCTTTCGAGCCTCAG", "raw_data": { "total_percent": 3.178388636980671, "total_count": 326976, "samples": 48 }, "formatted_data": { "total_percent": "3.1784", "total_count": "326,976", "samples": "48" } } ], "GACTACAAGGGTATCTAATCCTGTTCGCTACCCATGCTTTCGAGCCTCAG": [ { "sample": "GACTACAAGGGTATCTAATCCTGTTCGCTACCCATGCTTTCGAGCCTCAG", "raw_data": { "total_percent": 3.390724470149484, "total_count": 348820, "samples": 48 }, "formatted_data": { "total_percent": "3.3907", "total_count": "348,820", "samples": "48" } } ], "GACTACTGGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGAGCCTCAA": [ { "sample": "GACTACTGGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGAGCCTCAA", "raw_data": { "total_percent": 0.7914671400966437, "total_count": 81422, "samples": 47 }, "formatted_data": { "total_percent": "0.7915", "total_count": "81,422", "samples": "47" } } ], "GACTACTCGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGAGCCTCAA": [ { "sample": "GACTACTCGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGAGCCTCAA", "raw_data": { "total_percent": 0.7819312743056436, "total_count": 80441, "samples": 47 }, "formatted_data": { "total_percent": "0.7819", "total_count": "80,441", "samples": "47" } } ] } } ], "headers_in_order": { "1000.0": [ [ 0, "samples" ], [ 0, "total_count" ], [ 0, "total_percent" ] ] } } }, "fastqc-status-check-heatmap": { "id": "fastqc-status-check-heatmap", "anchor": "fastqc-status-check-heatmap", "plot_type": "heatmap", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 700, "hoverlabel": { "namelength": -1 }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "white", "plot_bgcolor": "white", "showlegend": false, "title": { "font": { "size": 20 }, "text": "FastQC: Status Checks", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)", "type": "category", "tickmode": "array", "tickvals": [ 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 ], "ticktext": [ "Basic
Statistics", "Per Base
Sequence
Quality", "Per Tile
Sequence
Quality", "Per
Sequence
Quality
Scores", "Per Base
Sequence
Content", "Per
Sequence
GC Content", "Per Base N
Content", "Sequence
Length
Distribution", "Sequence
Duplication
Levels", "Overrepresented
Sequences", "Adapter
Content" ], "tickangle": 0, "showgrid": false }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)", "type": "category", "showgrid": false, "autorange": "reversed", "ticklabelposition": "outside right" } }, "datasets": [ { "plot_id": "fastqc-status-check-heatmap", "label": "1", "uid": "fastqc-status-check-heatmap", "dconfig": { "title": "FastQC: Status Checks
64 samples" }, "layout": { "title": { "text": "FastQC: Status Checks
64 samples" }, "xaxis": { "hoverformat": null, "ticksuffix": "", "title": null, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "yaxis": { "hoverformat": ",.1f", "ticksuffix": "", "title": null, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } } }, "trace_params": { "colorscale": [ [ 0.0, "#ffffff" ], [ 0.25, "#d9534f" ], [ 0.5, "#fee391" ], [ 1.0, "#5cb85c" ] ], "reversescale": false, "showscale": false, "zmin": 0, "zmax": 1, "hovertemplate": "Section Name: %{x}
Sample: %{y}
z: %{z}" }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "n_samples": 64, "rows": [ [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 0.5, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 0.5, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 0.5, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 0.5, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 0.5, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 0.5, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 0.5, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 0.5, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 0.5, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 0.5, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 0.5, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 0.5, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 0.5, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 0.5, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 0.5, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 0.5, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 0.5, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 0.5, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 0.5, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 0.5, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 0.5, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 0.5, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 0.5, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 0.5, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 0.5, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 0.5, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 0.5, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 0.5, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 0.5, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 0.5, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 0.5, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 0.5, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 0.5, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 0.5, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 0.5, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 0.5, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 0.5, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 0.5, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 0.5, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 0.5, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 0.5, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 0.5, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 0.5, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 0.5, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 0.5, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 0.5, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 0.5, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ] ], "xcats": [ "Basic Statistics", "Per Base Sequence Quality", "Per Tile Sequence Quality", "Per Sequence Quality Scores", "Per Base Sequence Content", "Per Sequence GC Content", "Per Base N Content", "Sequence Length Distribution", "Sequence Duplication Levels", "Overrepresented Sequences", "Adapter Content" ], "ycats": [ "CAFS1_R2", "CAFS2_R2", "CAMS1_R2", "CAMS2_R2", "CCFS1_R2", "CCFS2_R2", "CCMS1_R2", "CCMS2_R2", "CPFS1_R2", "CPFS2_R2", "CPMS1_R2", "CPMS2_R2", "CVFS1_R2", "CVFS2_R2", "CVMS1_R2", "CVMS2_R2", "DAFS1_R2", "DAFS2_R2", "DAMS1_R2", "DAMS2_R2", "DCFS1_R2", "DCFS2_R2", "DCMS1_R2", "DCMS2_R2", "DPFS1_R2", "DPFS2_R2", "DPMS1_R2", "DPMS2_R2", "DVFS1_R2", "DVFS2_R2", "DVMS1_R2", "DVMS2_R2", "IAFS1_R2", "IAFS2_R2", "IAMS1_R2", "IAMS2_R2", "ICFS1_R2", "ICFS2_R2", "ICMS1_R2", "ICMS2_R2", "IPFS1_R2", "IPFS2_R2", "IPMS1_R2", "IPMS2_R2", "IVFS1_R2", "IVFS2_R2", "IVMS1_R2", "IVMS2_R2", "JAFS1_R2", "JAFS2_R2", "JAMS1_R2", "JAMS2_R2", "JCFS1_R2", "JCFS2_R2", "JCMS1_R2", "JCMS2_R2", "JPFS1_R2", "JPFS2_R2", "JPMS1_R2", "JPMS2_R2", "JVFS1_R2", "JVFS2_R2", "JVMS1_R2", "JVMS2_R2" ] } ], "pconfig": { "id": "fastqc-status-check-heatmap", "title": "FastQC: Status Checks", "anchor": null, "table_title": null, "height": null, "width": null, "square": false, "logswitch": false, "logswitch_active": false, "logswitch_label": "Log10", "cpswitch": true, "cpswitch_c_active": true, "cpswitch_counts_label": "Counts", "cpswitch_percent_label": "Percentages", "xLog": null, "yLog": null, "xlog": false, "ylog": false, "data_labels": [], "xTitle": null, "yTitle": null, "xlab": "Section Name", "ylab": "Sample", "xsuffix": null, "ysuffix": null, "tt_suffix": null, "xLabFormat": null, "yLabFormat": null, "xLabelFormat": null, "yLabelFormat": null, "xlab_format": null, "ylab_format": null, "tt_label": null, "xDecimals": null, "yDecimals": null, "decimalPlaces": 2, "x_decimals": null, "y_decimals": null, "tt_decimals": 1, "xmin": null, "xmax": null, "ymin": null, "ymax": null, "xFloor": null, "xCeiling": null, "yFloor": null, "yCeiling": null, "x_clipmin": null, "x_clipmax": null, "y_clipmin": null, "y_clipmax": null, "save_data_file": true, "showlegend": null, "xMinRange": null, "yMinRange": null, "x_minrange": null, "y_minrange": null, "xPlotBands": null, "yPlotBands": null, "xPlotLines": null, "yPlotLines": null, "x_bands": null, "y_bands": null, "x_lines": null, "y_lines": null, "zlab": "z", "min": 0, "max": 1, "xcats_samples": false, "ycats_samples": true, "colstops": [ [ 0, "#ffffff" ], [ 0.25, "#d9534f" ], [ 0.5, "#fee391" ], [ 1, "#5cb85c" ] ], "reverseColors": false, "reverse_colors": false, "legend": false, "datalabels": null, "display_values": false, "angled_xticks": false }, "add_log_tab": false, "add_pct_tab": false, "l_active": false, "p_active": false, "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [], "square": false, "flat": false, "defer_render": false, "xcats_samples": false, "ycats_samples": true, "min": 0.0, "max": 1.0 }, "general_stats_table": { "id": "general_stats_table", "anchor": "general_stats_table", "plot_type": "violin", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 500, "hoverlabel": { "namelength": -1 }, "margin": { "b": 40, "l": 60, "pad": 0, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "white", "plot_bgcolor": "white", "showlegend": false, "title": { "font": { "size": 20 }, "text": "General Statistics", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": false, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.1)", "tickfont": { "color": "rgba(0,0,0,0.5)", "size": 9 }, "zerolinecolor": "rgba(0,0,0,0.1)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.1)", "tickfont": { "color": "rgba(0,0,0,0.5)", "size": 9 }, "zerolinecolor": "rgba(0,0,0,0.1)" }, "violingap": 0, "grid": { "columns": 1, "roworder": "top to bottom", "ygap": 0.4 } }, "datasets": [ { "plot_id": "general_stats_table", "label": "1", "uid": "general_stats_table", "dconfig": { "ylab": "", "title": "General Statistics
64 samples" }, "layout": { "title": { "text": "General Statistics
64 samples" }, "xaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": null }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "yaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "" }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } } }, "trace_params": { "hovertemplate": "%{text}: %{x}", "orientation": "h", "box": { "visible": true }, "meanline": { "visible": true }, "fillcolor": "#b5b5b5", "line": { "width": 2, "color": "#b5b5b5" }, "opacity": 0.5, "points": false, "hoveron": "points" }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "n_samples": 64, "metrics": [ "fastqc-percent_duplicates", "fastqc-percent_gc", "fastqc-avg_sequence_length", "fastqc-median_sequence_length", "fastqc-percent_fails", "fastqc-total_sequences" ], "header_by_metric": { "fastqc-percent_duplicates": { "title": "Dups", "description": "% duplicate reads", "suffix": "%", "dmin": 0.0, "dmax": 100.0, "hidden": false, "xaxis": { "ticksuffix": "%", "tickvals": null, "range": [ -0.5, 100.5025 ] }, "show_only_outliers": false, "show_points": true, "namespace": "FastQC", "color": null, "hoverformat": ".2f" }, "fastqc-percent_gc": { "title": "GC", "description": "Average % GC content", "suffix": "%", "dmin": 0.0, "dmax": 100.0, "hidden": false, "xaxis": { "ticksuffix": "%", "tickvals": null, "range": [ -0.5, 100.5025 ] }, "show_only_outliers": false, "show_points": true, "namespace": "FastQC", "color": null, "hoverformat": ".2f" }, "fastqc-avg_sequence_length": { "title": "Avg len", "description": "Average read length", "suffix": " bp", "dmin": 0.0, "dmax": 300.98801893806, "hidden": true, "xaxis": { "ticksuffix": " bp", "tickvals": null, "range": [ -1.5049400946903, 302.50048373322375 ] }, "show_only_outliers": false, "show_points": true, "namespace": "FastQC", "color": null, "hoverformat": ".2f" }, "fastqc-median_sequence_length": { "title": "Median len", "description": "Median read length", "suffix": " bp", "dmin": 0.0, "dmax": 301, "hidden": true, "xaxis": { "ticksuffix": " bp", "tickvals": null, "range": [ -1.5050000000000001, 302.512525 ] }, "show_only_outliers": false, "show_points": true, "namespace": "FastQC", "color": null, "hoverformat": null }, "fastqc-percent_fails": { "title": "Failed", "description": "Percentage of modules failed in FastQC report (includes those not plotted here)", "suffix": "%", "dmin": 0.0, "dmax": 100.0, "hidden": true, "xaxis": { "ticksuffix": "%", "tickvals": null, "range": [ -0.5, 100.5025 ] }, "show_only_outliers": false, "show_points": true, "namespace": "FastQC", "color": null, "hoverformat": ".2f" }, "fastqc-total_sequences": { "title": "Seqs", "description": "Total sequences (millions)", "suffix": "M", "dmin": 0.0, "dmax": 0.347311, "hidden": false, "xaxis": { "ticksuffix": "M", "tickvals": null, "range": [ -0.0017365549999999999, 0.349056237775 ] }, "show_only_outliers": false, "show_points": true, "namespace": "FastQC", "color": null, "hoverformat": ".2f" } }, "violin_value_by_sample_by_metric": { "fastqc-percent_duplicates": { "CAFS1_R2": 93.9935708578086, "CAFS2_R2": 93.83468476796703, "CAMS1_R2": 93.07651485256297, "CAMS2_R2": 93.5453208508196, "CCFS1_R2": 91.4041912989704, "CCFS2_R2": 91.08369991970403, "CCMS1_R2": 91.62817277013191, "CCMS2_R2": 91.58605140080132, "CPFS1_R2": 92.6099851705388, "CPFS2_R2": 89.05866333318451, "CPMS1_R2": 91.90595899868994, "CPMS2_R2": 89.58183780405025, "CVFS1_R2": 91.72386760375932, "CVFS2_R2": 91.60386576246263, "CVMS1_R2": 91.62921838528828, "CVMS2_R2": 91.82807470823937, "DAFS1_R2": 92.35089358200158, "DAFS2_R2": 88.77665245202559, "DAMS1_R2": 93.18046081790463, "DAMS2_R2": 94.5173783392519, "DCFS1_R2": 93.1682635901447, "DCFS2_R2": 91.24500245493442, "DCMS1_R2": 93.96430802841786, "DCMS2_R2": 91.52662922898908, "DPFS1_R2": 93.65234787754125, "DPFS2_R2": 92.59236830750831, "DPMS1_R2": 89.9747570210846, "DPMS2_R2": 89.88132273303376, "DVFS1_R2": 90.00138966092274, "DVFS2_R2": 91.34050687793149, "DVMS1_R2": 89.90286930465034, "DVMS2_R2": 90.97101062343613, "IAFS1_R2": 96.24214199730062, "IAFS2_R2": 96.22256133348985, "IAMS1_R2": 95.84525143346734, "IAMS2_R2": 94.52770104105542, "ICFS1_R2": 90.88193039761559, "ICFS2_R2": 89.67283121933154, "ICMS1_R2": 93.69037905961196, "ICMS2_R2": 92.32164882823379, "IPFS1_R2": 93.96068637318125, "IPFS2_R2": 91.55943108703013, "IPMS1_R2": 94.06638728131445, "IPMS2_R2": 92.60392725604186, "IVFS1_R2": 94.83059102047234, "IVFS2_R2": 94.78888714487522, "IVMS1_R2": 91.31303685009512, "IVMS2_R2": 93.07708430155736, "JAFS1_R2": 94.74503286243106, "JAFS2_R2": 94.15085146585224, "JAMS1_R2": 96.70037872530484, "JAMS2_R2": 95.45162272834952, "JCFS1_R2": 95.41233717940545, "JCFS2_R2": 95.12824892906889, "JCMS1_R2": 93.7504259946588, "JCMS2_R2": 92.79807300003138, "JPFS1_R2": 96.0684521643845, "JPFS2_R2": 95.84431933072973, "JPMS1_R2": 94.25564237138138, "JPMS2_R2": 93.8103151478117, "JVFS1_R2": 94.14089894803953, "JVFS2_R2": 91.83366099096997, "JVMS1_R2": 94.71827843057088, "JVMS2_R2": 90.76489038900822 }, "fastqc-percent_gc": { "CAFS1_R2": 53.0, "CAFS2_R2": 53.0, "CAMS1_R2": 53.0, "CAMS2_R2": 53.0, "CCFS1_R2": 52.0, "CCFS2_R2": 52.0, "CCMS1_R2": 53.0, "CCMS2_R2": 53.0, "CPFS1_R2": 54.0, "CPFS2_R2": 53.0, "CPMS1_R2": 53.0, "CPMS2_R2": 52.0, "CVFS1_R2": 52.0, "CVFS2_R2": 52.0, "CVMS1_R2": 52.0, "CVMS2_R2": 52.0, "DAFS1_R2": 54.0, "DAFS2_R2": 54.0, "DAMS1_R2": 52.0, "DAMS2_R2": 52.0, "DCFS1_R2": 52.0, "DCFS2_R2": 52.0, "DCMS1_R2": 52.0, "DCMS2_R2": 52.0, "DPFS1_R2": 53.0, "DPFS2_R2": 53.0, "DPMS1_R2": 52.0, "DPMS2_R2": 52.0, "DVFS1_R2": 52.0, "DVFS2_R2": 52.0, "DVMS1_R2": 52.0, "DVMS2_R2": 52.0, "IAFS1_R2": 54.0, "IAFS2_R2": 55.0, "IAMS1_R2": 54.0, "IAMS2_R2": 54.0, "ICFS1_R2": 52.0, "ICFS2_R2": 53.0, "ICMS1_R2": 53.0, "ICMS2_R2": 52.0, "IPFS1_R2": 53.0, "IPFS2_R2": 53.0, "IPMS1_R2": 52.0, "IPMS2_R2": 52.0, "IVFS1_R2": 52.0, "IVFS2_R2": 52.0, "IVMS1_R2": 51.0, "IVMS2_R2": 52.0, "JAFS1_R2": 54.0, "JAFS2_R2": 54.0, "JAMS1_R2": 52.0, "JAMS2_R2": 52.0, "JCFS1_R2": 52.0, "JCFS2_R2": 52.0, "JCMS1_R2": 52.0, "JCMS2_R2": 52.0, "JPFS1_R2": 52.0, "JPFS2_R2": 52.0, "JPMS1_R2": 52.0, "JPMS2_R2": 52.0, "JVFS1_R2": 52.0, "JVFS2_R2": 52.0, "JVMS1_R2": 52.0, "JVMS2_R2": 52.0 }, "fastqc-avg_sequence_length": { "CAFS1_R2": 300.98170683355596, "CAFS2_R2": 300.49557592245316, "CAMS1_R2": 300.98525629686077, "CAMS2_R2": 300.9840022956347, "CCFS1_R2": 300.9598614591554, "CCFS2_R2": 300.9239651426854, "CCMS1_R2": 300.9792656793181, "CCMS2_R2": 300.9711867074948, "CPFS1_R2": 300.9125796582544, "CPFS2_R2": 300.9520709629894, "CPMS1_R2": 300.9581843288602, "CPMS2_R2": 300.9623224287884, "CVFS1_R2": 300.9537538399832, "CVFS2_R2": 300.9737493832774, "CVMS1_R2": 300.96820804519973, "CVMS2_R2": 300.9711808368549, "DAFS1_R2": 300.86612395600486, "DAFS2_R2": 300.7293043710021, "DAMS1_R2": 300.8482067079496, "DAMS2_R2": 300.828301513258, "DCFS1_R2": 300.4593884434885, "DCFS2_R2": 299.3549624745739, "DCMS1_R2": 300.76969658100205, "DCMS2_R2": 299.3178575598985, "DPFS1_R2": 300.73026881190214, "DPFS2_R2": 299.78814521562066, "DPMS1_R2": 300.5195968440179, "DPMS2_R2": 300.61627491646504, "DVFS1_R2": 300.74170372429126, "DVFS2_R2": 300.18769953884356, "DVMS1_R2": 300.62909157778597, "DVMS2_R2": 300.62397630681926, "IAFS1_R2": 300.98554857066426, "IAFS2_R2": 300.98801893806, "IAMS1_R2": 300.9804521188954, "IAMS2_R2": 300.97673943285884, "ICFS1_R2": 300.8209479018505, "ICFS2_R2": 300.86309138042776, "ICMS1_R2": 300.96351288248485, "ICMS2_R2": 300.95717582461305, "IPFS1_R2": 300.93989885811555, "IPFS2_R2": 300.9674349902864, "IPMS1_R2": 300.95055515546954, "IPMS2_R2": 300.96319375309827, "IVFS1_R2": 300.97923063819377, "IVFS2_R2": 300.87874352534925, "IVMS1_R2": 300.8512128568592, "IVMS2_R2": 300.9746029142404, "JAFS1_R2": 300.96649542947796, "JAFS2_R2": 300.9575752534195, "JAMS1_R2": 300.97737437516446, "JAMS2_R2": 300.9609936038445, "JCFS1_R2": 300.93379337455644, "JCFS2_R2": 300.9293809623926, "JCMS1_R2": 300.9415101588108, "JCMS2_R2": 300.9179808869221, "JPFS1_R2": 300.9850314395415, "JPFS2_R2": 300.9781188668398, "JPMS1_R2": 300.9699057751191, "JPMS2_R2": 300.93845712454635, "JVFS1_R2": 300.8708547748076, "JVFS2_R2": 300.97566225717236, "JVMS1_R2": 300.9159931588691, "JVMS2_R2": 300.9365901264873 }, "fastqc-median_sequence_length": { "CAFS1_R2": 301, "CAFS2_R2": 300, "CAMS1_R2": 301, "CAMS2_R2": 301, "CCFS1_R2": 301, "CCFS2_R2": 301, "CCMS1_R2": 301, "CCMS2_R2": 301, "CPFS1_R2": 301, "CPFS2_R2": 301, "CPMS1_R2": 301, "CPMS2_R2": 301, "CVFS1_R2": 301, "CVFS2_R2": 301, "CVMS1_R2": 301, "CVMS2_R2": 301, "DAFS1_R2": 301, "DAFS2_R2": 301, "DAMS1_R2": 301, "DAMS2_R2": 301, "DCFS1_R2": 301, "DCFS2_R2": 301, "DCMS1_R2": 301, "DCMS2_R2": 301, "DPFS1_R2": 301, "DPFS2_R2": 301, "DPMS1_R2": 301, "DPMS2_R2": 301, "DVFS1_R2": 301, "DVFS2_R2": 301, "DVMS1_R2": 301, "DVMS2_R2": 301, "IAFS1_R2": 301, "IAFS2_R2": 301, "IAMS1_R2": 301, "IAMS2_R2": 301, "ICFS1_R2": 301, "ICFS2_R2": 301, "ICMS1_R2": 301, "ICMS2_R2": 301, "IPFS1_R2": 301, "IPFS2_R2": 301, "IPMS1_R2": 301, "IPMS2_R2": 301, "IVFS1_R2": 301, "IVFS2_R2": 301, "IVMS1_R2": 301, "IVMS2_R2": 301, "JAFS1_R2": 301, "JAFS2_R2": 301, "JAMS1_R2": 301, "JAMS2_R2": 301, "JCFS1_R2": 301, "JCFS2_R2": 301, "JCMS1_R2": 301, "JCMS2_R2": 301, "JPFS1_R2": 301, "JPFS2_R2": 301, "JPMS1_R2": 301, "JPMS2_R2": 301, "JVFS1_R2": 301, "JVFS2_R2": 301, "JVMS1_R2": 301, "JVMS2_R2": 301 }, "fastqc-percent_fails": { "CAFS1_R2": 36.36363636363637, "CAFS2_R2": 36.36363636363637, "CAMS1_R2": 36.36363636363637, "CAMS2_R2": 36.36363636363637, "CCFS1_R2": 36.36363636363637, "CCFS2_R2": 36.36363636363637, "CCMS1_R2": 36.36363636363637, "CCMS2_R2": 36.36363636363637, "CPFS1_R2": 36.36363636363637, "CPFS2_R2": 36.36363636363637, "CPMS1_R2": 36.36363636363637, "CPMS2_R2": 36.36363636363637, "CVFS1_R2": 36.36363636363637, "CVFS2_R2": 36.36363636363637, "CVMS1_R2": 36.36363636363637, "CVMS2_R2": 36.36363636363637, "DAFS1_R2": 36.36363636363637, "DAFS2_R2": 36.36363636363637, "DAMS1_R2": 36.36363636363637, "DAMS2_R2": 36.36363636363637, "DCFS1_R2": 36.36363636363637, "DCFS2_R2": 36.36363636363637, "DCMS1_R2": 36.36363636363637, "DCMS2_R2": 36.36363636363637, "DPFS1_R2": 36.36363636363637, "DPFS2_R2": 36.36363636363637, "DPMS1_R2": 36.36363636363637, "DPMS2_R2": 36.36363636363637, "DVFS1_R2": 36.36363636363637, "DVFS2_R2": 36.36363636363637, "DVMS1_R2": 36.36363636363637, "DVMS2_R2": 36.36363636363637, "IAFS1_R2": 36.36363636363637, "IAFS2_R2": 36.36363636363637, "IAMS1_R2": 36.36363636363637, "IAMS2_R2": 36.36363636363637, "ICFS1_R2": 36.36363636363637, "ICFS2_R2": 36.36363636363637, "ICMS1_R2": 36.36363636363637, "ICMS2_R2": 36.36363636363637, "IPFS1_R2": 36.36363636363637, "IPFS2_R2": 36.36363636363637, "IPMS1_R2": 36.36363636363637, "IPMS2_R2": 36.36363636363637, "IVFS1_R2": 36.36363636363637, "IVFS2_R2": 36.36363636363637, "IVMS1_R2": 36.36363636363637, "IVMS2_R2": 36.36363636363637, "JAFS1_R2": 36.36363636363637, "JAFS2_R2": 36.36363636363637, "JAMS1_R2": 36.36363636363637, "JAMS2_R2": 36.36363636363637, "JCFS1_R2": 36.36363636363637, "JCFS2_R2": 36.36363636363637, "JCMS1_R2": 36.36363636363637, "JCMS2_R2": 36.36363636363637, "JPFS1_R2": 36.36363636363637, "JPFS2_R2": 36.36363636363637, "JPMS1_R2": 36.36363636363637, "JPMS2_R2": 36.36363636363637, "JVFS1_R2": 36.36363636363637, "JVFS2_R2": 36.36363636363637, "JVMS1_R2": 36.36363636363637, "JVMS2_R2": 36.36363636363637 }, "fastqc-total_sequences": { "CAFS1_R2": 0.163941, "CAFS2_R2": 0.151444, "CAMS1_R2": 0.146978, "CAMS2_R2": 0.167274, "CCFS1_R2": 0.216687, "CCFS2_R2": 0.20299899999999999, "CCMS1_R2": 0.20998999999999998, "CCMS2_R2": 0.196923, "CPFS1_R2": 0.149702, "CPFS2_R2": 0.179192, "CPMS1_R2": 0.22594399999999998, "CPMS2_R2": 0.204777, "CVFS1_R2": 0.21940199999999999, "CVFS2_R2": 0.20673799999999998, "CVMS1_R2": 0.183364, "CVMS2_R2": 0.228355, "DAFS1_R2": 0.089919, "DAFS2_R2": 0.03752, "DAMS1_R2": 0.063626, "DAMS2_R2": 0.080819, "DCFS1_R2": 0.122736, "DCFS2_R2": 0.071285, "DCMS1_R2": 0.24167899999999998, "DCMS2_R2": 0.094201, "DPFS1_R2": 0.141958, "DPFS2_R2": 0.132107, "DPMS1_R2": 0.08200299999999999, "DPMS2_R2": 0.08678999999999999, "DVFS1_R2": 0.07196, "DVFS2_R2": 0.10148399999999999, "DVMS1_R2": 0.16585899999999998, "DVMS2_R2": 0.16105899999999998, "IAFS1_R2": 0.164482, "IAFS2_R2": 0.12778499999999998, "IAMS1_R2": 0.15173, "IAMS2_R2": 0.151673, "ICFS1_R2": 0.139909, "ICFS2_R2": 0.172816, "ICMS1_R2": 0.194877, "ICMS2_R2": 0.125665, "IPFS1_R2": 0.160962, "IPFS2_R2": 0.224428, "IPMS1_R2": 0.345759, "IPMS2_R2": 0.244089, "IVFS1_R2": 0.22894299999999998, "IVFS2_R2": 0.12742, "IVMS1_R2": 0.15611899999999998, "IVMS2_R2": 0.109737, "JAFS1_R2": 0.13237, "JAFS2_R2": 0.084149, "JAMS1_R2": 0.163443, "JAMS2_R2": 0.147745, "JCFS1_R2": 0.188244, "JCFS2_R2": 0.152204, "JCMS1_R2": 0.161387, "JCMS2_R2": 0.12745199999999998, "JPFS1_R2": 0.233623, "JPFS2_R2": 0.20177199999999998, "JPMS1_R2": 0.211303, "JPMS2_R2": 0.134191, "JVFS1_R2": 0.10979499999999999, "JVFS2_R2": 0.150055, "JVMS1_R2": 0.347311, "JVMS2_R2": 0.117324 } }, "scatter_value_by_sample_by_metric": { "fastqc-percent_duplicates": {}, "fastqc-percent_gc": {}, "fastqc-avg_sequence_length": {}, "fastqc-median_sequence_length": {}, "fastqc-percent_fails": {}, "fastqc-total_sequences": {} }, "all_samples": [ "CAFS1_R2", "CAFS2_R2", "CAMS1_R2", "CAMS2_R2", "CCFS1_R2", "CCFS2_R2", "CCMS1_R2", "CCMS2_R2", "CPFS1_R2", "CPFS2_R2", "CPMS1_R2", "CPMS2_R2", "CVFS1_R2", "CVFS2_R2", "CVMS1_R2", "CVMS2_R2", "DAFS1_R2", "DAFS2_R2", "DAMS1_R2", "DAMS2_R2", "DCFS1_R2", "DCFS2_R2", "DCMS1_R2", "DCMS2_R2", "DPFS1_R2", "DPFS2_R2", "DPMS1_R2", "DPMS2_R2", "DVFS1_R2", "DVFS2_R2", "DVMS1_R2", "DVMS2_R2", "IAFS1_R2", "IAFS2_R2", "IAMS1_R2", "IAMS2_R2", "ICFS1_R2", "ICFS2_R2", "ICMS1_R2", "ICMS2_R2", "IPFS1_R2", "IPFS2_R2", "IPMS1_R2", "IPMS2_R2", "IVFS1_R2", "IVFS2_R2", "IVMS1_R2", "IVMS2_R2", "JAFS1_R2", "JAFS2_R2", "JAMS1_R2", "JAMS2_R2", "JCFS1_R2", "JCFS2_R2", "JCMS1_R2", "JCMS2_R2", "JPFS1_R2", "JPFS2_R2", "JPMS1_R2", "JPMS2_R2", "JVFS1_R2", "JVFS2_R2", "JVMS1_R2", "JVMS2_R2" ], "scatter_trace_params": { "mode": "markers", "marker": { "size": 4, "color": "#0b79e6" }, "showlegend": false, "hovertemplate": "%{text}: %{x}", "hoverlabel": { "bgcolor": "white" } } } ], "pconfig": { "id": "general_stats_table", "title": "General Statistics", "anchor": null, "table_title": null, "height": null, "width": null, "square": false, "logswitch": false, "logswitch_active": false, "logswitch_label": "Log10", "cpswitch": true, "cpswitch_c_active": true, "cpswitch_counts_label": "Counts", "cpswitch_percent_label": "Percentages", "xLog": null, "yLog": null, "xlog": false, "ylog": false, "data_labels": [], "xTitle": null, "yTitle": null, "xlab": null, "ylab": null, "xsuffix": null, "ysuffix": null, "tt_suffix": null, "xLabFormat": null, "yLabFormat": null, "xLabelFormat": null, "yLabelFormat": null, "xlab_format": null, "ylab_format": null, "tt_label": null, "xDecimals": null, "yDecimals": null, "decimalPlaces": null, "x_decimals": null, "y_decimals": null, "tt_decimals": null, "xmin": null, "xmax": null, "ymin": null, "ymax": null, "xFloor": null, "xCeiling": null, "yFloor": null, "yCeiling": null, "x_clipmin": null, "x_clipmax": null, "y_clipmin": null, "y_clipmax": null, "save_data_file": true, "showlegend": null, "xMinRange": null, "yMinRange": null, "x_minrange": null, "y_minrange": null, "xPlotBands": null, "yPlotBands": null, "xPlotLines": null, "yPlotLines": null, "x_bands": null, "y_bands": null, "x_lines": null, "y_lines": null, "namespace": "", "save_file": true, "raw_data_fn": "multiqc_general_stats", "defaultsort": null, "sortRows": true, "sort_rows": true, "only_defined_headers": true, "col1_header": "Sample Name", "no_beeswarm": false, "no_violin": false, "scale": "GnBu", "min": null }, "add_log_tab": false, "add_pct_tab": false, "l_active": false, "p_active": false, "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [], "square": false, "flat": false, "defer_render": false, "violin_height": 70, "extra_height": 63, "no_violin": false, "show_table": true, "show_table_by_default": true, "n_samples": 64, "main_table_dt": { "id": "general_stats_table", "anchor": "general_stats_table_table", "pconfig": { "id": "general_stats_table", "title": "General Statistics", "anchor": null, "table_title": null, "height": null, "width": null, "square": false, "logswitch": false, "logswitch_active": false, "logswitch_label": "Log10", "cpswitch": true, "cpswitch_c_active": true, "cpswitch_counts_label": "Counts", "cpswitch_percent_label": "Percentages", "xLog": null, "yLog": null, "xlog": false, "ylog": false, "data_labels": [], "xTitle": null, "yTitle": null, "xlab": null, "ylab": null, "xsuffix": null, "ysuffix": null, "tt_suffix": null, "xLabFormat": null, "yLabFormat": null, "xLabelFormat": null, "yLabelFormat": null, "xlab_format": null, "ylab_format": null, "tt_label": null, "xDecimals": null, "yDecimals": null, "decimalPlaces": null, "x_decimals": null, "y_decimals": null, "tt_decimals": null, "xmin": null, "xmax": null, "ymin": null, "ymax": null, "xFloor": null, "xCeiling": null, "yFloor": null, "yCeiling": null, "x_clipmin": null, "x_clipmax": null, "y_clipmin": null, "y_clipmax": null, "save_data_file": true, "showlegend": null, "xMinRange": null, "yMinRange": null, "x_minrange": null, "y_minrange": null, "xPlotBands": null, "yPlotBands": null, "xPlotLines": null, "yPlotLines": null, "x_bands": null, "y_bands": null, "x_lines": null, "y_lines": null, "namespace": "", "save_file": true, "raw_data_fn": "multiqc_general_stats", "defaultsort": null, "sortRows": true, "sort_rows": true, "only_defined_headers": true, "col1_header": "Sample Name", "no_beeswarm": false, "no_violin": false, "scale": "GnBu", "min": null }, "sections": [ { "column_by_key": { "percent_duplicates": { "rid": "fastqc-percent_duplicates", "title": "Dups", "description": "% duplicate reads", "scale": "RdYlGn-rev", "hidden": false, "placement": 1000.0, "namespace": "FastQC", "colour": null, "color": null, "max": 100.0, "dmax": 100.0, "min": 0.0, "dmin": 0.0, "ceiling": null, "floor": null, "minRange": null, "minrange": null, "shared_key": null, "tt_decimals": null, "suffix": "%", "cond_formatting_colours": [ { "blue": "#337ab7" }, { "lbue": "#5bc0de" }, { "pass": "#5cb85c" }, { "warn": "#f0ad4e" }, { "fail": "#d9534f" } ], "cond_formatting_rules": {}, "bgcols": {}, "bars_zero_centrepoint": false }, "percent_gc": { "rid": "fastqc-percent_gc", "title": "GC", "description": "Average % GC content", "scale": "PuRd", "hidden": false, "placement": 1000.0, "namespace": "FastQC", "colour": null, "color": null, "max": 100.0, "dmax": 100.0, "min": 0.0, "dmin": 0.0, "ceiling": null, "floor": null, "minRange": null, "minrange": null, "shared_key": null, "tt_decimals": null, "suffix": "%", "cond_formatting_colours": [ { "blue": "#337ab7" }, { "lbue": "#5bc0de" }, { "pass": "#5cb85c" }, { "warn": "#f0ad4e" }, { "fail": "#d9534f" } ], "cond_formatting_rules": {}, "bgcols": {}, "bars_zero_centrepoint": false }, "avg_sequence_length": { "rid": "fastqc-avg_sequence_length", "title": "Avg len", "description": "Average read length", "scale": "RdYlGn", "hidden": true, "placement": 1000.0, "namespace": "FastQC", "colour": null, "color": null, "max": null, "dmax": 300.98801893806, "min": 0.0, "dmin": 0.0, "ceiling": null, "floor": null, "minRange": null, "minrange": null, "shared_key": null, "tt_decimals": null, "suffix": " bp", "cond_formatting_colours": [ { "blue": "#337ab7" }, { "lbue": "#5bc0de" }, { "pass": "#5cb85c" }, { "warn": "#f0ad4e" }, { "fail": "#d9534f" } ], "cond_formatting_rules": {}, "bgcols": {}, "bars_zero_centrepoint": false }, "median_sequence_length": { "rid": "fastqc-median_sequence_length", "title": "Median len", "description": "Median read length", "scale": "RdYlGn", "hidden": true, "placement": 1000.0, "namespace": "FastQC", "colour": null, "color": null, "max": null, "dmax": 301, "min": 0.0, "dmin": 0.0, "ceiling": null, "floor": null, "minRange": null, "minrange": null, "shared_key": null, "tt_decimals": null, "suffix": " bp", "cond_formatting_colours": [ { "blue": "#337ab7" }, { "lbue": "#5bc0de" }, { "pass": "#5cb85c" }, { "warn": "#f0ad4e" }, { "fail": "#d9534f" } ], "cond_formatting_rules": {}, "bgcols": {}, "bars_zero_centrepoint": false }, "percent_fails": { "rid": "fastqc-percent_fails", "title": "Failed", "description": "Percentage of modules failed in FastQC report (includes those not plotted here)", "scale": "Reds", "hidden": true, "placement": 1000.0, "namespace": "FastQC", "colour": null, "color": null, "max": 100.0, "dmax": 100.0, "min": 0.0, "dmin": 0.0, "ceiling": null, "floor": null, "minRange": null, "minrange": null, "shared_key": null, "tt_decimals": null, "suffix": "%", "cond_formatting_colours": [ { "blue": "#337ab7" }, { "lbue": "#5bc0de" }, { "pass": "#5cb85c" }, { "warn": "#f0ad4e" }, { "fail": "#d9534f" } ], "cond_formatting_rules": {}, "bgcols": {}, "bars_zero_centrepoint": false }, "total_sequences": { "rid": "fastqc-total_sequences", "title": "Seqs", "description": "Total sequences (millions)", "scale": "Blues", "hidden": false, "placement": 1000.0, "namespace": "FastQC", "colour": null, "color": null, "max": null, "dmax": 0.347311, "min": 0.0, "dmin": 0.0, "ceiling": null, "floor": null, "minRange": null, "minrange": null, "shared_key": null, "tt_decimals": null, "suffix": "M", "cond_formatting_colours": [ { "blue": "#337ab7" }, { "lbue": "#5bc0de" }, { "pass": "#5cb85c" }, { "warn": "#f0ad4e" }, { "fail": "#d9534f" } ], "cond_formatting_rules": {}, "bgcols": {}, "bars_zero_centrepoint": false } }, "rows_by_sgroup": { "CAFS1_R2": [ { "sample": "CAFS1_R2", "raw_data": { "total_sequences": 0.163941, "percent_gc": 53.0, "avg_sequence_length": 300.98170683355596, "median_sequence_length": 301, "percent_duplicates": 93.9935708578086, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "53.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "94.0", "percent_fails": "36" } } ], "CAFS2_R2": [ { "sample": "CAFS2_R2", "raw_data": { "total_sequences": 0.151444, "percent_gc": 53.0, "avg_sequence_length": 300.49557592245316, "median_sequence_length": 300, "percent_duplicates": 93.83468476796703, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "53.0", "avg_sequence_length": "300", "median_sequence_length": "300", "percent_duplicates": "93.8", "percent_fails": "36" } } ], "CAMS1_R2": [ { "sample": "CAMS1_R2", "raw_data": { "total_sequences": 0.146978, "percent_gc": 53.0, "avg_sequence_length": 300.98525629686077, "median_sequence_length": 301, "percent_duplicates": 93.07651485256297, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "53.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "93.1", "percent_fails": "36" } } ], "CAMS2_R2": [ { "sample": "CAMS2_R2", "raw_data": { "total_sequences": 0.167274, "percent_gc": 53.0, "avg_sequence_length": 300.9840022956347, "median_sequence_length": 301, "percent_duplicates": 93.5453208508196, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "53.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "93.5", "percent_fails": "36" } } ], "CCFS1_R2": [ { "sample": "CCFS1_R2", "raw_data": { "total_sequences": 0.216687, "percent_gc": 52.0, "avg_sequence_length": 300.9598614591554, "median_sequence_length": 301, "percent_duplicates": 91.4041912989704, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "52.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "91.4", "percent_fails": "36" } } ], "CCFS2_R2": [ { "sample": "CCFS2_R2", "raw_data": { "total_sequences": 0.20299899999999999, "percent_gc": 52.0, "avg_sequence_length": 300.9239651426854, "median_sequence_length": 301, "percent_duplicates": 91.08369991970403, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "52.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "91.1", "percent_fails": "36" } } ], "CCMS1_R2": [ { "sample": "CCMS1_R2", "raw_data": { "total_sequences": 0.20998999999999998, "percent_gc": 53.0, "avg_sequence_length": 300.9792656793181, "median_sequence_length": 301, "percent_duplicates": 91.62817277013191, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "53.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "91.6", "percent_fails": "36" } } ], "CCMS2_R2": [ { "sample": "CCMS2_R2", "raw_data": { "total_sequences": 0.196923, "percent_gc": 53.0, "avg_sequence_length": 300.9711867074948, "median_sequence_length": 301, "percent_duplicates": 91.58605140080132, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "53.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "91.6", "percent_fails": "36" } } ], "CPFS1_R2": [ { "sample": "CPFS1_R2", "raw_data": { "total_sequences": 0.149702, "percent_gc": 54.0, "avg_sequence_length": 300.9125796582544, "median_sequence_length": 301, "percent_duplicates": 92.6099851705388, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "54.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "92.6", "percent_fails": "36" } } ], "CPFS2_R2": [ { "sample": "CPFS2_R2", "raw_data": { "total_sequences": 0.179192, "percent_gc": 53.0, "avg_sequence_length": 300.9520709629894, "median_sequence_length": 301, "percent_duplicates": 89.05866333318451, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "53.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "89.1", "percent_fails": "36" } } ], "CPMS1_R2": [ { "sample": "CPMS1_R2", "raw_data": { "total_sequences": 0.22594399999999998, "percent_gc": 53.0, "avg_sequence_length": 300.9581843288602, "median_sequence_length": 301, "percent_duplicates": 91.90595899868994, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "53.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "91.9", "percent_fails": "36" } } ], "CPMS2_R2": [ { "sample": "CPMS2_R2", "raw_data": { "total_sequences": 0.204777, "percent_gc": 52.0, "avg_sequence_length": 300.9623224287884, "median_sequence_length": 301, "percent_duplicates": 89.58183780405025, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "52.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "89.6", "percent_fails": "36" } } ], "CVFS1_R2": [ { "sample": "CVFS1_R2", "raw_data": { "total_sequences": 0.21940199999999999, "percent_gc": 52.0, "avg_sequence_length": 300.9537538399832, "median_sequence_length": 301, "percent_duplicates": 91.72386760375932, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "52.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "91.7", "percent_fails": "36" } } ], "CVFS2_R2": [ { "sample": "CVFS2_R2", "raw_data": { "total_sequences": 0.20673799999999998, "percent_gc": 52.0, "avg_sequence_length": 300.9737493832774, "median_sequence_length": 301, "percent_duplicates": 91.60386576246263, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "52.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "91.6", "percent_fails": "36" } } ], "CVMS1_R2": [ { "sample": "CVMS1_R2", "raw_data": { "total_sequences": 0.183364, "percent_gc": 52.0, "avg_sequence_length": 300.96820804519973, "median_sequence_length": 301, "percent_duplicates": 91.62921838528828, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "52.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "91.6", "percent_fails": "36" } } ], "CVMS2_R2": [ { "sample": "CVMS2_R2", "raw_data": { "total_sequences": 0.228355, "percent_gc": 52.0, "avg_sequence_length": 300.9711808368549, "median_sequence_length": 301, "percent_duplicates": 91.82807470823937, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "52.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "91.8", "percent_fails": "36" } } ], "DAFS1_R2": [ { "sample": "DAFS1_R2", "raw_data": { "total_sequences": 0.089919, "percent_gc": 54.0, "avg_sequence_length": 300.86612395600486, "median_sequence_length": 301, "percent_duplicates": 92.35089358200158, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "54.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "92.4", "percent_fails": "36" } } ], "DAFS2_R2": [ { "sample": "DAFS2_R2", "raw_data": { "total_sequences": 0.03752, "percent_gc": 54.0, "avg_sequence_length": 300.7293043710021, "median_sequence_length": 301, "percent_duplicates": 88.77665245202559, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.0", "percent_gc": "54.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "88.8", "percent_fails": "36" } } ], "DAMS1_R2": [ { "sample": "DAMS1_R2", "raw_data": { "total_sequences": 0.063626, "percent_gc": 52.0, "avg_sequence_length": 300.8482067079496, "median_sequence_length": 301, "percent_duplicates": 93.18046081790463, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "52.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "93.2", "percent_fails": "36" } } ], "DAMS2_R2": [ { "sample": "DAMS2_R2", "raw_data": { "total_sequences": 0.080819, "percent_gc": 52.0, "avg_sequence_length": 300.828301513258, "median_sequence_length": 301, "percent_duplicates": 94.5173783392519, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "52.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "94.5", "percent_fails": "36" } } ], "DCFS1_R2": [ { "sample": "DCFS1_R2", "raw_data": { "total_sequences": 0.122736, "percent_gc": 52.0, "avg_sequence_length": 300.4593884434885, "median_sequence_length": 301, "percent_duplicates": 93.1682635901447, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "52.0", "avg_sequence_length": "300", "median_sequence_length": "301", "percent_duplicates": "93.2", "percent_fails": "36" } } ], "DCFS2_R2": [ { "sample": "DCFS2_R2", "raw_data": { "total_sequences": 0.071285, "percent_gc": 52.0, "avg_sequence_length": 299.3549624745739, "median_sequence_length": 301, "percent_duplicates": 91.24500245493442, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "52.0", "avg_sequence_length": "299", "median_sequence_length": "301", "percent_duplicates": "91.2", "percent_fails": "36" } } ], "DCMS1_R2": [ { "sample": "DCMS1_R2", "raw_data": { "total_sequences": 0.24167899999999998, "percent_gc": 52.0, "avg_sequence_length": 300.76969658100205, "median_sequence_length": 301, "percent_duplicates": 93.96430802841786, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "52.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "94.0", "percent_fails": "36" } } ], "DCMS2_R2": [ { "sample": "DCMS2_R2", "raw_data": { "total_sequences": 0.094201, "percent_gc": 52.0, "avg_sequence_length": 299.3178575598985, "median_sequence_length": 301, "percent_duplicates": 91.52662922898908, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "52.0", "avg_sequence_length": "299", "median_sequence_length": "301", "percent_duplicates": "91.5", "percent_fails": "36" } } ], "DPFS1_R2": [ { "sample": "DPFS1_R2", "raw_data": { "total_sequences": 0.141958, "percent_gc": 53.0, "avg_sequence_length": 300.73026881190214, "median_sequence_length": 301, "percent_duplicates": 93.65234787754125, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "53.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "93.7", "percent_fails": "36" } } ], "DPFS2_R2": [ { "sample": "DPFS2_R2", "raw_data": { "total_sequences": 0.132107, "percent_gc": 53.0, "avg_sequence_length": 299.78814521562066, "median_sequence_length": 301, "percent_duplicates": 92.59236830750831, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "53.0", "avg_sequence_length": "300", "median_sequence_length": "301", "percent_duplicates": "92.6", "percent_fails": "36" } } ], "DPMS1_R2": [ { "sample": "DPMS1_R2", "raw_data": { "total_sequences": 0.08200299999999999, "percent_gc": 52.0, "avg_sequence_length": 300.5195968440179, "median_sequence_length": 301, "percent_duplicates": 89.9747570210846, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "52.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "90.0", "percent_fails": "36" } } ], "DPMS2_R2": [ { "sample": "DPMS2_R2", "raw_data": { "total_sequences": 0.08678999999999999, "percent_gc": 52.0, "avg_sequence_length": 300.61627491646504, "median_sequence_length": 301, "percent_duplicates": 89.88132273303376, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "52.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "89.9", "percent_fails": "36" } } ], "DVFS1_R2": [ { "sample": "DVFS1_R2", "raw_data": { "total_sequences": 0.07196, "percent_gc": 52.0, "avg_sequence_length": 300.74170372429126, "median_sequence_length": 301, "percent_duplicates": 90.00138966092274, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "52.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "90.0", "percent_fails": "36" } } ], "DVFS2_R2": [ { "sample": "DVFS2_R2", "raw_data": { "total_sequences": 0.10148399999999999, "percent_gc": 52.0, "avg_sequence_length": 300.18769953884356, "median_sequence_length": 301, "percent_duplicates": 91.34050687793149, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "52.0", "avg_sequence_length": "300", "median_sequence_length": "301", "percent_duplicates": "91.3", "percent_fails": "36" } } ], "DVMS1_R2": [ { "sample": "DVMS1_R2", "raw_data": { "total_sequences": 0.16585899999999998, "percent_gc": 52.0, "avg_sequence_length": 300.62909157778597, "median_sequence_length": 301, "percent_duplicates": 89.90286930465034, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "52.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "89.9", "percent_fails": "36" } } ], "DVMS2_R2": [ { "sample": "DVMS2_R2", "raw_data": { "total_sequences": 0.16105899999999998, "percent_gc": 52.0, "avg_sequence_length": 300.62397630681926, "median_sequence_length": 301, "percent_duplicates": 90.97101062343613, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "52.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "91.0", "percent_fails": "36" } } ], "IAFS1_R2": [ { "sample": "IAFS1_R2", "raw_data": { "total_sequences": 0.164482, "percent_gc": 54.0, "avg_sequence_length": 300.98554857066426, "median_sequence_length": 301, "percent_duplicates": 96.24214199730062, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "54.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "96.2", "percent_fails": "36" } } ], "IAFS2_R2": [ { "sample": "IAFS2_R2", "raw_data": { "total_sequences": 0.12778499999999998, "percent_gc": 55.0, "avg_sequence_length": 300.98801893806, "median_sequence_length": 301, "percent_duplicates": 96.22256133348985, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "55.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "96.2", "percent_fails": "36" } } ], "IAMS1_R2": [ { "sample": "IAMS1_R2", "raw_data": { "total_sequences": 0.15173, "percent_gc": 54.0, "avg_sequence_length": 300.9804521188954, "median_sequence_length": 301, "percent_duplicates": 95.84525143346734, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "54.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "95.8", "percent_fails": "36" } } ], "IAMS2_R2": [ { "sample": "IAMS2_R2", "raw_data": { "total_sequences": 0.151673, "percent_gc": 54.0, "avg_sequence_length": 300.97673943285884, "median_sequence_length": 301, "percent_duplicates": 94.52770104105542, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "54.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "94.5", "percent_fails": "36" } } ], "ICFS1_R2": [ { "sample": "ICFS1_R2", "raw_data": { "total_sequences": 0.139909, "percent_gc": 52.0, "avg_sequence_length": 300.8209479018505, "median_sequence_length": 301, "percent_duplicates": 90.88193039761559, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "52.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "90.9", "percent_fails": "36" } } ], "ICFS2_R2": [ { "sample": "ICFS2_R2", "raw_data": { "total_sequences": 0.172816, "percent_gc": 53.0, "avg_sequence_length": 300.86309138042776, "median_sequence_length": 301, "percent_duplicates": 89.67283121933154, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "53.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "89.7", "percent_fails": "36" } } ], "ICMS1_R2": [ { "sample": "ICMS1_R2", "raw_data": { "total_sequences": 0.194877, "percent_gc": 53.0, "avg_sequence_length": 300.96351288248485, "median_sequence_length": 301, "percent_duplicates": 93.69037905961196, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "53.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "93.7", "percent_fails": "36" } } ], "ICMS2_R2": [ { "sample": "ICMS2_R2", "raw_data": { "total_sequences": 0.125665, "percent_gc": 52.0, "avg_sequence_length": 300.95717582461305, "median_sequence_length": 301, "percent_duplicates": 92.32164882823379, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "52.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "92.3", "percent_fails": "36" } } ], "IPFS1_R2": [ { "sample": "IPFS1_R2", "raw_data": { "total_sequences": 0.160962, "percent_gc": 53.0, "avg_sequence_length": 300.93989885811555, "median_sequence_length": 301, "percent_duplicates": 93.96068637318125, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "53.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "94.0", "percent_fails": "36" } } ], "IPFS2_R2": [ { "sample": "IPFS2_R2", "raw_data": { "total_sequences": 0.224428, "percent_gc": 53.0, "avg_sequence_length": 300.9674349902864, "median_sequence_length": 301, "percent_duplicates": 91.55943108703013, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "53.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "91.6", "percent_fails": "36" } } ], "IPMS1_R2": [ { "sample": "IPMS1_R2", "raw_data": { "total_sequences": 0.345759, "percent_gc": 52.0, "avg_sequence_length": 300.95055515546954, "median_sequence_length": 301, "percent_duplicates": 94.06638728131445, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.3", "percent_gc": "52.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "94.1", "percent_fails": "36" } } ], "IPMS2_R2": [ { "sample": "IPMS2_R2", "raw_data": { "total_sequences": 0.244089, "percent_gc": 52.0, "avg_sequence_length": 300.96319375309827, "median_sequence_length": 301, "percent_duplicates": 92.60392725604186, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "52.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "92.6", "percent_fails": "36" } } ], "IVFS1_R2": [ { "sample": "IVFS1_R2", "raw_data": { "total_sequences": 0.22894299999999998, "percent_gc": 52.0, "avg_sequence_length": 300.97923063819377, "median_sequence_length": 301, "percent_duplicates": 94.83059102047234, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "52.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "94.8", "percent_fails": "36" } } ], "IVFS2_R2": [ { "sample": "IVFS2_R2", "raw_data": { "total_sequences": 0.12742, "percent_gc": 52.0, "avg_sequence_length": 300.87874352534925, "median_sequence_length": 301, "percent_duplicates": 94.78888714487522, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "52.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "94.8", "percent_fails": "36" } } ], "IVMS1_R2": [ { "sample": "IVMS1_R2", "raw_data": { "total_sequences": 0.15611899999999998, "percent_gc": 51.0, "avg_sequence_length": 300.8512128568592, "median_sequence_length": 301, "percent_duplicates": 91.31303685009512, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "51.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "91.3", "percent_fails": "36" } } ], "IVMS2_R2": [ { "sample": "IVMS2_R2", "raw_data": { "total_sequences": 0.109737, "percent_gc": 52.0, "avg_sequence_length": 300.9746029142404, "median_sequence_length": 301, "percent_duplicates": 93.07708430155736, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "52.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "93.1", "percent_fails": "36" } } ], "JAFS1_R2": [ { "sample": "JAFS1_R2", "raw_data": { "total_sequences": 0.13237, "percent_gc": 54.0, "avg_sequence_length": 300.96649542947796, "median_sequence_length": 301, "percent_duplicates": 94.74503286243106, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "54.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "94.7", "percent_fails": "36" } } ], "JAFS2_R2": [ { "sample": "JAFS2_R2", "raw_data": { "total_sequences": 0.084149, "percent_gc": 54.0, "avg_sequence_length": 300.9575752534195, "median_sequence_length": 301, "percent_duplicates": 94.15085146585224, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "54.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "94.2", "percent_fails": "36" } } ], "JAMS1_R2": [ { "sample": "JAMS1_R2", "raw_data": { "total_sequences": 0.163443, "percent_gc": 52.0, "avg_sequence_length": 300.97737437516446, "median_sequence_length": 301, "percent_duplicates": 96.70037872530484, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "52.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "96.7", "percent_fails": "36" } } ], "JAMS2_R2": [ { "sample": "JAMS2_R2", "raw_data": { "total_sequences": 0.147745, "percent_gc": 52.0, "avg_sequence_length": 300.9609936038445, "median_sequence_length": 301, "percent_duplicates": 95.45162272834952, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "52.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "95.5", "percent_fails": "36" } } ], "JCFS1_R2": [ { "sample": "JCFS1_R2", "raw_data": { "total_sequences": 0.188244, "percent_gc": 52.0, "avg_sequence_length": 300.93379337455644, "median_sequence_length": 301, "percent_duplicates": 95.41233717940545, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "52.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "95.4", "percent_fails": "36" } } ], "JCFS2_R2": [ { "sample": "JCFS2_R2", "raw_data": { "total_sequences": 0.152204, "percent_gc": 52.0, "avg_sequence_length": 300.9293809623926, "median_sequence_length": 301, "percent_duplicates": 95.12824892906889, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "52.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "95.1", "percent_fails": "36" } } ], "JCMS1_R2": [ { "sample": "JCMS1_R2", "raw_data": { "total_sequences": 0.161387, "percent_gc": 52.0, "avg_sequence_length": 300.9415101588108, "median_sequence_length": 301, "percent_duplicates": 93.7504259946588, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "52.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "93.8", "percent_fails": "36" } } ], "JCMS2_R2": [ { "sample": "JCMS2_R2", "raw_data": { "total_sequences": 0.12745199999999998, "percent_gc": 52.0, "avg_sequence_length": 300.9179808869221, "median_sequence_length": 301, "percent_duplicates": 92.79807300003138, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "52.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "92.8", "percent_fails": "36" } } ], "JPFS1_R2": [ { "sample": "JPFS1_R2", "raw_data": { "total_sequences": 0.233623, "percent_gc": 52.0, "avg_sequence_length": 300.9850314395415, "median_sequence_length": 301, "percent_duplicates": 96.0684521643845, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "52.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "96.1", "percent_fails": "36" } } ], "JPFS2_R2": [ { "sample": "JPFS2_R2", "raw_data": { "total_sequences": 0.20177199999999998, "percent_gc": 52.0, "avg_sequence_length": 300.9781188668398, "median_sequence_length": 301, "percent_duplicates": 95.84431933072973, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "52.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "95.8", "percent_fails": "36" } } ], "JPMS1_R2": [ { "sample": "JPMS1_R2", "raw_data": { "total_sequences": 0.211303, "percent_gc": 52.0, "avg_sequence_length": 300.9699057751191, "median_sequence_length": 301, "percent_duplicates": 94.25564237138138, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "52.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "94.3", "percent_fails": "36" } } ], "JPMS2_R2": [ { "sample": "JPMS2_R2", "raw_data": { "total_sequences": 0.134191, "percent_gc": 52.0, "avg_sequence_length": 300.93845712454635, "median_sequence_length": 301, "percent_duplicates": 93.8103151478117, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "52.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "93.8", "percent_fails": "36" } } ], "JVFS1_R2": [ { "sample": "JVFS1_R2", "raw_data": { "total_sequences": 0.10979499999999999, "percent_gc": 52.0, "avg_sequence_length": 300.8708547748076, "median_sequence_length": 301, "percent_duplicates": 94.14089894803953, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "52.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "94.1", "percent_fails": "36" } } ], "JVFS2_R2": [ { "sample": "JVFS2_R2", "raw_data": { "total_sequences": 0.150055, "percent_gc": 52.0, "avg_sequence_length": 300.97566225717236, "median_sequence_length": 301, "percent_duplicates": 91.83366099096997, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "52.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "91.8", "percent_fails": "36" } } ], "JVMS1_R2": [ { "sample": "JVMS1_R2", "raw_data": { "total_sequences": 0.347311, "percent_gc": 52.0, "avg_sequence_length": 300.9159931588691, "median_sequence_length": 301, "percent_duplicates": 94.71827843057088, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.3", "percent_gc": "52.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "94.7", "percent_fails": "36" } } ], "JVMS2_R2": [ { "sample": "JVMS2_R2", "raw_data": { "total_sequences": 0.117324, "percent_gc": 52.0, "avg_sequence_length": 300.9365901264873, "median_sequence_length": 301, "percent_duplicates": 90.76489038900822, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "52.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "90.8", "percent_fails": "36" } } ] } } ], "headers_in_order": { "1000.0": [ [ 0, "percent_duplicates" ], [ 0, "percent_gc" ], [ 0, "avg_sequence_length" ], [ 0, "median_sequence_length" ], [ 0, "percent_fails" ], [ 0, "total_sequences" ] ] } } } }, "report_saved_raw_data": { "multiqc_fastqc": { "CAFS1_R2": { "Filename": "CAFS1_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 163941.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "38-301", "%GC": 53.0, "total_deduplicated_percentage": 6.006429142191398, "avg_sequence_length": 300.98170683355596, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "CAFS2_R2": { "Filename": "CAFS2_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 151444.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "225-301", "%GC": 53.0, "total_deduplicated_percentage": 6.165315232032962, "avg_sequence_length": 300.49557592245316, "median_sequence_length": 300, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "CAMS1_R2": { "Filename": "CAMS1_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 146978.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "100-301", "%GC": 53.0, "total_deduplicated_percentage": 6.923485147437032, "avg_sequence_length": 300.98525629686077, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "CAMS2_R2": { "Filename": "CAMS2_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 167274.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "69-301", "%GC": 53.0, "total_deduplicated_percentage": 6.454679149180387, "avg_sequence_length": 300.9840022956347, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "CCFS1_R2": { "Filename": "CCFS1_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 216687.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "41-301", "%GC": 52.0, "total_deduplicated_percentage": 8.595808701029597, "avg_sequence_length": 300.9598614591554, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "warn", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "CCFS2_R2": { "Filename": "CCFS2_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 202999.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "42-301", "%GC": 52.0, "total_deduplicated_percentage": 8.916300080295962, "avg_sequence_length": 300.9239651426854, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "warn", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "CCMS1_R2": { "Filename": "CCMS1_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 209990.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "99-301", "%GC": 53.0, "total_deduplicated_percentage": 8.371827229868089, "avg_sequence_length": 300.9792656793181, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "warn", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "CCMS2_R2": { "Filename": "CCMS2_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 196923.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "51-301", "%GC": 53.0, "total_deduplicated_percentage": 8.41394859919867, "avg_sequence_length": 300.9711867074948, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "warn", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "CPFS1_R2": { "Filename": "CPFS1_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 149702.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "37-301", "%GC": 54.0, "total_deduplicated_percentage": 7.390014829461196, "avg_sequence_length": 300.9125796582544, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "warn", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "CPFS2_R2": { "Filename": "CPFS2_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 179192.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "35-301", "%GC": 53.0, "total_deduplicated_percentage": 10.941336666815484, "avg_sequence_length": 300.9520709629894, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "warn", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "CPMS1_R2": { "Filename": "CPMS1_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 225944.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "51-301", "%GC": 53.0, "total_deduplicated_percentage": 8.09404100131006, "avg_sequence_length": 300.9581843288602, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "warn", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "CPMS2_R2": { "Filename": "CPMS2_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 204777.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "35-301", "%GC": 52.0, "total_deduplicated_percentage": 10.41816219594974, "avg_sequence_length": 300.9623224287884, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "warn", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "CVFS1_R2": { "Filename": "CVFS1_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 219402.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "35-301", "%GC": 52.0, "total_deduplicated_percentage": 8.27613239624069, "avg_sequence_length": 300.9537538399832, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "warn", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "CVFS2_R2": { "Filename": "CVFS2_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 206738.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "42-301", "%GC": 52.0, "total_deduplicated_percentage": 8.396134237537366, "avg_sequence_length": 300.9737493832774, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "warn", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "CVMS1_R2": { "Filename": "CVMS1_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 183364.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "36-301", "%GC": 52.0, "total_deduplicated_percentage": 8.37078161471172, "avg_sequence_length": 300.96820804519973, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "warn", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "CVMS2_R2": { "Filename": "CVMS2_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 228355.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "51-301", "%GC": 52.0, "total_deduplicated_percentage": 8.171925291760635, "avg_sequence_length": 300.9711808368549, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "warn", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "DAFS1_R2": { "Filename": "DAFS1_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 89919.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "76-301", "%GC": 54.0, "total_deduplicated_percentage": 7.6491064179984205, "avg_sequence_length": 300.86612395600486, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "DAFS2_R2": { "Filename": "DAFS2_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 37520.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "37-301", "%GC": 54.0, "total_deduplicated_percentage": 11.223347547974413, "avg_sequence_length": 300.7293043710021, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "DAMS1_R2": { "Filename": "DAMS1_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 63626.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "76-301", "%GC": 52.0, "total_deduplicated_percentage": 6.819539182095371, "avg_sequence_length": 300.8482067079496, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "DAMS2_R2": { "Filename": "DAMS2_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 80819.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "44-301", "%GC": 52.0, "total_deduplicated_percentage": 5.482621660748092, "avg_sequence_length": 300.828301513258, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "DCFS1_R2": { "Filename": "DCFS1_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 122736.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "35-301", "%GC": 52.0, "total_deduplicated_percentage": 6.831736409855299, "avg_sequence_length": 300.4593884434885, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "warn", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "DCFS2_R2": { "Filename": "DCFS2_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 71285.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "42-301", "%GC": 52.0, "total_deduplicated_percentage": 8.754997545065581, "avg_sequence_length": 299.3549624745739, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "warn", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "DCMS1_R2": { "Filename": "DCMS1_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 241679.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "37-301", "%GC": 52.0, "total_deduplicated_percentage": 6.03569197158214, "avg_sequence_length": 300.76969658100205, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "warn", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "DCMS2_R2": { "Filename": "DCMS2_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 94201.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "37-301", "%GC": 52.0, "total_deduplicated_percentage": 8.473370771010924, "avg_sequence_length": 299.3178575598985, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "warn", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "DPFS1_R2": { "Filename": "DPFS1_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 141958.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "41-301", "%GC": 53.0, "total_deduplicated_percentage": 6.347652122458755, "avg_sequence_length": 300.73026881190214, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "warn", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "DPFS2_R2": { "Filename": "DPFS2_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 132107.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "38-301", "%GC": 53.0, "total_deduplicated_percentage": 7.407631692491693, "avg_sequence_length": 299.78814521562066, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "warn", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "DPMS1_R2": { "Filename": "DPMS1_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 82003.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "37-301", "%GC": 52.0, "total_deduplicated_percentage": 10.025242978915404, "avg_sequence_length": 300.5195968440179, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "DPMS2_R2": { "Filename": "DPMS2_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 86790.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "42-301", "%GC": 52.0, "total_deduplicated_percentage": 10.118677266966241, "avg_sequence_length": 300.61627491646504, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "warn", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "DVFS1_R2": { "Filename": "DVFS1_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 71960.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "42-301", "%GC": 52.0, "total_deduplicated_percentage": 9.998610339077265, "avg_sequence_length": 300.74170372429126, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "warn", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "DVFS2_R2": { "Filename": "DVFS2_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 101484.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "37-301", "%GC": 52.0, "total_deduplicated_percentage": 8.659493122068504, "avg_sequence_length": 300.18769953884356, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "warn", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "DVMS1_R2": { "Filename": "DVMS1_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 165859.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "35-301", "%GC": 52.0, "total_deduplicated_percentage": 10.097130695349664, "avg_sequence_length": 300.62909157778597, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "warn", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "DVMS2_R2": { "Filename": "DVMS2_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 161059.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "35-301", "%GC": 52.0, "total_deduplicated_percentage": 9.028989376563867, "avg_sequence_length": 300.62397630681926, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "warn", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "IAFS1_R2": { "Filename": "IAFS1_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 164482.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "51-301", "%GC": 54.0, "total_deduplicated_percentage": 3.757858002699384, "avg_sequence_length": 300.98554857066426, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "IAFS2_R2": { "Filename": "IAFS2_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 127785.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "51-301", "%GC": 55.0, "total_deduplicated_percentage": 3.777438666510154, "avg_sequence_length": 300.98801893806, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "IAMS1_R2": { "Filename": "IAMS1_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 151730.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "51-301", "%GC": 54.0, "total_deduplicated_percentage": 4.154748566532657, "avg_sequence_length": 300.9804521188954, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "IAMS2_R2": { "Filename": "IAMS2_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 151673.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "51-301", "%GC": 54.0, "total_deduplicated_percentage": 5.472298958944571, "avg_sequence_length": 300.97673943285884, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "ICFS1_R2": { "Filename": "ICFS1_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 139909.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "37-301", "%GC": 52.0, "total_deduplicated_percentage": 9.118069602384407, "avg_sequence_length": 300.8209479018505, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "warn", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "ICFS2_R2": { "Filename": "ICFS2_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 172816.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "37-301", "%GC": 53.0, "total_deduplicated_percentage": 10.327168780668456, "avg_sequence_length": 300.86309138042776, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "warn", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "ICMS1_R2": { "Filename": "ICMS1_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 194877.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "35-301", "%GC": 53.0, "total_deduplicated_percentage": 6.30962094038804, "avg_sequence_length": 300.96351288248485, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "warn", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "ICMS2_R2": { "Filename": "ICMS2_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 125665.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "35-301", "%GC": 52.0, "total_deduplicated_percentage": 7.678351171766204, "avg_sequence_length": 300.95717582461305, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "warn", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "IPFS1_R2": { "Filename": "IPFS1_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 160962.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "42-301", "%GC": 53.0, "total_deduplicated_percentage": 6.039313626818752, "avg_sequence_length": 300.93989885811555, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "warn", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "IPFS2_R2": { "Filename": "IPFS2_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 224428.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "42-301", "%GC": 53.0, "total_deduplicated_percentage": 8.44056891296986, "avg_sequence_length": 300.9674349902864, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "warn", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "IPMS1_R2": { "Filename": "IPMS1_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 345759.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "40-301", "%GC": 52.0, "total_deduplicated_percentage": 5.933612718685558, "avg_sequence_length": 300.95055515546954, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "warn", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "IPMS2_R2": { "Filename": "IPMS2_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 244089.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "35-301", "%GC": 52.0, "total_deduplicated_percentage": 7.396072743958146, "avg_sequence_length": 300.96319375309827, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "warn", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "IVFS1_R2": { "Filename": "IVFS1_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 228943.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "51-301", "%GC": 52.0, "total_deduplicated_percentage": 5.169408979527655, "avg_sequence_length": 300.97923063819377, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "warn", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "IVFS2_R2": { "Filename": "IVFS2_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 127420.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "41-301", "%GC": 52.0, "total_deduplicated_percentage": 5.211112855124784, "avg_sequence_length": 300.87874352534925, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "warn", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "IVMS1_R2": { "Filename": "IVMS1_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 156119.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "37-301", "%GC": 51.0, "total_deduplicated_percentage": 8.68696314990488, "avg_sequence_length": 300.8512128568592, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "warn", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "IVMS2_R2": { "Filename": "IVMS2_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 109737.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "82-301", "%GC": 52.0, "total_deduplicated_percentage": 6.92291569844264, "avg_sequence_length": 300.9746029142404, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "warn", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "JAFS1_R2": { "Filename": "JAFS1_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 132370.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "38-301", "%GC": 54.0, "total_deduplicated_percentage": 5.2549671375689355, "avg_sequence_length": 300.96649542947796, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "JAFS2_R2": { "Filename": "JAFS2_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 84149.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "76-301", "%GC": 54.0, "total_deduplicated_percentage": 5.849148534147762, "avg_sequence_length": 300.9575752534195, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "JAMS1_R2": { "Filename": "JAMS1_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 163443.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "86-301", "%GC": 52.0, "total_deduplicated_percentage": 3.299621274695154, "avg_sequence_length": 300.97737437516446, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "JAMS2_R2": { "Filename": "JAMS2_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 147745.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "81-301", "%GC": 52.0, "total_deduplicated_percentage": 4.548377271650479, "avg_sequence_length": 300.9609936038445, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "JCFS1_R2": { "Filename": "JCFS1_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 188244.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "41-301", "%GC": 52.0, "total_deduplicated_percentage": 4.587662820594547, "avg_sequence_length": 300.93379337455644, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "warn", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "JCFS2_R2": { "Filename": "JCFS2_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 152204.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "38-301", "%GC": 52.0, "total_deduplicated_percentage": 4.8717510709311185, "avg_sequence_length": 300.9293809623926, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "warn", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "JCMS1_R2": { "Filename": "JCMS1_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 161387.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "35-301", "%GC": 52.0, "total_deduplicated_percentage": 6.249574005341199, "avg_sequence_length": 300.9415101588108, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "warn", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "JCMS2_R2": { "Filename": "JCMS2_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 127452.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "39-301", "%GC": 52.0, "total_deduplicated_percentage": 7.201926999968615, "avg_sequence_length": 300.9179808869221, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "warn", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "JPFS1_R2": { "Filename": "JPFS1_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 233623.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "111-301", "%GC": 52.0, "total_deduplicated_percentage": 3.9315478356155, "avg_sequence_length": 300.9850314395415, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "warn", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "JPFS2_R2": { "Filename": "JPFS2_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 201772.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "72-301", "%GC": 52.0, "total_deduplicated_percentage": 4.155680669270265, "avg_sequence_length": 300.9781188668398, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "warn", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "JPMS1_R2": { "Filename": "JPMS1_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 211303.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "71-301", "%GC": 52.0, "total_deduplicated_percentage": 5.744357628618619, "avg_sequence_length": 300.9699057751191, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "warn", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "JPMS2_R2": { "Filename": "JPMS2_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 134191.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "41-301", "%GC": 52.0, "total_deduplicated_percentage": 6.189684852188298, "avg_sequence_length": 300.93845712454635, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "warn", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "JVFS1_R2": { "Filename": "JVFS1_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 109795.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "37-301", "%GC": 52.0, "total_deduplicated_percentage": 5.859101051960472, "avg_sequence_length": 300.8708547748076, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "warn", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "JVFS2_R2": { "Filename": "JVFS2_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 150055.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "85-301", "%GC": 52.0, "total_deduplicated_percentage": 8.166339009030024, "avg_sequence_length": 300.97566225717236, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "warn", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "JVMS1_R2": { "Filename": "JVMS1_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 347311.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "37-301", "%GC": 52.0, "total_deduplicated_percentage": 5.281721569429129, "avg_sequence_length": 300.9159931588691, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "warn", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "JVMS2_R2": { "Filename": "JVMS2_R2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 117324.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "37-301", "%GC": 52.0, "total_deduplicated_percentage": 9.235109610991783, "avg_sequence_length": 300.9365901264873, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "warn", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" } }, "multiqc_general_stats": { "CAFS1_R2": { "fastqc-percent_duplicates": 93.9935708578086, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 300.98170683355596, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.163941 }, "CAFS2_R2": { "fastqc-percent_duplicates": 93.83468476796703, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 300.49557592245316, "fastqc-median_sequence_length": 300, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.151444 }, "CAMS1_R2": { "fastqc-percent_duplicates": 93.07651485256297, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 300.98525629686077, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.146978 }, "CAMS2_R2": { "fastqc-percent_duplicates": 93.5453208508196, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 300.9840022956347, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.167274 }, "CCFS1_R2": { "fastqc-percent_duplicates": 91.4041912989704, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 300.9598614591554, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.216687 }, "CCFS2_R2": { "fastqc-percent_duplicates": 91.08369991970403, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 300.9239651426854, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.20299899999999999 }, "CCMS1_R2": { "fastqc-percent_duplicates": 91.62817277013191, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 300.9792656793181, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.20998999999999998 }, "CCMS2_R2": { "fastqc-percent_duplicates": 91.58605140080132, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 300.9711867074948, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.196923 }, "CPFS1_R2": { "fastqc-percent_duplicates": 92.6099851705388, "fastqc-percent_gc": 54.0, "fastqc-avg_sequence_length": 300.9125796582544, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.149702 }, "CPFS2_R2": { "fastqc-percent_duplicates": 89.05866333318451, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 300.9520709629894, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.179192 }, "CPMS1_R2": { "fastqc-percent_duplicates": 91.90595899868994, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 300.9581843288602, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.22594399999999998 }, "CPMS2_R2": { "fastqc-percent_duplicates": 89.58183780405025, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 300.9623224287884, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.204777 }, "CVFS1_R2": { "fastqc-percent_duplicates": 91.72386760375932, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 300.9537538399832, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.21940199999999999 }, "CVFS2_R2": { "fastqc-percent_duplicates": 91.60386576246263, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 300.9737493832774, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.20673799999999998 }, "CVMS1_R2": { "fastqc-percent_duplicates": 91.62921838528828, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 300.96820804519973, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.183364 }, "CVMS2_R2": { "fastqc-percent_duplicates": 91.82807470823937, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 300.9711808368549, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.228355 }, "DAFS1_R2": { "fastqc-percent_duplicates": 92.35089358200158, "fastqc-percent_gc": 54.0, "fastqc-avg_sequence_length": 300.86612395600486, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.089919 }, "DAFS2_R2": { "fastqc-percent_duplicates": 88.77665245202559, "fastqc-percent_gc": 54.0, "fastqc-avg_sequence_length": 300.7293043710021, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.03752 }, "DAMS1_R2": { "fastqc-percent_duplicates": 93.18046081790463, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 300.8482067079496, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.063626 }, "DAMS2_R2": { "fastqc-percent_duplicates": 94.5173783392519, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 300.828301513258, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.080819 }, "DCFS1_R2": { "fastqc-percent_duplicates": 93.1682635901447, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 300.4593884434885, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.122736 }, "DCFS2_R2": { "fastqc-percent_duplicates": 91.24500245493442, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 299.3549624745739, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.071285 }, "DCMS1_R2": { "fastqc-percent_duplicates": 93.96430802841786, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 300.76969658100205, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.24167899999999998 }, "DCMS2_R2": { "fastqc-percent_duplicates": 91.52662922898908, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 299.3178575598985, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.094201 }, "DPFS1_R2": { "fastqc-percent_duplicates": 93.65234787754125, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 300.73026881190214, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.141958 }, "DPFS2_R2": { "fastqc-percent_duplicates": 92.59236830750831, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 299.78814521562066, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.132107 }, "DPMS1_R2": { "fastqc-percent_duplicates": 89.9747570210846, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 300.5195968440179, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.08200299999999999 }, "DPMS2_R2": { "fastqc-percent_duplicates": 89.88132273303376, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 300.61627491646504, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.08678999999999999 }, "DVFS1_R2": { "fastqc-percent_duplicates": 90.00138966092274, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 300.74170372429126, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.07196 }, "DVFS2_R2": { "fastqc-percent_duplicates": 91.34050687793149, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 300.18769953884356, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.10148399999999999 }, "DVMS1_R2": { "fastqc-percent_duplicates": 89.90286930465034, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 300.62909157778597, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.16585899999999998 }, "DVMS2_R2": { "fastqc-percent_duplicates": 90.97101062343613, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 300.62397630681926, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.16105899999999998 }, "IAFS1_R2": { "fastqc-percent_duplicates": 96.24214199730062, "fastqc-percent_gc": 54.0, "fastqc-avg_sequence_length": 300.98554857066426, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.164482 }, "IAFS2_R2": { "fastqc-percent_duplicates": 96.22256133348985, "fastqc-percent_gc": 55.0, "fastqc-avg_sequence_length": 300.98801893806, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.12778499999999998 }, "IAMS1_R2": { "fastqc-percent_duplicates": 95.84525143346734, "fastqc-percent_gc": 54.0, "fastqc-avg_sequence_length": 300.9804521188954, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.15173 }, "IAMS2_R2": { "fastqc-percent_duplicates": 94.52770104105542, "fastqc-percent_gc": 54.0, "fastqc-avg_sequence_length": 300.97673943285884, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.151673 }, "ICFS1_R2": { "fastqc-percent_duplicates": 90.88193039761559, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 300.8209479018505, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.139909 }, "ICFS2_R2": { "fastqc-percent_duplicates": 89.67283121933154, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 300.86309138042776, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.172816 }, "ICMS1_R2": { "fastqc-percent_duplicates": 93.69037905961196, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 300.96351288248485, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.194877 }, "ICMS2_R2": { "fastqc-percent_duplicates": 92.32164882823379, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 300.95717582461305, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.125665 }, "IPFS1_R2": { "fastqc-percent_duplicates": 93.96068637318125, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 300.93989885811555, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.160962 }, "IPFS2_R2": { "fastqc-percent_duplicates": 91.55943108703013, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 300.9674349902864, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.224428 }, "IPMS1_R2": { "fastqc-percent_duplicates": 94.06638728131445, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 300.95055515546954, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.345759 }, "IPMS2_R2": { "fastqc-percent_duplicates": 92.60392725604186, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 300.96319375309827, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.244089 }, "IVFS1_R2": { "fastqc-percent_duplicates": 94.83059102047234, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 300.97923063819377, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.22894299999999998 }, "IVFS2_R2": { "fastqc-percent_duplicates": 94.78888714487522, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 300.87874352534925, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.12742 }, "IVMS1_R2": { "fastqc-percent_duplicates": 91.31303685009512, "fastqc-percent_gc": 51.0, "fastqc-avg_sequence_length": 300.8512128568592, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.15611899999999998 }, "IVMS2_R2": { "fastqc-percent_duplicates": 93.07708430155736, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 300.9746029142404, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.109737 }, "JAFS1_R2": { "fastqc-percent_duplicates": 94.74503286243106, "fastqc-percent_gc": 54.0, "fastqc-avg_sequence_length": 300.96649542947796, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.13237 }, "JAFS2_R2": { "fastqc-percent_duplicates": 94.15085146585224, "fastqc-percent_gc": 54.0, "fastqc-avg_sequence_length": 300.9575752534195, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.084149 }, "JAMS1_R2": { "fastqc-percent_duplicates": 96.70037872530484, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 300.97737437516446, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.163443 }, "JAMS2_R2": { "fastqc-percent_duplicates": 95.45162272834952, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 300.9609936038445, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.147745 }, "JCFS1_R2": { "fastqc-percent_duplicates": 95.41233717940545, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 300.93379337455644, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.188244 }, "JCFS2_R2": { "fastqc-percent_duplicates": 95.12824892906889, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 300.9293809623926, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.152204 }, "JCMS1_R2": { "fastqc-percent_duplicates": 93.7504259946588, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 300.9415101588108, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.161387 }, "JCMS2_R2": { "fastqc-percent_duplicates": 92.79807300003138, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 300.9179808869221, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.12745199999999998 }, "JPFS1_R2": { "fastqc-percent_duplicates": 96.0684521643845, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 300.9850314395415, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.233623 }, "JPFS2_R2": { "fastqc-percent_duplicates": 95.84431933072973, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 300.9781188668398, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.20177199999999998 }, "JPMS1_R2": { "fastqc-percent_duplicates": 94.25564237138138, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 300.9699057751191, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.211303 }, "JPMS2_R2": { "fastqc-percent_duplicates": 93.8103151478117, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 300.93845712454635, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.134191 }, "JVFS1_R2": { "fastqc-percent_duplicates": 94.14089894803953, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 300.8708547748076, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.10979499999999999 }, "JVFS2_R2": { "fastqc-percent_duplicates": 91.83366099096997, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 300.97566225717236, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.150055 }, "JVMS1_R2": { "fastqc-percent_duplicates": 94.71827843057088, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 300.9159931588691, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.347311 }, "JVMS2_R2": { "fastqc-percent_duplicates": 90.76489038900822, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 300.9365901264873, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.117324 } } }, "config_analysis_dir_abs": [ "/data/MicrobiomaFrangos/output/fastqc/pre/R2.txt" ], "config_analysis_dir": [ "/data/MicrobiomaFrangos/output/fastqc/pre/R2.txt" ], "config_creation_date": "2024-11-01, 18:48 -03", "config_git_hash": null, "config_intro_text": null, "config_report_comment": null, "config_report_header_info": null, "config_script_path": "/usr/local/bioinfo/anaconda3/lib/python3.9/site-packages/multiqc", "config_short_version": "1.25.1", "config_subtitle": null, "config_title": "Pre-processing reads (R2)", "config_version": "1.25.1", "config_output_dir": "/srv/data/MicrobiomaFrangos/output/fastqc/pre" }