{ "report_data_sources": { "FastQC": { "all_sections": { "CAFS1_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/CAFS1_R1_fastqc.zip", "CAFS2_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/CAFS2_R1_fastqc.zip", "CAMS1_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/CAMS1_R1_fastqc.zip", "CAMS2_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/CAMS2_R1_fastqc.zip", "CCFS1_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/CCFS1_R1_fastqc.zip", "CCFS2_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/CCFS2_R1_fastqc.zip", "CCMS1_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/CCMS1_R1_fastqc.zip", "CCMS2_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/CCMS2_R1_fastqc.zip", "CPFS1_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/CPFS1_R1_fastqc.zip", "CPFS2_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/CPFS2_R1_fastqc.zip", "CPMS1_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/CPMS1_R1_fastqc.zip", "CPMS2_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/CPMS2_R1_fastqc.zip", "CVFS1_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/CVFS1_R1_fastqc.zip", "CVFS2_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/CVFS2_R1_fastqc.zip", "CVMS1_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/CVMS1_R1_fastqc.zip", "CVMS2_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/CVMS2_R1_fastqc.zip", "DAFS1_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/DAFS1_R1_fastqc.zip", "DAFS2_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/DAFS2_R1_fastqc.zip", "DAMS1_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/DAMS1_R1_fastqc.zip", "DAMS2_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/DAMS2_R1_fastqc.zip", "DCFS1_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/DCFS1_R1_fastqc.zip", "DCFS2_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/DCFS2_R1_fastqc.zip", "DCMS1_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/DCMS1_R1_fastqc.zip", "DCMS2_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/DCMS2_R1_fastqc.zip", "DPFS1_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/DPFS1_R1_fastqc.zip", "DPFS2_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/DPFS2_R1_fastqc.zip", "DPMS1_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/DPMS1_R1_fastqc.zip", "DPMS2_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/DPMS2_R1_fastqc.zip", "DVFS1_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/DVFS1_R1_fastqc.zip", "DVFS2_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/DVFS2_R1_fastqc.zip", "DVMS1_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/DVMS1_R1_fastqc.zip", "DVMS2_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/DVMS2_R1_fastqc.zip", "IAFS1_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/IAFS1_R1_fastqc.zip", "IAFS2_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/IAFS2_R1_fastqc.zip", "IAMS1_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/IAMS1_R1_fastqc.zip", "IAMS2_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/IAMS2_R1_fastqc.zip", "ICFS1_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/ICFS1_R1_fastqc.zip", "ICFS2_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/ICFS2_R1_fastqc.zip", "ICMS1_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/ICMS1_R1_fastqc.zip", "ICMS2_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/ICMS2_R1_fastqc.zip", "IPFS1_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/IPFS1_R1_fastqc.zip", "IPFS2_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/IPFS2_R1_fastqc.zip", "IPMS1_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/IPMS1_R1_fastqc.zip", "IPMS2_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/IPMS2_R1_fastqc.zip", "IVFS1_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/IVFS1_R1_fastqc.zip", "IVFS2_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/IVFS2_R1_fastqc.zip", "IVMS1_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/IVMS1_R1_fastqc.zip", "IVMS2_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/IVMS2_R1_fastqc.zip", "JAFS1_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/JAFS1_R1_fastqc.zip", "JAFS2_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/JAFS2_R1_fastqc.zip", "JAMS1_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/JAMS1_R1_fastqc.zip", "JAMS2_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/JAMS2_R1_fastqc.zip", "JCFS1_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/JCFS1_R1_fastqc.zip", "JCFS2_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/JCFS2_R1_fastqc.zip", "JCMS1_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/JCMS1_R1_fastqc.zip", "JCMS2_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/JCMS2_R1_fastqc.zip", "JPFS1_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/JPFS1_R1_fastqc.zip", "JPFS2_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/JPFS2_R1_fastqc.zip", "JPMS1_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/JPMS1_R1_fastqc.zip", "JPMS2_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/JPMS2_R1_fastqc.zip", "JVFS1_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/JVFS1_R1_fastqc.zip", "JVFS2_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/JVFS2_R1_fastqc.zip", "JVMS1_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/JVMS1_R1_fastqc.zip", "JVMS2_R1": "/data/MicrobiomaFrangos/output/fastqc/pre/JVMS2_R1_fastqc.zip" } } }, "report_general_stats_data": [ { "CAFS1_R1": { "total_sequences": 163941.0, "percent_gc": 54.0, "avg_sequence_length": 300.98912108624444, "median_sequence_length": 301, "percent_duplicates": 95.6209855984775, "percent_fails": 36.36363636363637 }, "CAFS2_R1": { "total_sequences": 151444.0, "percent_gc": 53.0, "avg_sequence_length": 300.49757005889967, "median_sequence_length": 300, "percent_duplicates": 95.38179128918941, "percent_fails": 36.36363636363637 }, "CAMS1_R1": { "total_sequences": 146978.0, "percent_gc": 53.0, "avg_sequence_length": 300.9908353631156, "median_sequence_length": 301, "percent_duplicates": 95.36257126916954, "percent_fails": 36.36363636363637 }, "CAMS2_R1": { "total_sequences": 167274.0, "percent_gc": 53.0, "avg_sequence_length": 300.98940062412566, "median_sequence_length": 301, "percent_duplicates": 95.7225868933606, "percent_fails": 36.36363636363637 }, "CCFS1_R1": { "total_sequences": 216687.0, "percent_gc": 53.0, "avg_sequence_length": 300.96590935312224, "median_sequence_length": 301, "percent_duplicates": 93.88749671184704, "percent_fails": 36.36363636363637 }, "CCFS2_R1": { "total_sequences": 202999.0, "percent_gc": 53.0, "avg_sequence_length": 300.92754644111545, "median_sequence_length": 301, "percent_duplicates": 93.43198734969138, "percent_fails": 36.36363636363637 }, "CCMS1_R1": { "total_sequences": 209990.0, "percent_gc": 53.0, "avg_sequence_length": 300.9813800657174, "median_sequence_length": 301, "percent_duplicates": 93.73970189056621, "percent_fails": 36.36363636363637 }, "CCMS2_R1": { "total_sequences": 196923.0, "percent_gc": 53.0, "avg_sequence_length": 300.973304286447, "median_sequence_length": 301, "percent_duplicates": 93.68179440695094, "percent_fails": 36.36363636363637 }, "CPFS1_R1": { "total_sequences": 149702.0, "percent_gc": 53.0, "avg_sequence_length": 300.8958597747525, "median_sequence_length": 301, "percent_duplicates": 94.83240036873255, "percent_fails": 36.36363636363637 }, "CPFS2_R1": { "total_sequences": 179192.0, "percent_gc": 53.0, "avg_sequence_length": 300.9559969195053, "median_sequence_length": 301, "percent_duplicates": 93.12022858163311, "percent_fails": 27.27272727272727 }, "CPMS1_R1": { "total_sequences": 225944.0, "percent_gc": 53.0, "avg_sequence_length": 300.95744078178666, "median_sequence_length": 301, "percent_duplicates": 93.68516092483094, "percent_fails": 36.36363636363637 }, "CPMS2_R1": { "total_sequences": 204777.0, "percent_gc": 53.0, "avg_sequence_length": 300.96786016007655, "median_sequence_length": 301, "percent_duplicates": 93.74490299203524, "percent_fails": 36.36363636363637 }, "CVFS1_R1": { "total_sequences": 219402.0, "percent_gc": 53.0, "avg_sequence_length": 300.95555874604605, "median_sequence_length": 301, "percent_duplicates": 93.72293780366633, "percent_fails": 36.36363636363637 }, "CVFS2_R1": { "total_sequences": 206738.0, "percent_gc": 53.0, "avg_sequence_length": 300.97790681925915, "median_sequence_length": 301, "percent_duplicates": 93.75779972719094, "percent_fails": 36.36363636363637 }, "CVMS1_R1": { "total_sequences": 183364.0, "percent_gc": 52.0, "avg_sequence_length": 300.9705258393142, "median_sequence_length": 301, "percent_duplicates": 93.97809820902685, "percent_fails": 36.36363636363637 }, "CVMS2_R1": { "total_sequences": 228355.0, "percent_gc": 52.0, "avg_sequence_length": 300.9735849882858, "median_sequence_length": 301, "percent_duplicates": 94.05224321779686, "percent_fails": 36.36363636363637 }, "DAFS1_R1": { "total_sequences": 89919.0, "percent_gc": 54.0, "avg_sequence_length": 300.86233165404417, "median_sequence_length": 301, "percent_duplicates": 94.36826477162779, "percent_fails": 36.36363636363637 }, "DAFS2_R1": { "total_sequences": 37520.0, "percent_gc": 53.0, "avg_sequence_length": 300.6738272921109, "median_sequence_length": 301, "percent_duplicates": 91.30863539445629, "percent_fails": 36.36363636363637 }, "DAMS1_R1": { "total_sequences": 63626.0, "percent_gc": 50.0, "avg_sequence_length": 300.83824222801996, "median_sequence_length": 301, "percent_duplicates": 95.0696256247446, "percent_fails": 36.36363636363637 }, "DAMS2_R1": { "total_sequences": 80819.0, "percent_gc": 50.0, "avg_sequence_length": 300.818681250696, "median_sequence_length": 301, "percent_duplicates": 96.35605488808325, "percent_fails": 36.36363636363637 }, "DCFS1_R1": { "total_sequences": 122736.0, "percent_gc": 51.0, "avg_sequence_length": 300.4278003193847, "median_sequence_length": 301, "percent_duplicates": 94.17530308955807, "percent_fails": 36.36363636363637 }, "DCFS2_R1": { "total_sequences": 71285.0, "percent_gc": 51.0, "avg_sequence_length": 299.3111383881602, "median_sequence_length": 301, "percent_duplicates": 91.76124009258609, "percent_fails": 36.36363636363637 }, "DCMS1_R1": { "total_sequences": 241679.0, "percent_gc": 52.0, "avg_sequence_length": 300.75027826166115, "median_sequence_length": 301, "percent_duplicates": 95.2101754806996, "percent_fails": 36.36363636363637 }, "DCMS2_R1": { "total_sequences": 94201.0, "percent_gc": 51.0, "avg_sequence_length": 299.26231144043055, "median_sequence_length": 301, "percent_duplicates": 92.01813144234137, "percent_fails": 36.36363636363637 }, "DPFS1_R1": { "total_sequences": 141958.0, "percent_gc": 52.0, "avg_sequence_length": 300.6953324222657, "median_sequence_length": 301, "percent_duplicates": 94.53711661195565, "percent_fails": 36.36363636363637 }, "DPFS2_R1": { "total_sequences": 132107.0, "percent_gc": 51.0, "avg_sequence_length": 299.76268479338717, "median_sequence_length": 301, "percent_duplicates": 93.55219632570568, "percent_fails": 36.36363636363637 }, "DPMS1_R1": { "total_sequences": 82003.0, "percent_gc": 52.0, "avg_sequence_length": 300.5020548028731, "median_sequence_length": 301, "percent_duplicates": 91.64054973598527, "percent_fails": 36.36363636363637 }, "DPMS2_R1": { "total_sequences": 86790.0, "percent_gc": 51.0, "avg_sequence_length": 300.60624495909667, "median_sequence_length": 301, "percent_duplicates": 91.30775434957944, "percent_fails": 36.36363636363637 }, "DVFS1_R1": { "total_sequences": 71960.0, "percent_gc": 51.0, "avg_sequence_length": 300.7119302390217, "median_sequence_length": 301, "percent_duplicates": 91.57170650361311, "percent_fails": 36.36363636363637 }, "DVFS2_R1": { "total_sequences": 101484.0, "percent_gc": 51.0, "avg_sequence_length": 300.13608056442393, "median_sequence_length": 301, "percent_duplicates": 92.38402112648299, "percent_fails": 36.36363636363637 }, "DVMS1_R1": { "total_sequences": 165859.0, "percent_gc": 52.0, "avg_sequence_length": 300.6154806190801, "median_sequence_length": 301, "percent_duplicates": 92.25305832062173, "percent_fails": 36.36363636363637 }, "DVMS2_R1": { "total_sequences": 161059.0, "percent_gc": 52.0, "avg_sequence_length": 300.61822065205916, "median_sequence_length": 301, "percent_duplicates": 92.79270329506578, "percent_fails": 36.36363636363637 }, "IAFS1_R1": { "total_sequences": 164482.0, "percent_gc": 54.0, "avg_sequence_length": 300.98650916209675, "median_sequence_length": 301, "percent_duplicates": 97.81860629126591, "percent_fails": 36.36363636363637 }, "IAFS2_R1": { "total_sequences": 127785.0, "percent_gc": 54.0, "avg_sequence_length": 300.98274445357436, "median_sequence_length": 301, "percent_duplicates": 97.62100403020699, "percent_fails": 36.36363636363637 }, "IAMS1_R1": { "total_sequences": 151730.0, "percent_gc": 54.0, "avg_sequence_length": 300.9770711131615, "median_sequence_length": 301, "percent_duplicates": 97.57068476899757, "percent_fails": 36.36363636363637 }, "IAMS2_R1": { "total_sequences": 151673.0, "percent_gc": 54.0, "avg_sequence_length": 300.97739215285515, "median_sequence_length": 301, "percent_duplicates": 96.21356470828691, "percent_fails": 36.36363636363637 }, "ICFS1_R1": { "total_sequences": 139909.0, "percent_gc": 52.0, "avg_sequence_length": 300.8100908447634, "median_sequence_length": 301, "percent_duplicates": 93.129820097349, "percent_fails": 36.36363636363637 }, "ICFS2_R1": { "total_sequences": 172816.0, "percent_gc": 53.0, "avg_sequence_length": 300.8646797750208, "median_sequence_length": 301, "percent_duplicates": 92.59269975002314, "percent_fails": 36.36363636363637 }, "ICMS1_R1": { "total_sequences": 194877.0, "percent_gc": 53.0, "avg_sequence_length": 300.9421917414574, "median_sequence_length": 301, "percent_duplicates": 95.9035699441186, "percent_fails": 36.36363636363637 }, "ICMS2_R1": { "total_sequences": 125665.0, "percent_gc": 54.0, "avg_sequence_length": 300.95274738391754, "median_sequence_length": 301, "percent_duplicates": 95.04396610034615, "percent_fails": 36.36363636363637 }, "IPFS1_R1": { "total_sequences": 160962.0, "percent_gc": 52.0, "avg_sequence_length": 300.9171978479393, "median_sequence_length": 301, "percent_duplicates": 95.75862625961408, "percent_fails": 36.36363636363637 }, "IPFS2_R1": { "total_sequences": 224428.0, "percent_gc": 53.0, "avg_sequence_length": 300.9690279287789, "median_sequence_length": 301, "percent_duplicates": 93.79310959416829, "percent_fails": 27.27272727272727 }, "IPMS1_R1": { "total_sequences": 345759.0, "percent_gc": 54.0, "avg_sequence_length": 300.95856073160786, "median_sequence_length": 301, "percent_duplicates": 96.4084810518309, "percent_fails": 36.36363636363637 }, "IPMS2_R1": { "total_sequences": 244089.0, "percent_gc": 53.0, "avg_sequence_length": 300.95523354186383, "median_sequence_length": 301, "percent_duplicates": 95.10096727013507, "percent_fails": 27.27272727272727 }, "IVFS1_R1": { "total_sequences": 228943.0, "percent_gc": 54.0, "avg_sequence_length": 300.9764570220535, "median_sequence_length": 301, "percent_duplicates": 96.65768335349847, "percent_fails": 36.36363636363637 }, "IVFS2_R1": { "total_sequences": 127420.0, "percent_gc": 51.0, "avg_sequence_length": 300.85812666771307, "median_sequence_length": 301, "percent_duplicates": 96.26510751844295, "percent_fails": 36.36363636363637 }, "IVMS1_R1": { "total_sequences": 156119.0, "percent_gc": 52.0, "avg_sequence_length": 300.84647928823523, "median_sequence_length": 301, "percent_duplicates": 94.1352429877209, "percent_fails": 36.36363636363637 }, "IVMS2_R1": { "total_sequences": 109737.0, "percent_gc": 51.0, "avg_sequence_length": 300.9528053436854, "median_sequence_length": 301, "percent_duplicates": 95.14840026609075, "percent_fails": 36.36363636363637 }, "JAFS1_R1": { "total_sequences": 132370.0, "percent_gc": 53.0, "avg_sequence_length": 300.9448402205938, "median_sequence_length": 301, "percent_duplicates": 96.21137720027197, "percent_fails": 36.36363636363637 }, "JAFS2_R1": { "total_sequences": 84149.0, "percent_gc": 53.0, "avg_sequence_length": 300.9482346789623, "median_sequence_length": 301, "percent_duplicates": 95.54718416142795, "percent_fails": 36.36363636363637 }, "JAMS1_R1": { "total_sequences": 163443.0, "percent_gc": 50.0, "avg_sequence_length": 300.96827028382984, "median_sequence_length": 301, "percent_duplicates": 97.99869067503656, "percent_fails": 36.36363636363637 }, "JAMS2_R1": { "total_sequences": 147745.0, "percent_gc": 50.0, "avg_sequence_length": 300.94705066161293, "median_sequence_length": 301, "percent_duplicates": 96.84320958408068, "percent_fails": 36.36363636363637 }, "JCFS1_R1": { "total_sequences": 188244.0, "percent_gc": 51.0, "avg_sequence_length": 300.91172892628714, "median_sequence_length": 301, "percent_duplicates": 97.08729096279298, "percent_fails": 36.36363636363637 }, "JCFS2_R1": { "total_sequences": 152204.0, "percent_gc": 51.0, "avg_sequence_length": 300.9076601140574, "median_sequence_length": 301, "percent_duplicates": 96.70245197235289, "percent_fails": 36.36363636363637 }, "JCMS1_R1": { "total_sequences": 161387.0, "percent_gc": 52.0, "avg_sequence_length": 300.9189711686815, "median_sequence_length": 301, "percent_duplicates": 95.55912186235571, "percent_fails": 36.36363636363637 }, "JCMS2_R1": { "total_sequences": 127452.0, "percent_gc": 52.0, "avg_sequence_length": 300.8786602014876, "median_sequence_length": 301, "percent_duplicates": 94.02598625364843, "percent_fails": 36.36363636363637 }, "JPFS1_R1": { "total_sequences": 233623.0, "percent_gc": 51.0, "avg_sequence_length": 300.9633726131417, "median_sequence_length": 301, "percent_duplicates": 97.49040120193645, "percent_fails": 36.36363636363637 }, "JPFS2_R1": { "total_sequences": 201772.0, "percent_gc": 51.0, "avg_sequence_length": 300.9524017207541, "median_sequence_length": 301, "percent_duplicates": 96.96984715421367, "percent_fails": 36.36363636363637 }, "JPMS1_R1": { "total_sequences": 211303.0, "percent_gc": 51.0, "avg_sequence_length": 300.9438105469397, "median_sequence_length": 301, "percent_duplicates": 95.1160182297459, "percent_fails": 36.36363636363637 }, "JPMS2_R1": { "total_sequences": 134191.0, "percent_gc": 51.0, "avg_sequence_length": 300.91419320222667, "median_sequence_length": 301, "percent_duplicates": 94.45268311585725, "percent_fails": 36.36363636363637 }, "JVFS1_R1": { "total_sequences": 109795.0, "percent_gc": 51.0, "avg_sequence_length": 300.854879548249, "median_sequence_length": 301, "percent_duplicates": 95.5890523247871, "percent_fails": 36.36363636363637 }, "JVFS2_R1": { "total_sequences": 150055.0, "percent_gc": 54.0, "avg_sequence_length": 300.97411615740896, "median_sequence_length": 301, "percent_duplicates": 95.45566625570623, "percent_fails": 36.36363636363637 }, "JVMS1_R1": { "total_sequences": 347311.0, "percent_gc": 52.0, "avg_sequence_length": 300.8928481965731, "median_sequence_length": 301, "percent_duplicates": 96.57108470506262, "percent_fails": 36.36363636363637 }, "JVMS2_R1": { "total_sequences": 117324.0, "percent_gc": 52.0, "avg_sequence_length": 300.894054072483, "median_sequence_length": 301, "percent_duplicates": 94.15209164365348, "percent_fails": 36.36363636363637 } } ], "report_general_stats_headers": [ { "percent_duplicates": { "title": "Dups", "description": "% duplicate reads", "max": 100, "min": 0, "suffix": "%", "scale": "RdYlGn-rev", "namespace": "FastQC", "rid": "fastqc-percent_duplicates", "placement": 1000 }, "percent_gc": { "title": "GC", "description": "Average % GC content", "max": 100, "min": 0, "suffix": "%", "scale": "PuRd", "format": "{:,.1f}", "namespace": "FastQC", "rid": "fastqc-percent_gc", "placement": 1000 }, "avg_sequence_length": { "title": "Avg len", "description": "Average read length", "min": 0, "suffix": " bp", "scale": "RdYlGn", "format": "{:,.0f}", "hidden": true, "namespace": "FastQC", "rid": "fastqc-avg_sequence_length", "placement": 1000 }, "median_sequence_length": { "title": "Median len", "description": "Median read length", "min": 0, "suffix": " bp", "scale": "RdYlGn", "format": "{:,.0f}", "hidden": true, "namespace": "FastQC", "rid": "fastqc-median_sequence_length", "placement": 1000 }, "percent_fails": { "title": "Failed", "description": "Percentage of modules failed in FastQC report (includes those not plotted here)", "max": 100, "min": 0, "suffix": "%", "scale": "Reds", "format": "{:,.0f}", "hidden": true, "namespace": "FastQC", "rid": "fastqc-percent_fails", "placement": 1000 }, "total_sequences": { "title": "Seqs", "description": "Total sequences (millions)", "min": 0, "scale": "Blues", "suffix": "M", "modify": null, "namespace": "FastQC", "rid": "fastqc-total_sequences", "placement": 1000 } } ], "report_multiqc_command": "/usr/local/bioinfo/anaconda3/bin/multiqc --title Pre-processing reads (R1) --file-list /data/MicrobiomaFrangos/output/fastqc/pre/R1.txt -o /data/MicrobiomaFrangos/output/fastqc/pre", "report_plot_data": { "fastqc_sequence_counts_plot": { "id": "fastqc_sequence_counts_plot", "anchor": "fastqc_sequence_counts_plot", "plot_type": "bar_graph", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 800, "hoverlabel": { "namelength": -1, "bgcolor": "rgba(255, 255, 255, 0.8)", "font": { "color": "black" } }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "white", "plot_bgcolor": "white", "showlegend": true, "title": { "font": { "size": 20 }, "text": "FastQC: Sequence Counts", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)", "showgrid": false, "categoryorder": "trace", "type": "category" }, "barmode": "relative", "bargroupgap": 0, "bargap": 0.2, "legend": { "tracegroupgap": 0, "traceorder": "normal" }, "hovermode": "y unified" }, "datasets": [ { "plot_id": "fastqc_sequence_counts_plot", "label": "1", "uid": "fastqc_sequence_counts_plot", "dconfig": { "title": "FastQC: Sequence Counts
64 samples" }, "layout": { "title": { "text": "FastQC: Sequence Counts
64 samples" }, "xaxis": { "title": { "text": "Number of reads" }, "hoverformat": ",.2f", "ticksuffix": "", "autorangeoptions": { "minallowed": 0, "maxallowed": 347311.0 } }, "yaxis": { "title": null, "hoverformat": null, "ticksuffix": "" }, "showlegend": true }, "trace_params": { "hovertemplate": "%{meta}: %{x}", "orientation": "h", "marker": { "line": { "width": 0 } }, "textposition": "inside", "insidetextanchor": "start" }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "n_samples": 64, "cats": [ { "name": "Unique Reads", "color": "124,181,236", "data": [ 6861.0, 11909.0, 6820.0, 4843.0, 7444.0, 10321.0, 6114.0, 5863.0, 7614.0, 7167.0, 5019.0, 5483.0, 4664.0, 3271.0, 3747.0, 5015.0, 5324.0, 9156.0, 4759.0, 7652.0, 11958.0, 12418.0, 13930.0, 6827.0, 6228.0, 7983.0, 12801.0, 9612.0, 5743.0, 3686.0, 3040.0, 3588.0, 11608.0, 12849.0, 7729.0, 6065.0, 7544.0, 6855.0, 8518.0, 7755.0, 7520.0, 11577.0, 5873.0, 7149.0, 2945.0, 3137.0, 3261.0, 5064.0, 13582.0, 11042.0, 12905.0, 13772.0, 12809.0, 14268.0, 12328.0, 7736.0, 12442.0, 13147.0, 13333.0, 13245.0, 7155.0, 6816.0, 6994.0, 7179.0 ], "data_pct": [ 5.847908356346528, 3.42891529493739, 4.545000166605577, 4.410947675212896, 5.547316884142751, 4.884455024301595, 3.030152845786333, 2.509598798063547, 5.9740137463515675, 4.4408781376442965, 3.297548027647105, 2.9127090372070294, 3.1567904159193203, 2.001309324963443, 4.452815838572056, 3.788622799728035, 4.851599733909255, 5.864757012279095, 3.7348924815570554, 3.342316646501531, 4.899032729864927, 3.5915189481691008, 6.2068904058317145, 4.24137374038593, 4.956033899653842, 4.0964300558814015, 7.4073002499768545, 6.870179902651009, 3.7864352917130932, 2.429315231002439, 2.3789959697930114, 2.1813937087340864, 7.207296704934217, 7.746941679378268, 7.615978873517007, 8.428293496386882, 8.692245650420555, 8.35945026401473, 6.447803674294322, 5.462883388044351, 7.982930117514677, 4.790238291287204, 8.238759907413902, 5.824696910441924, 3.643945111916752, 4.930374375255399, 8.69136460554371, 5.631735228372202, 5.9477567822031485, 6.021901790973146, 6.242200272809063, 6.27706219633367, 6.255097007964762, 6.314839075169068, 6.879771418366891, 5.167599631267452, 6.31820559304906, 6.26077432258679, 6.568012650308622, 6.112503288152958, 4.277413106639406, 4.6374287308304645, 4.618208710810596, 4.379014401522499 ] }, { "name": "Duplicate Reads", "color": "67,67,72", "data": [ 110463.0, 335402.0, 143235.0, 104952.0, 126747.0, 200982.0, 195658.0, 227760.0, 119838.0, 154220.0, 147185.0, 182761.0, 143081.0, 160172.0, 80402.0, 127355.0, 104413.0, 146963.0, 122661.0, 221291.0, 232131.0, 333341.0, 210498.0, 154135.0, 119437.0, 186894.0, 160015.0, 130297.0, 145930.0, 148044.0, 124745.0, 160894.0, 149451.0, 153010.0, 93755.0, 65895.0, 79246.0, 75148.0, 123589.0, 134203.0, 86681.0, 230102.0, 65412.0, 115587.0, 77874.0, 60489.0, 34259.0, 84855.0, 214773.0, 172322.0, 193833.0, 205630.0, 191968.0, 211676.0, 166864.0, 141966.0, 184481.0, 196843.0, 189666.0, 203442.0, 160119.0, 140162.0, 144450.0, 156762.0 ], "data_pct": [ 94.15209164365346, 96.5710847050626, 95.45499983339442, 95.5890523247871, 94.45268311585725, 95.11554497569841, 96.96984715421367, 97.49040120193645, 94.02598625364843, 95.5591218623557, 96.7024519723529, 97.08729096279298, 96.84320958408068, 97.99869067503656, 95.54718416142795, 96.21137720027197, 95.14840026609075, 94.1352429877209, 96.26510751844295, 96.65768335349847, 95.10096727013507, 96.40848105183089, 93.79310959416829, 95.75862625961406, 95.04396610034615, 95.9035699441186, 92.59269975002314, 93.129820097349, 96.2135647082869, 97.57068476899757, 97.62100403020699, 97.81860629126591, 92.79270329506578, 92.25305832062173, 92.38402112648299, 91.57170650361311, 91.30775434957944, 91.64054973598526, 93.55219632570568, 94.53711661195565, 92.01706988248533, 95.20976170871279, 91.76124009258609, 94.17530308955807, 96.35605488808324, 95.0696256247446, 91.30863539445629, 94.36826477162779, 94.05224321779684, 93.97809820902685, 93.75779972719094, 93.72293780366633, 93.74490299203524, 93.68516092483094, 93.12022858163311, 94.83240036873255, 93.68179440695094, 93.7392256774132, 93.43198734969138, 93.88749671184704, 95.7225868933606, 95.36257126916954, 95.3817912891894, 95.6209855984775 ] } ], "samples": [ "JVMS2_R1", "JVMS1_R1", "JVFS2_R1", "JVFS1_R1", "JPMS2_R1", "JPMS1_R1", "JPFS2_R1", "JPFS1_R1", "JCMS2_R1", "JCMS1_R1", "JCFS2_R1", "JCFS1_R1", "JAMS2_R1", "JAMS1_R1", "JAFS2_R1", "JAFS1_R1", "IVMS2_R1", "IVMS1_R1", "IVFS2_R1", "IVFS1_R1", "IPMS2_R1", "IPMS1_R1", "IPFS2_R1", "IPFS1_R1", "ICMS2_R1", "ICMS1_R1", "ICFS2_R1", "ICFS1_R1", "IAMS2_R1", "IAMS1_R1", "IAFS2_R1", "IAFS1_R1", "DVMS2_R1", "DVMS1_R1", "DVFS2_R1", "DVFS1_R1", "DPMS2_R1", "DPMS1_R1", "DPFS2_R1", "DPFS1_R1", "DCMS2_R1", "DCMS1_R1", "DCFS2_R1", "DCFS1_R1", "DAMS2_R1", "DAMS1_R1", "DAFS2_R1", "DAFS1_R1", "CVMS2_R1", "CVMS1_R1", "CVFS2_R1", "CVFS1_R1", "CPMS2_R1", "CPMS1_R1", "CPFS2_R1", "CPFS1_R1", "CCMS2_R1", "CCMS1_R1", "CCFS2_R1", "CCFS1_R1", "CAMS2_R1", "CAMS1_R1", "CAFS2_R1", "CAFS1_R1" ] } ], "pconfig": { "id": "fastqc_sequence_counts_plot", "title": "FastQC: Sequence Counts", "anchor": null, "table_title": null, "height": null, "width": null, "square": false, "logswitch": false, "logswitch_active": false, "logswitch_label": "Log10", "cpswitch": true, "cpswitch_c_active": true, "cpswitch_counts_label": "Number of reads", "cpswitch_percent_label": "Percentages", "xLog": null, "yLog": null, "xlog": false, "ylog": false, "data_labels": [], "xTitle": null, "yTitle": null, "xlab": null, "ylab": "Number of reads", "xsuffix": null, "ysuffix": null, "tt_suffix": null, "xLabFormat": null, "yLabFormat": null, "xLabelFormat": null, "yLabelFormat": null, "xlab_format": null, "ylab_format": null, "tt_label": null, "xDecimals": null, "yDecimals": null, "decimalPlaces": null, "x_decimals": null, "y_decimals": null, "tt_decimals": null, "xmin": null, "xmax": null, "ymin": null, "ymax": null, "xFloor": null, "xCeiling": null, "yFloor": null, "yCeiling": null, "x_clipmin": null, "x_clipmax": null, "y_clipmin": null, "y_clipmax": null, "save_data_file": true, "showlegend": null, "xMinRange": null, "yMinRange": null, "x_minrange": null, "y_minrange": null, "xPlotBands": null, "yPlotBands": null, "xPlotLines": null, "yPlotLines": null, "x_bands": null, "y_bands": null, "x_lines": null, "y_lines": null, "stacking": "relative", "hide_zero_cats": true, "sort_samples": true, "use_legend": true, "suffix": null, "lab_format": null }, "add_log_tab": false, "add_pct_tab": true, "l_active": false, "p_active": false, "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "xaxis" ], "square": false, "flat": false, "defer_render": false }, "fastqc_per_base_sequence_quality_plot": { "id": "fastqc_per_base_sequence_quality_plot", "anchor": "fastqc_per_base_sequence_quality_plot", "plot_type": "xy_line", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 500, "hoverlabel": { "namelength": -1 }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "white", "plot_bgcolor": "white", "showlegend": false, "title": { "font": { "size": 20 }, "text": "FastQC: Mean Quality Scores", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "shapes": [ { "fillcolor": "#c3e6c3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 28, "y1": 100 }, { "fillcolor": "#e6dcc3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 20, "y1": 28 }, { "fillcolor": "#e6c3c3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 0, "y1": 20 }, { "fillcolor": "#c3e6c3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 28, "y1": 100 }, { "fillcolor": "#e6dcc3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 20, "y1": 28 }, { "fillcolor": "#e6c3c3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 0, "y1": 20 } ], "hoverdistance": -1 }, "datasets": [ { "plot_id": "fastqc_per_base_sequence_quality_plot", "label": "1", "uid": "fastqc_per_base_sequence_quality_plot", "dconfig": { "title": "FastQC: Mean Quality Scores
64 samples" }, "layout": { "title": { "text": "FastQC: Mean Quality Scores
64 samples" }, "xaxis": { "hoverformat": ",.0f", "ticksuffix": " bp", "title": { "text": "Position (bp)" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": null } }, "yaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "Phred Score" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": null }, "range": [ 0, 41.77777142787661 ] } }, "trace_params": { "hovertemplate": "%{text}
Base %{x}: %{y:.2f}", "mode": "lines", "line": { "width": 2 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "n_samples": 64, "lines": [ { "name": "CAFS1_R1", "pairs": [ [ 1, 39.600246430118155 ], [ 2, 38.63170286871497 ], [ 3, 39.202103195661856 ], [ 4, 39.1942955087501 ], [ 5, 38.89321158221556 ], [ 6, 39.33580983402565 ], [ 7, 39.369456084811 ], [ 8, 39.44077442494556 ], [ 9, 38.86071208544537 ], [ 10, 39.58163485644226 ], [ 15, 39.486688503791 ], [ 20, 39.4089678603888 ], [ 25, 39.580014761408066 ], [ 30, 39.50220140172379 ], [ 35, 39.57809141618213 ], [ 40, 39.57324386970843 ], [ 45, 39.582120287910215 ], [ 50, 39.29382944979871 ], [ 55, 39.39132365499573 ], [ 60, 39.44508966695132 ], [ 65, 39.46706355983896 ], [ 70, 39.44539221666464 ], [ 75, 39.444299133829446 ], [ 80, 39.462603391484684 ], [ 85, 39.56188361595706 ], [ 90, 39.460051238257904 ], [ 95, 39.45420031718921 ], [ 100, 39.24967401612609 ], [ 105, 39.393287706328 ], [ 110, 39.36243213897937 ], [ 115, 39.23075308958265 ], [ 120, 39.221408093303566 ], [ 125, 39.23148507362539 ], [ 130, 39.25247349607779 ], [ 135, 39.059834815601015 ], [ 140, 39.21590845319572 ], [ 145, 39.10249674229866 ], [ 150, 39.1296217449386 ], [ 155, 38.926690130964936 ], [ 160, 38.90822938079872 ], [ 165, 39.13176891122809 ], [ 170, 38.913626576062754 ], [ 175, 39.284861867668674 ], [ 180, 39.16368338863947 ], [ 185, 38.9538893226625 ], [ 190, 39.177020300605115 ], [ 195, 39.14917040796408 ], [ 200, 39.09642787429241 ], [ 205, 39.11362970915479 ], [ 210, 39.09642299433925 ], [ 215, 39.2722086667968 ], [ 220, 39.10003903962522 ], [ 225, 39.18605509957233 ], [ 230, 39.053507792722726 ], [ 235, 39.14308475920334 ], [ 240, 39.19179674871138 ], [ 245, 38.9716655991704 ], [ 250, 39.06661054686309 ], [ 255, 38.910797572208494 ], [ 260, 38.593364443224445 ], [ 265, 38.982302613089736 ], [ 270, 38.65807947100662 ], [ 275, 38.72328132053143 ], [ 280, 38.6470360022936 ], [ 285, 38.84494003684409 ], [ 290, 38.88637535771894 ], [ 295, 38.7140590475484 ], [ 300, 37.51975831898648 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAFS2_R1", "pairs": [ [ 1, 39.36087266580386 ], [ 2, 38.79531708090119 ], [ 3, 39.188610971712315 ], [ 4, 38.66826021499696 ], [ 5, 38.809672222075484 ], [ 6, 39.200496553181374 ], [ 7, 39.3864926969705 ], [ 8, 39.45529700747471 ], [ 9, 38.90668497926627 ], [ 10, 39.541253532658935 ], [ 15, 39.4212936795119 ], [ 20, 39.35364623227067 ], [ 25, 39.5442645466311 ], [ 30, 39.471075777184964 ], [ 35, 39.56993740260426 ], [ 40, 39.56568500567867 ], [ 45, 39.55127439845752 ], [ 50, 39.25801748501097 ], [ 55, 39.45036317054489 ], [ 60, 39.52555928263912 ], [ 65, 39.44033702226566 ], [ 70, 39.415546340561534 ], [ 75, 39.42046433004939 ], [ 80, 39.420321703071764 ], [ 85, 39.55866458889095 ], [ 90, 39.434616095718546 ], [ 95, 39.41529806397084 ], [ 100, 39.21584744195875 ], [ 105, 39.36267927418716 ], [ 110, 39.32950529568686 ], [ 115, 39.217014870183036 ], [ 120, 39.2011779931856 ], [ 125, 39.21986740973561 ], [ 130, 39.252090541718395 ], [ 135, 39.06067457277938 ], [ 140, 39.18613877076676 ], [ 145, 39.092554343519716 ], [ 150, 39.11452418055519 ], [ 155, 38.88933203032144 ], [ 160, 38.91018198145849 ], [ 165, 39.119928158263114 ], [ 170, 38.89817490293442 ], [ 175, 39.285835028129206 ], [ 180, 39.18085629011383 ], [ 185, 38.963133567523315 ], [ 190, 39.17243073347244 ], [ 195, 39.12867066374369 ], [ 200, 39.09369007686009 ], [ 205, 39.1067589339954 ], [ 210, 39.08554977417395 ], [ 215, 39.272480917038635 ], [ 220, 39.08411822191702 ], [ 225, 39.1780629679706 ], [ 230, 39.04277649016462 ], [ 235, 39.14265829387954 ], [ 240, 39.176059639600375 ], [ 245, 38.946444536888464 ], [ 250, 39.0453913353539 ], [ 255, 38.891008812825156 ], [ 260, 38.54960182776243 ], [ 265, 38.94530183172436 ], [ 270, 38.605507058807994 ], [ 275, 38.68716472312833 ], [ 280, 38.58303508934113 ], [ 285, 38.804616949063 ], [ 290, 38.85699079515591 ], [ 295, 38.690598261967736 ], [ 300, 37.49070918343335 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAMS1_R1", "pairs": [ [ 1, 39.64231381567309 ], [ 2, 39.07254146879125 ], [ 3, 39.22951734273156 ], [ 4, 39.07605219828818 ], [ 5, 38.82627331981657 ], [ 6, 39.33513859217026 ], [ 7, 39.35307324905768 ], [ 8, 39.4828069507001 ], [ 9, 38.92411109145586 ], [ 10, 39.57961599695193 ], [ 15, 39.452407843350706 ], [ 20, 39.3973791996081 ], [ 25, 39.56182285784267 ], [ 30, 39.496768223815806 ], [ 35, 39.55629822150254 ], [ 40, 39.5591557920233 ], [ 45, 39.57226795846998 ], [ 50, 39.36189089523602 ], [ 55, 39.38625372504729 ], [ 60, 39.472840833321996 ], [ 65, 39.44902230265754 ], [ 70, 39.41748016709984 ], [ 75, 39.40303991073494 ], [ 80, 39.4135938711916 ], [ 85, 39.5321694403244 ], [ 90, 39.41350678332812 ], [ 95, 39.42042482548408 ], [ 100, 39.2688161499572 ], [ 105, 39.35351726484096 ], [ 110, 39.321909168225886 ], [ 115, 39.18681136247661 ], [ 120, 39.210608606905936 ], [ 125, 39.21395611498554 ], [ 130, 39.22009593468277 ], [ 135, 38.95655179452288 ], [ 140, 39.25830146828691 ], [ 145, 39.06866248452107 ], [ 150, 39.08684801393444 ], [ 155, 38.9269993332154 ], [ 160, 38.95777484453033 ], [ 165, 39.091273286431615 ], [ 170, 38.94002476628519 ], [ 175, 39.27178412508335 ], [ 180, 39.09379346006777 ], [ 185, 38.94611019636126 ], [ 190, 39.12709458815845 ], [ 195, 39.11546804196661 ], [ 200, 39.134061806850184 ], [ 205, 39.05005783335828 ], [ 210, 39.09177949841469 ], [ 215, 39.23939200130635 ], [ 220, 39.0972063085988 ], [ 225, 39.13081769564685 ], [ 230, 39.03253636697648 ], [ 235, 39.10831575652837 ], [ 240, 39.15260658347735 ], [ 245, 38.94883176616272 ], [ 250, 39.06161906187489 ], [ 255, 38.786490127505544 ], [ 260, 38.625961054336145 ], [ 265, 38.95490612456256 ], [ 270, 38.75404598123465 ], [ 275, 38.711964782647144 ], [ 280, 38.67522878351806 ], [ 285, 38.773385587829054 ], [ 290, 38.85291039850857 ], [ 295, 38.65301471103278 ], [ 300, 37.83454787032597 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAMS2_R1", "pairs": [ [ 1, 39.551992539187204 ], [ 2, 38.864736898740986 ], [ 3, 39.18476272463144 ], [ 4, 39.17703887035642 ], [ 5, 38.92595382426438 ], [ 6, 39.36123964274185 ], [ 7, 39.325824694812106 ], [ 8, 39.473223573298895 ], [ 9, 38.951994930473354 ], [ 10, 39.592362232026495 ], [ 15, 39.47101402489329 ], [ 20, 39.41237968841541 ], [ 25, 39.57972667599268 ], [ 30, 39.51985843585973 ], [ 35, 39.57983189258343 ], [ 40, 39.575082798283056 ], [ 45, 39.59463395387209 ], [ 50, 39.363769623492 ], [ 55, 39.44068295132537 ], [ 60, 39.57190238769922 ], [ 65, 39.4777048435501 ], [ 70, 39.44525655664692 ], [ 75, 39.43571048525464 ], [ 80, 39.46342087485728 ], [ 85, 39.55595941963138 ], [ 90, 39.44518960023434 ], [ 95, 39.45328176095366 ], [ 100, 39.29430332450545 ], [ 105, 39.38369013528782 ], [ 110, 39.35728061312943 ], [ 115, 39.22518517632851 ], [ 120, 39.23945167480705 ], [ 125, 39.25190556754527 ], [ 130, 39.25395252072959 ], [ 135, 39.02238855045345 ], [ 140, 39.279697261363154 ], [ 145, 39.106629282669644 ], [ 150, 39.13357911444037 ], [ 155, 38.942319947869024 ], [ 160, 39.01217066915365 ], [ 165, 39.12997232036635 ], [ 170, 38.97173329507207 ], [ 175, 39.302568885222186 ], [ 180, 39.13879632452726 ], [ 185, 38.94357405082709 ], [ 190, 39.15393316195373 ], [ 195, 39.14370299515753 ], [ 200, 39.15707242174089 ], [ 205, 39.08832359851497 ], [ 210, 39.1025904381565 ], [ 215, 39.27191768947025 ], [ 220, 39.111672814448575 ], [ 225, 39.157405779269176 ], [ 230, 39.06618679229491 ], [ 235, 39.14230028816376 ], [ 240, 39.181007497040646 ], [ 245, 38.99152248514342 ], [ 250, 39.100120765726444 ], [ 255, 38.8515476175075 ], [ 260, 38.71585039219438 ], [ 265, 38.953675455771766 ], [ 270, 38.733142416434 ], [ 275, 38.78971918475694 ], [ 280, 38.71241816779563 ], [ 285, 38.82673872882825 ], [ 290, 38.90164916440451 ], [ 295, 38.709114078278006 ], [ 300, 37.855107355353816 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCFS1_R1", "pairs": [ [ 1, 32.28469174431323 ], [ 2, 33.141397499619266 ], [ 3, 33.64831300447189 ], [ 4, 33.397702677133374 ], [ 5, 33.22619261884654 ], [ 6, 33.16989482525486 ], [ 7, 33.56775902569144 ], [ 8, 33.509629096346345 ], [ 9, 33.38633143658826 ], [ 10, 33.218424732448184 ], [ 15, 33.3907876337759 ], [ 20, 33.51671120094883 ], [ 25, 33.37784177177219 ], [ 30, 33.40309478648926 ], [ 35, 33.543223174440556 ], [ 40, 33.61526896091421 ], [ 45, 33.61437656332205 ], [ 50, 33.45249882248143 ], [ 55, 33.460923741485296 ], [ 60, 33.446616270698335 ], [ 65, 33.39258920824796 ], [ 70, 33.36037270864485 ], [ 75, 33.39746358752838 ], [ 80, 33.56267907143161 ], [ 85, 33.54588038747848 ], [ 90, 33.14899646026684 ], [ 95, 33.47169274931582 ], [ 100, 33.2474765955942 ], [ 105, 33.43061459011173 ], [ 110, 33.142100137990866 ], [ 115, 33.186878406505414 ], [ 120, 33.21104388478916 ], [ 125, 33.12083477554562 ], [ 130, 33.088735070534725 ], [ 135, 33.18829702787521 ], [ 140, 33.25818811150083 ], [ 145, 33.07856747277091 ], [ 150, 33.22832748753923 ], [ 155, 33.069707773498294 ], [ 160, 33.115233273490034 ], [ 165, 33.14696437554517 ], [ 170, 32.59911296538165 ], [ 175, 32.909949833161804 ], [ 180, 32.92069024400375 ], [ 185, 32.971688288541856 ], [ 190, 32.949482137911936 ], [ 195, 32.86232068679036 ], [ 200, 32.82897535308779 ], [ 205, 32.76163371934699 ], [ 210, 32.22193216067645 ], [ 215, 32.907501650058386 ], [ 220, 33.02082350606253 ], [ 225, 33.044406693177976 ], [ 230, 32.78754961874343 ], [ 235, 32.86517733508114 ], [ 240, 32.837320680169114 ], [ 245, 32.61923084024149 ], [ 250, 32.55630042649041 ], [ 255, 32.58731791075088 ], [ 260, 32.441421456628404 ], [ 265, 32.31960173396464 ], [ 270, 32.25198153704131 ], [ 275, 31.839107940107017 ], [ 280, 31.838787326273838 ], [ 285, 31.954830758436692 ], [ 290, 31.881603123919614 ], [ 295, 31.733774797306324 ], [ 300, 28.31025427155504 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCFS2_R1", "pairs": [ [ 1, 32.27477475258499 ], [ 2, 33.1493652678092 ], [ 3, 33.638884920615375 ], [ 4, 33.37656835747959 ], [ 5, 33.197360578130926 ], [ 6, 33.177853092872375 ], [ 7, 33.558741668678174 ], [ 8, 33.50406159636255 ], [ 9, 33.370331873556026 ], [ 10, 33.20199606894615 ], [ 15, 33.38346100227095 ], [ 20, 33.50937492302918 ], [ 25, 33.36393676816142 ], [ 30, 33.400961581091536 ], [ 35, 33.53309523692235 ], [ 40, 33.61569956937062 ], [ 45, 33.60360109165788 ], [ 50, 33.43910699848331 ], [ 55, 33.45877206378608 ], [ 60, 33.472784507687535 ], [ 65, 33.39404998251153 ], [ 70, 33.389159125281424 ], [ 75, 33.38984970327887 ], [ 80, 33.55643353346467 ], [ 85, 33.545002931193316 ], [ 90, 33.16322165240481 ], [ 95, 33.471371355098064 ], [ 100, 33.23535765600076 ], [ 105, 33.43252422640543 ], [ 110, 33.14036978830531 ], [ 115, 33.17708652533981 ], [ 120, 33.21702819475714 ], [ 125, 33.12653105463073 ], [ 130, 33.078547133596764 ], [ 135, 33.182038605407776 ], [ 140, 33.26519109268082 ], [ 145, 33.084021598825466 ], [ 150, 33.22747186225714 ], [ 155, 33.06203129369686 ], [ 160, 33.103649800463124 ], [ 165, 33.14120854558348 ], [ 170, 32.58470050896477 ], [ 175, 32.91768387404939 ], [ 180, 32.92616377611352 ], [ 185, 32.97138428388988 ], [ 190, 32.94933902255158 ], [ 195, 32.90850725425324 ], [ 200, 32.82697642334507 ], [ 205, 32.755201719243175 ], [ 210, 32.228934635434626 ], [ 215, 32.925871872444006 ], [ 220, 33.02556934083586 ], [ 225, 33.04326497909411 ], [ 230, 32.80567384973217 ], [ 235, 32.867594452104 ], [ 240, 32.82852566945586 ], [ 245, 32.61658684654057 ], [ 250, 32.582445115484184 ], [ 255, 32.579799333740716 ], [ 260, 32.43170152372316 ], [ 265, 32.31540707047374 ], [ 270, 32.259775971929955 ], [ 275, 31.842467104593823 ], [ 280, 31.857178332267598 ], [ 285, 31.964505841706416 ], [ 290, 31.917785053150652 ], [ 295, 31.767392911952477 ], [ 300, 28.389411592209704 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCMS1_R1", "pairs": [ [ 1, 32.2241011476737 ], [ 2, 33.112129149007096 ], [ 3, 33.63527787037478 ], [ 4, 33.40700033334921 ], [ 5, 33.171074813086335 ], [ 6, 33.15185008809944 ], [ 7, 33.55666936520787 ], [ 8, 33.49785704081147 ], [ 9, 33.3181627696557 ], [ 10, 33.19628648983284 ], [ 15, 33.38960617172246 ], [ 20, 33.468178484689744 ], [ 25, 33.25354921662936 ], [ 30, 33.37429591885328 ], [ 35, 33.52990999571408 ], [ 40, 33.589900471451024 ], [ 45, 33.59502547740368 ], [ 50, 33.426424115434074 ], [ 55, 33.428185151673894 ], [ 60, 33.40914519739035 ], [ 65, 33.411002428687084 ], [ 70, 33.453119672365354 ], [ 75, 33.400185723129674 ], [ 80, 33.58641173389209 ], [ 85, 33.554753083480165 ], [ 90, 33.272153912091056 ], [ 95, 33.49084337349397 ], [ 100, 33.286850396500796 ], [ 105, 33.45449627354334 ], [ 110, 33.126676667381005 ], [ 115, 33.18475510155488 ], [ 120, 33.03227944853204 ], [ 125, 33.14127961521061 ], [ 130, 33.148232492797106 ], [ 135, 33.18385408481558 ], [ 140, 33.260048192488014 ], [ 145, 33.049513212927394 ], [ 150, 33.218093065563075 ], [ 155, 33.04397156255756 ], [ 160, 33.00909991427755 ], [ 165, 33.12960853414611 ], [ 170, 32.61842365939613 ], [ 175, 32.84644061339175 ], [ 180, 32.91565006191066 ], [ 185, 32.95055800412332 ], [ 190, 32.92059892273916 ], [ 195, 32.883398657948256 ], [ 200, 32.78460593303076 ], [ 205, 32.74843244736328 ], [ 210, 32.12034841911257 ], [ 215, 32.84202174523877 ], [ 220, 32.99005986369936 ], [ 225, 33.004815790267585 ], [ 230, 32.83528201513542 ], [ 235, 32.863855098188495 ], [ 240, 32.83801019193218 ], [ 245, 32.65855598418821 ], [ 250, 32.561945039767586 ], [ 255, 32.592750392913274 ], [ 260, 32.47169931117678 ], [ 265, 32.14905081374263 ], [ 270, 32.32285168621736 ], [ 275, 31.656209785347222 ], [ 280, 31.71929144786908 ], [ 285, 32.009023365687774 ], [ 290, 31.90155371938318 ], [ 295, 31.498910003376533 ], [ 300, 27.668674019098606 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCMS2_R1", "pairs": [ [ 1, 32.195137185600466 ], [ 2, 33.103624259228226 ], [ 3, 33.61841430406809 ], [ 4, 33.37714233482122 ], [ 5, 33.13911021058993 ], [ 6, 33.14560513500201 ], [ 7, 33.53928692940896 ], [ 8, 33.48990214449302 ], [ 9, 33.30411886879644 ], [ 10, 33.16840998766015 ], [ 15, 33.37629835011654 ], [ 20, 33.46639143218415 ], [ 25, 33.26317393092732 ], [ 30, 33.3794163200845 ], [ 35, 33.52569481472453 ], [ 40, 33.588106010978905 ], [ 45, 33.593466481822844 ], [ 50, 33.42718670900761 ], [ 55, 33.431370796559044 ], [ 60, 33.41854338265913 ], [ 65, 33.40818395100598 ], [ 70, 33.4606292484534 ], [ 75, 33.39890209779556 ], [ 80, 33.576936331053616 ], [ 85, 33.550273207393865 ], [ 90, 33.265706886045095 ], [ 95, 33.494384521633144 ], [ 100, 33.28445860243302 ], [ 105, 33.45550341773567 ], [ 110, 33.11781751297764 ], [ 115, 33.18849542691443 ], [ 120, 33.06116609873395 ], [ 125, 33.142076957844324 ], [ 130, 33.14404255668922 ], [ 135, 33.19796312014489 ], [ 140, 33.26557208877152 ], [ 145, 33.05572596617744 ], [ 150, 33.2247624184532 ], [ 155, 33.02835827717372 ], [ 160, 32.998393166386506 ], [ 165, 33.12369673300865 ], [ 170, 32.62332854262629 ], [ 175, 32.85439466961896 ], [ 180, 32.90464021451533 ], [ 185, 32.95129187427678 ], [ 190, 32.90948371304074 ], [ 195, 32.89468274201903 ], [ 200, 32.783031497262655 ], [ 205, 32.73617246770259 ], [ 210, 32.14568446712882 ], [ 215, 32.84473565607828 ], [ 220, 33.00448645024987 ], [ 225, 33.01654151812956 ], [ 230, 32.8445779583545 ], [ 235, 32.86194528480563 ], [ 240, 32.84803603896434 ], [ 245, 32.63765401375332 ], [ 250, 32.55854687996792 ], [ 255, 32.57361754428733 ], [ 260, 32.45313695116687 ], [ 265, 32.156361611719184 ], [ 270, 32.31827455179979 ], [ 275, 31.658665366468078 ], [ 280, 31.7312392744659 ], [ 285, 32.04366524411329 ], [ 290, 31.953043511663235 ], [ 295, 31.552279494012858 ], [ 300, 27.82566863084962 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPFS1_R1", "pairs": [ [ 1, 32.234352246462976 ], [ 2, 33.15087306782809 ], [ 3, 33.61838185194586 ], [ 4, 33.499485644814364 ], [ 5, 33.26409132810517 ], [ 6, 33.17043192475718 ], [ 7, 33.57268439967402 ], [ 8, 33.493300022711786 ], [ 9, 33.382205982552 ], [ 10, 33.27262695221172 ], [ 15, 33.43436961430041 ], [ 20, 33.6243603959867 ], [ 25, 33.547923207438785 ], [ 30, 33.47324685040948 ], [ 35, 33.54990437252356 ], [ 40, 33.47862982766828 ], [ 45, 33.558144941478275 ], [ 50, 33.43545374378708 ], [ 55, 33.43608171663727 ], [ 60, 33.283567153011596 ], [ 65, 33.44540778151889 ], [ 70, 33.195882418785224 ], [ 75, 33.39251638418834 ], [ 80, 33.53144628458049 ], [ 85, 33.52495761903937 ], [ 90, 33.22046016327512 ], [ 95, 33.36002832596235 ], [ 100, 33.212190531559436 ], [ 105, 33.19104653104854 ], [ 110, 33.4262163877476 ], [ 115, 33.27360122924809 ], [ 120, 33.06232020576544 ], [ 125, 33.04218725991249 ], [ 130, 33.03819086748839 ], [ 135, 32.887122958212245 ], [ 140, 33.186257808063594 ], [ 145, 33.0931801214911 ], [ 150, 33.036785494775664 ], [ 155, 32.84232830744427 ], [ 160, 33.19613161850676 ], [ 165, 33.27989434147732 ], [ 170, 32.98116038857784 ], [ 175, 33.20780897149806 ], [ 180, 33.11457567780643 ], [ 185, 33.214690653938774 ], [ 190, 33.17631338068163 ], [ 195, 32.636560188680505 ], [ 200, 32.99530303131535 ], [ 205, 32.40653433196812 ], [ 210, 32.1247122020966 ], [ 215, 33.040901984365604 ], [ 220, 32.97282688581546 ], [ 225, 33.11566551356113 ], [ 230, 32.60046368987566 ], [ 235, 32.85085355016737 ], [ 240, 32.628279737286945 ], [ 245, 32.59596571054408 ], [ 250, 32.75470611424028 ], [ 255, 32.327495038986555 ], [ 260, 32.61723826895708 ], [ 265, 32.766947957799644 ], [ 270, 32.23860863507771 ], [ 275, 32.30858128374781 ], [ 280, 31.965286198892606 ], [ 285, 32.032929879360324 ], [ 290, 31.805702191018923 ], [ 295, 32.01053156242799 ], [ 300, 30.930711885792853 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPFS2_R1", "pairs": [ [ 1, 32.18451158533863 ], [ 2, 33.09467498549042 ], [ 3, 33.615278583865354 ], [ 4, 33.328675387294076 ], [ 5, 33.14709362025091 ], [ 6, 33.12570315639091 ], [ 7, 33.547273315773026 ], [ 8, 33.485669003080496 ], [ 9, 33.325399571409434 ], [ 10, 33.19468949506674 ], [ 15, 33.37493972945221 ], [ 20, 33.48626501183088 ], [ 25, 33.30987990535292 ], [ 30, 33.33600942006339 ], [ 35, 33.524240897698704 ], [ 40, 33.58110504028408 ], [ 45, 33.59008750585976 ], [ 50, 33.41863224916795 ], [ 55, 33.438663950665514 ], [ 60, 33.411765493763426 ], [ 65, 33.383852443005836 ], [ 70, 33.44637330133661 ], [ 75, 33.378672321901945 ], [ 80, 33.5648144177152 ], [ 85, 33.536639432092144 ], [ 90, 33.232545316546116 ], [ 95, 33.463664166443436 ], [ 100, 33.24167894454862 ], [ 105, 33.3672091258148 ], [ 110, 33.10473984947001 ], [ 115, 33.147787457515506 ], [ 120, 33.161420447252254 ], [ 125, 33.134446906235524 ], [ 130, 33.11074684931862 ], [ 135, 33.14945121412718 ], [ 140, 33.24119255712197 ], [ 145, 33.010627420777105 ], [ 150, 33.1971056714552 ], [ 155, 33.050776281397 ], [ 160, 33.05994407764389 ], [ 165, 33.10752721838781 ], [ 170, 32.5595738268518 ], [ 175, 32.830502969147645 ], [ 180, 32.907998839130244 ], [ 185, 32.92702338766243 ], [ 190, 32.87230746047072 ], [ 195, 32.89445783927029 ], [ 200, 32.79074510241669 ], [ 205, 32.74751130211531 ], [ 210, 32.094022436791874 ], [ 215, 32.90063515097394 ], [ 220, 33.00331082212424 ], [ 225, 33.024873013995446 ], [ 230, 32.761231267267604 ], [ 235, 32.85079256993592 ], [ 240, 32.83949007613137 ], [ 245, 32.57670402536223 ], [ 250, 32.543750976758716 ], [ 255, 32.49287356835079 ], [ 260, 32.4053881964564 ], [ 265, 32.177292186444745 ], [ 270, 32.1807382104564 ], [ 275, 31.63381493357452 ], [ 280, 31.779721683562894 ], [ 285, 32.017151388833454 ], [ 290, 31.917642133467304 ], [ 295, 31.582585856273035 ], [ 300, 28.006914206443938 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPMS1_R1", "pairs": [ [ 1, 31.686740962362354 ], [ 2, 32.92659242998265 ], [ 3, 33.50552791842227 ], [ 4, 32.99305580143752 ], [ 5, 33.05058333038275 ], [ 6, 32.93751106468859 ], [ 7, 33.417554792337924 ], [ 8, 33.39102166908614 ], [ 9, 33.26190560492866 ], [ 10, 33.24095439577948 ], [ 15, 33.15669280883758 ], [ 20, 33.368603724816765 ], [ 25, 33.202030591651024 ], [ 30, 33.21947385192791 ], [ 35, 33.42194968664802 ], [ 40, 33.51550561201005 ], [ 45, 33.50558014375243 ], [ 50, 33.290841179910466 ], [ 55, 33.3516876012428 ], [ 60, 33.34520717706314 ], [ 65, 33.262010604491415 ], [ 70, 33.33434321581153 ], [ 75, 33.21429134154492 ], [ 80, 33.45282172073358 ], [ 85, 33.43978702121821 ], [ 90, 33.15224176544008 ], [ 95, 33.35178854375979 ], [ 100, 33.113731876908794 ], [ 105, 33.28634230980329 ], [ 110, 32.94538517377525 ], [ 115, 32.99822241107629 ], [ 120, 33.00708822435864 ], [ 125, 32.94558347054762 ], [ 130, 32.94349988491258 ], [ 135, 32.99719193877505 ], [ 140, 33.10140624377548 ], [ 145, 32.8438216534643 ], [ 150, 33.037515934844194 ], [ 155, 32.875280466505544 ], [ 160, 32.92981378281597 ], [ 165, 32.92651259964855 ], [ 170, 32.32453401440339 ], [ 175, 32.655723511524045 ], [ 180, 32.68214235587588 ], [ 185, 32.712947667764126 ], [ 190, 32.75017263053524 ], [ 195, 32.724991391082945 ], [ 200, 32.6034198703052 ], [ 205, 32.46093774501955 ], [ 210, 31.98486762603303 ], [ 215, 32.66048080455751 ], [ 220, 32.78581843453011 ], [ 225, 32.838802323809944 ], [ 230, 32.55898502864125 ], [ 235, 32.63958351736569 ], [ 240, 32.64668030138029 ], [ 245, 32.3063976909524 ], [ 250, 32.26783447103509 ], [ 255, 32.22482458002336 ], [ 260, 32.09486172656966 ], [ 265, 31.839370750514284 ], [ 270, 31.853658413949113 ], [ 275, 31.325971415608212 ], [ 280, 31.324994130010378 ], [ 285, 31.605147062729323 ], [ 290, 31.46219664049744 ], [ 295, 31.088055132809433 ], [ 300, 27.6212022858948 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPMS2_R1", "pairs": [ [ 1, 32.22041537868022 ], [ 2, 33.1104469740254 ], [ 3, 33.61225137588694 ], [ 4, 33.338319244837066 ], [ 5, 33.25269927775092 ], [ 6, 33.13370642210795 ], [ 7, 33.53957719861117 ], [ 8, 33.48994271817636 ], [ 9, 33.3924952509315 ], [ 10, 33.41002846999419 ], [ 15, 33.35444898597011 ], [ 20, 33.47816795831564 ], [ 25, 33.29971725340248 ], [ 30, 33.35177485752794 ], [ 35, 33.5295270463905 ], [ 40, 33.58682545290684 ], [ 45, 33.60345061653034 ], [ 50, 33.416936071645566 ], [ 55, 33.452692236319066 ], [ 60, 33.43047457196714 ], [ 65, 33.367440202369444 ], [ 70, 33.46067664840263 ], [ 75, 33.37282662838055 ], [ 80, 33.565486829382635 ], [ 85, 33.53242306152148 ], [ 90, 33.29845781202692 ], [ 95, 33.46244347426919 ], [ 100, 33.230008588503765 ], [ 105, 33.392740253842064 ], [ 110, 33.07866955116153 ], [ 115, 33.1247830524532 ], [ 120, 33.116968545657876 ], [ 125, 33.079978317453964 ], [ 130, 33.09669752029813 ], [ 135, 33.13729637835435 ], [ 140, 33.2248845045661 ], [ 145, 33.007502075499346 ], [ 150, 33.173816349154414 ], [ 155, 33.004907969468036 ], [ 160, 33.05904116345736 ], [ 165, 33.082109108312295 ], [ 170, 32.53250900871241 ], [ 175, 32.82165963431786 ], [ 180, 32.853169440537584 ], [ 185, 32.851171376893966 ], [ 190, 32.89519581545749 ], [ 195, 32.874459470679305 ], [ 200, 32.78075046519465 ], [ 205, 32.69819831699658 ], [ 210, 32.187393591302694 ], [ 215, 32.86888592596934 ], [ 220, 32.98545760013285 ], [ 225, 33.00822008713027 ], [ 230, 32.77690113604173 ], [ 235, 32.77491428403974 ], [ 240, 32.836139411758964 ], [ 245, 32.57945986675982 ], [ 250, 32.522585655327354 ], [ 255, 32.47586217001636 ], [ 260, 32.37877164277516 ], [ 265, 32.16851107475152 ], [ 270, 32.19701189284231 ], [ 275, 31.621641229162684 ], [ 280, 31.727713834647837 ], [ 285, 32.057428586606285 ], [ 290, 31.910930473811568 ], [ 295, 31.520889375195896 ], [ 300, 28.051564254592265 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVFS1_R1", "pairs": [ [ 1, 32.168539940383404 ], [ 2, 33.0754323114648 ], [ 3, 33.61742372448747 ], [ 4, 33.32962780649219 ], [ 5, 33.10822143827313 ], [ 6, 33.11047301300808 ], [ 7, 33.518782873446916 ], [ 8, 33.4860529986053 ], [ 9, 33.31860238284063 ], [ 10, 33.198859627533025 ], [ 15, 33.37140682400343 ], [ 20, 33.505536868396824 ], [ 25, 33.34977803301702 ], [ 30, 33.37945779892617 ], [ 35, 33.536220283792474 ], [ 40, 33.59018205030988 ], [ 45, 33.60677675629111 ], [ 50, 33.430164793749654 ], [ 55, 33.43259903460912 ], [ 60, 33.42418308697178 ], [ 65, 33.40059527879194 ], [ 70, 33.45685960810053 ], [ 75, 33.37969397382779 ], [ 80, 33.58560010410735 ], [ 85, 33.548099292590436 ], [ 90, 33.27470554988331 ], [ 95, 33.5000893378063 ], [ 100, 33.304750635283476 ], [ 105, 33.43999799440256 ], [ 110, 33.087156883301574 ], [ 115, 33.190956578815424 ], [ 120, 33.210833872717494 ], [ 125, 33.177735133508975 ], [ 130, 33.11982350742527 ], [ 135, 33.1953477464218 ], [ 140, 33.278849511133394 ], [ 145, 33.079593281607565 ], [ 150, 33.21073642562813 ], [ 155, 33.062428435984394 ], [ 160, 33.0457290826739 ], [ 165, 33.11252524231015 ], [ 170, 32.57383890889857 ], [ 175, 32.84929437505698 ], [ 180, 32.93442246330568 ], [ 185, 32.94172848412863 ], [ 190, 32.92725615148284 ], [ 195, 32.91513052778076 ], [ 200, 32.793055720563046 ], [ 205, 32.74241483527754 ], [ 210, 32.09510550715917 ], [ 215, 32.89208958421655 ], [ 220, 32.99699410582169 ], [ 225, 33.02151851805532 ], [ 230, 32.756987276796906 ], [ 235, 32.853685599417 ], [ 240, 32.85747902990518 ], [ 245, 32.60394146608316 ], [ 250, 32.52539752005835 ], [ 255, 32.44304113167467 ], [ 260, 32.42314653028689 ], [ 265, 32.16507242612317 ], [ 270, 32.20120930609714 ], [ 275, 31.559244878019467 ], [ 280, 31.721510270461863 ], [ 285, 31.917059867750133 ], [ 290, 31.828142793197344 ], [ 295, 31.530344328378078 ], [ 300, 27.98701364442469 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVFS2_R1", "pairs": [ [ 1, 32.22472888390136 ], [ 2, 33.0899592721222 ], [ 3, 33.61119871528214 ], [ 4, 33.357568516673275 ], [ 5, 33.12955528253151 ], [ 6, 33.12877168203233 ], [ 7, 33.54253209376119 ], [ 8, 33.48359275991835 ], [ 9, 33.32046841896506 ], [ 10, 33.2079859532355 ], [ 15, 33.38143350520949 ], [ 20, 33.49778850525786 ], [ 25, 33.315997059079606 ], [ 30, 33.37349398755913 ], [ 35, 33.528023875630026 ], [ 40, 33.583406202316255 ], [ 45, 33.6016562105477 ], [ 50, 33.42217116432956 ], [ 55, 33.40886730483658 ], [ 60, 33.4272771685765 ], [ 65, 33.40088615003604 ], [ 70, 33.46560992952398 ], [ 75, 33.38097292695551 ], [ 80, 33.57809971122731 ], [ 85, 33.5408204627135 ], [ 90, 33.26754297537859 ], [ 95, 33.49023779119263 ], [ 100, 33.30240906688401 ], [ 105, 33.44849977023726 ], [ 110, 33.11013422981111 ], [ 115, 33.20196483420805 ], [ 120, 33.206000919050965 ], [ 125, 33.153480542723784 ], [ 130, 33.128333573417244 ], [ 135, 33.18678978784332 ], [ 140, 33.260305513365 ], [ 145, 33.0655228457825 ], [ 150, 33.21813014579281 ], [ 155, 33.0634925241737 ], [ 160, 33.04465276467714 ], [ 165, 33.11023108966204 ], [ 170, 32.5756302846197 ], [ 175, 32.85136215002999 ], [ 180, 32.91535708066482 ], [ 185, 32.937092862048516 ], [ 190, 32.91737685569031 ], [ 195, 32.8820407393254 ], [ 200, 32.780900506946324 ], [ 205, 32.7425515653419 ], [ 210, 32.117119113037425 ], [ 215, 32.8741863704965 ], [ 220, 32.98148968693162 ], [ 225, 33.02054879829382 ], [ 230, 32.770264125386994 ], [ 235, 32.85413472584162 ], [ 240, 32.859228227690735 ], [ 245, 32.627038636990314 ], [ 250, 32.53178179074009 ], [ 255, 32.469392750545424 ], [ 260, 32.43198061136132 ], [ 265, 32.19999042021614 ], [ 270, 32.24274173261867 ], [ 275, 31.55488962840972 ], [ 280, 31.7551565497569 ], [ 285, 31.993283719892453 ], [ 290, 31.905736567767896 ], [ 295, 31.559482200711454 ], [ 300, 28.02659196943934 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVMS1_R1", "pairs": [ [ 1, 32.18761043607251 ], [ 2, 33.08663096354792 ], [ 3, 33.61807661263934 ], [ 4, 33.27928601034009 ], [ 5, 33.22892716127484 ], [ 6, 33.11670229707031 ], [ 7, 33.535726751161626 ], [ 8, 33.469634170284245 ], [ 9, 33.41209288628084 ], [ 10, 33.38158744355489 ], [ 15, 33.339962042712855 ], [ 20, 33.48929779018782 ], [ 25, 33.297623306646884 ], [ 30, 33.35719770511115 ], [ 35, 33.53304399321954 ], [ 40, 33.562016521605685 ], [ 45, 33.599684776562206 ], [ 50, 33.42422797790649 ], [ 55, 33.43312154711198 ], [ 60, 33.438492372969165 ], [ 65, 33.35169092664198 ], [ 70, 33.42530278157429 ], [ 75, 33.42120527923212 ], [ 80, 33.596091841186734 ], [ 85, 33.533528577661436 ], [ 90, 33.333852530541016 ], [ 95, 33.48752617801047 ], [ 100, 33.32528795811518 ], [ 105, 33.44214114310646 ], [ 110, 33.08368744500234 ], [ 115, 33.180179865727894 ], [ 120, 33.14957215080798 ], [ 125, 33.09085891611538 ], [ 130, 33.17729372433314 ], [ 135, 33.162267464373166 ], [ 140, 33.17609389230962 ], [ 145, 33.02371608361297 ], [ 150, 33.201241321385524 ], [ 155, 32.979681815950656 ], [ 160, 32.97399442605247 ], [ 165, 33.0313144589944 ], [ 170, 32.66655795105616 ], [ 175, 32.787609816919726 ], [ 180, 32.69294471835595 ], [ 185, 32.9095260237052 ], [ 190, 32.83001614416301 ], [ 195, 32.548093243449614 ], [ 200, 32.70013145089882 ], [ 205, 32.67523426165308 ], [ 210, 32.188855799544015 ], [ 215, 32.62921534618364 ], [ 220, 32.94661343281954 ], [ 225, 32.99043911233145 ], [ 230, 32.77389397666592 ], [ 235, 32.734113883612494 ], [ 240, 32.81856611430504 ], [ 245, 32.588430951160184 ], [ 250, 32.36078196079286 ], [ 255, 32.45111654139439 ], [ 260, 32.345378380442256 ], [ 265, 32.077650626724996 ], [ 270, 32.1658459423784 ], [ 275, 31.49695621836322 ], [ 280, 31.4445227128611 ], [ 285, 31.948769777194293 ], [ 290, 31.88589346461086 ], [ 295, 31.387153053294355 ], [ 300, 27.54908688558348 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVMS2_R1", "pairs": [ [ 1, 32.24913840292527 ], [ 2, 33.12027325874187 ], [ 3, 33.62981322940159 ], [ 4, 33.34508112368899 ], [ 5, 33.24324407173042 ], [ 6, 33.132964025311466 ], [ 7, 33.54600512360141 ], [ 8, 33.48647500602133 ], [ 9, 33.41141643493683 ], [ 10, 33.40793326180727 ], [ 15, 33.35839285323291 ], [ 20, 33.50301504236824 ], [ 25, 33.316200652492824 ], [ 30, 33.36883974513368 ], [ 35, 33.5346070810799 ], [ 40, 33.57816820301723 ], [ 45, 33.61167918372709 ], [ 50, 33.43318642460227 ], [ 55, 33.42881165919282 ], [ 60, 33.45940653026906 ], [ 65, 33.36858271440583 ], [ 70, 33.44122933015695 ], [ 75, 33.42192930213004 ], [ 80, 33.593642523611585 ], [ 85, 33.53584350407925 ], [ 90, 33.34072020704967 ], [ 95, 33.48374388550958 ], [ 100, 33.32591341378118 ], [ 105, 33.46062177300337 ], [ 110, 33.124665530968215 ], [ 115, 33.20004817229918 ], [ 120, 33.16687585122643 ], [ 125, 33.09220265648334 ], [ 130, 33.182027978837226 ], [ 135, 33.153900457640844 ], [ 140, 33.1943112395717 ], [ 145, 33.017908865970355 ], [ 150, 33.215289328770915 ], [ 155, 33.021066461128825 ], [ 160, 32.98873979609712 ], [ 165, 33.07483527658995 ], [ 170, 32.676839666641854 ], [ 175, 32.832541396057685 ], [ 180, 32.76614412594014 ], [ 185, 32.92822927113396 ], [ 190, 32.86920080613442 ], [ 195, 32.631818341070336 ], [ 200, 32.736527984584384 ], [ 205, 32.709033020933695 ], [ 210, 32.23865901725497 ], [ 215, 32.68893754926863 ], [ 220, 32.96088541107434 ], [ 225, 32.9959898055895 ], [ 230, 32.802817876037984 ], [ 235, 32.76336118306072 ], [ 240, 32.83808509515924 ], [ 245, 32.613810380998686 ], [ 250, 32.430470258977486 ], [ 255, 32.50051889120475 ], [ 260, 32.39729765241766 ], [ 265, 32.107358218127835 ], [ 270, 32.20805289385209 ], [ 275, 31.55588968979049 ], [ 280, 31.538675779947653 ], [ 285, 32.041319794614886 ], [ 290, 31.990709505903613 ], [ 295, 31.435971306605488 ], [ 300, 27.782706042782493 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAFS1_R1", "pairs": [ [ 1, 39.67219386336592 ], [ 2, 39.13388716511527 ], [ 3, 39.18161901266696 ], [ 4, 39.203371923620146 ], [ 5, 39.2942537172344 ], [ 6, 39.356531989902024 ], [ 7, 39.30804390618223 ], [ 8, 39.39154127603732 ], [ 9, 39.011554843803864 ], [ 10, 39.57911453641611 ], [ 15, 39.47418454386726 ], [ 20, 39.431737452596224 ], [ 25, 39.60134787975845 ], [ 30, 39.48513662296067 ], [ 35, 39.592281942637264 ], [ 40, 39.54733482356343 ], [ 45, 39.49249435603154 ], [ 50, 39.48118640109432 ], [ 55, 39.40485103259601 ], [ 60, 39.44440663263604 ], [ 65, 39.46418443265606 ], [ 70, 39.40265349926045 ], [ 75, 39.403937200756786 ], [ 80, 39.39282639885222 ], [ 85, 39.55310266459698 ], [ 90, 39.42928706484262 ], [ 95, 39.297048159270375 ], [ 100, 39.229949949949955 ], [ 105, 39.333833718981865 ], [ 110, 39.33208041836961 ], [ 115, 39.24765135757428 ], [ 120, 39.16572305707262 ], [ 125, 39.28202573909165 ], [ 130, 39.273520872960255 ], [ 135, 39.04560881589697 ], [ 140, 39.35374861337432 ], [ 145, 39.02902237890562 ], [ 150, 39.16918148041026 ], [ 155, 39.10215863362016 ], [ 160, 39.21506312895703 ], [ 165, 39.202216017176355 ], [ 170, 39.02057401872878 ], [ 175, 39.27393942685585 ], [ 180, 39.23980241199769 ], [ 185, 39.146600030632435 ], [ 190, 39.26968425380196 ], [ 195, 39.203853068583854 ], [ 200, 39.36379721297625 ], [ 205, 39.17513145270771 ], [ 210, 39.24133156329258 ], [ 215, 39.283310408547166 ], [ 220, 39.17958420513734 ], [ 225, 39.24135346228646 ], [ 230, 39.11367040990084 ], [ 235, 39.21656075057595 ], [ 240, 39.19402880857963 ], [ 245, 39.0727796966323 ], [ 250, 39.1962871039188 ], [ 255, 39.001284377121614 ], [ 260, 38.92741524423955 ], [ 265, 39.04804220555172 ], [ 270, 38.04554459853527 ], [ 275, 38.95812566086037 ], [ 280, 38.3568946519005 ], [ 285, 38.933703459219 ], [ 290, 38.9871109923868 ], [ 295, 38.896729373968256 ], [ 300, 38.32535384795014 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAFS2_R1", "pairs": [ [ 1, 39.663965884861405 ], [ 2, 39.05069296375267 ], [ 3, 39.18518123667378 ], [ 4, 39.05319829424307 ], [ 5, 39.21396588486141 ], [ 6, 39.28912579957356 ], [ 7, 39.320149253731344 ], [ 8, 39.42388059701493 ], [ 9, 38.95511727078891 ], [ 10, 39.58788912579958 ], [ 15, 39.48407249466951 ], [ 20, 39.42763326226013 ], [ 25, 39.59710021321962 ], [ 30, 39.49697228144989 ], [ 35, 39.591423360138606 ], [ 40, 39.54819691356379 ], [ 45, 39.50938990911271 ], [ 50, 39.46751246035342 ], [ 55, 39.409807210909015 ], [ 60, 39.446975994618604 ], [ 65, 39.459231814910574 ], [ 70, 39.40438734440387 ], [ 75, 39.408104370387356 ], [ 80, 39.373016211604096 ], [ 85, 39.56321253359046 ], [ 90, 39.43900370676551 ], [ 95, 39.3495933224886 ], [ 100, 39.23383556894851 ], [ 105, 39.34323581962185 ], [ 110, 39.33124210973759 ], [ 115, 39.247835711428195 ], [ 120, 39.19241406451854 ], [ 125, 39.22609926819347 ], [ 130, 39.253940735603976 ], [ 135, 39.057072476780185 ], [ 140, 39.34497344714971 ], [ 145, 39.037140189409094 ], [ 150, 39.12233693477391 ], [ 155, 39.07175670268107 ], [ 160, 39.16422728448261 ], [ 165, 39.16546127195612 ], [ 170, 38.98290109889603 ], [ 175, 39.24206931511966 ], [ 180, 39.16054809780091 ], [ 185, 39.08284534284875 ], [ 190, 39.21131420947298 ], [ 195, 39.1728245496998 ], [ 200, 39.30327951967979 ], [ 205, 39.11189624806533 ], [ 210, 39.208001828036586 ], [ 215, 39.27087959009394 ], [ 220, 39.15907344150298 ], [ 225, 39.20100341588386 ], [ 230, 39.08744662681469 ], [ 235, 39.18588812980359 ], [ 240, 39.163364645602044 ], [ 245, 39.08450042698548 ], [ 250, 39.16458155422716 ], [ 255, 38.95708795900939 ], [ 260, 38.887105038428686 ], [ 265, 38.988759265035725 ], [ 270, 38.2456406287529 ], [ 275, 38.840658233008256 ], [ 280, 38.398313317320515 ], [ 285, 38.9033573525487 ], [ 290, 38.89762358610722 ], [ 295, 38.82352519049295 ], [ 300, 38.40288799974063 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAMS1_R1", "pairs": [ [ 1, 39.56105994404803 ], [ 2, 39.024172508094175 ], [ 3, 39.07107157451356 ], [ 4, 38.91151416087763 ], [ 5, 39.021594945462546 ], [ 6, 39.20422468802062 ], [ 7, 39.29764561657184 ], [ 8, 39.4240090529029 ], [ 9, 38.84537767579292 ], [ 10, 39.51984408889447 ], [ 15, 39.54902712727502 ], [ 20, 39.54984440323138 ], [ 25, 39.635658378650234 ], [ 30, 39.4349228302895 ], [ 35, 39.5567598151699 ], [ 40, 39.361870933266275 ], [ 45, 39.53742180869456 ], [ 50, 39.506352748876246 ], [ 55, 39.41318328985006 ], [ 60, 39.44430264357338 ], [ 65, 39.493251186621826 ], [ 70, 39.32964511363279 ], [ 75, 39.197549383053556 ], [ 80, 39.57964758955658 ], [ 85, 39.56791079863199 ], [ 90, 39.27570541538945 ], [ 95, 39.31516355824256 ], [ 100, 39.15934228314522 ], [ 105, 39.26329424340554 ], [ 110, 39.09201633655886 ], [ 115, 38.99888071433063 ], [ 120, 39.0919323398101 ], [ 125, 38.95770609318997 ], [ 130, 39.041934389274566 ], [ 135, 39.1337221549732 ], [ 140, 39.222093686004186 ], [ 145, 39.04967455900387 ], [ 150, 39.17406533974783 ], [ 155, 38.81771304435622 ], [ 160, 39.2293943777121 ], [ 165, 39.180919031251314 ], [ 170, 39.09541044952123 ], [ 175, 39.219710381912236 ], [ 180, 39.19124542066949 ], [ 185, 39.16204728084825 ], [ 190, 39.224828244565984 ], [ 195, 39.145000235875024 ], [ 200, 39.37138778488516 ], [ 205, 38.88307699679717 ], [ 210, 39.08156255897339 ], [ 215, 39.06231364408379 ], [ 220, 39.17474995282129 ], [ 225, 39.24669372902203 ], [ 230, 38.92052149024171 ], [ 235, 39.18481450610974 ], [ 240, 39.18788431597653 ], [ 245, 39.12909335837845 ], [ 250, 39.0750629089079 ], [ 255, 39.10426298514538 ], [ 260, 39.172571284777376 ], [ 265, 39.20911384335729 ], [ 270, 38.95749111383725 ], [ 275, 39.00024535245824 ], [ 280, 37.664999528168345 ], [ 285, 39.012613632789154 ], [ 290, 39.15316913591897 ], [ 295, 38.99465581920085 ], [ 300, 38.99202881669622 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAMS2_R1", "pairs": [ [ 1, 39.634095942785734 ], [ 2, 38.662146277484254 ], [ 3, 39.126641012633165 ], [ 4, 38.8931315655972 ], [ 5, 39.24978037342704 ], [ 6, 39.23517984632326 ], [ 7, 39.298778752521066 ], [ 8, 39.37475098677291 ], [ 9, 38.92950915007609 ], [ 10, 39.56113290191663 ], [ 15, 39.58117769336418 ], [ 20, 39.59412514383994 ], [ 25, 39.61085388336901 ], [ 30, 39.30744998082134 ], [ 35, 39.55697546369047 ], [ 40, 39.34273871243148 ], [ 45, 39.54472518498354 ], [ 50, 39.504842980524145 ], [ 55, 39.471454378974975 ], [ 60, 39.469835528403465 ], [ 65, 39.50526250665082 ], [ 70, 39.33376162104672 ], [ 75, 39.167729162542074 ], [ 80, 39.63637893486439 ], [ 85, 39.605994413282545 ], [ 90, 39.27315835715435 ], [ 95, 39.2674561631461 ], [ 100, 39.16623398960284 ], [ 105, 39.24778616507858 ], [ 110, 39.06342953878396 ], [ 115, 38.95550386474057 ], [ 120, 39.07645318977786 ], [ 125, 38.966684817583285 ], [ 130, 38.99519825751201 ], [ 135, 39.120964308697594 ], [ 140, 39.21492489202711 ], [ 145, 39.0399524758357 ], [ 150, 39.19070308535785 ], [ 155, 38.75218177919326 ], [ 160, 39.24186190423149 ], [ 165, 39.18783153256847 ], [ 170, 39.09439473260808 ], [ 175, 39.23048552581097 ], [ 180, 39.1814843656908 ], [ 185, 39.161464618975934 ], [ 190, 39.23416809453636 ], [ 195, 39.16506522028021 ], [ 200, 39.3929348857797 ], [ 205, 38.76401328799184 ], [ 210, 39.106232121141645 ], [ 215, 39.04246179972829 ], [ 220, 39.172363582333496 ], [ 225, 39.274096270957294 ], [ 230, 38.88124613060598 ], [ 235, 39.201436319060946 ], [ 240, 39.205366149192194 ], [ 245, 39.147667007407925 ], [ 250, 39.07432092342027 ], [ 255, 39.15231125475191 ], [ 260, 39.230382505541314 ], [ 265, 39.24313933220856 ], [ 270, 38.98205324215411 ], [ 275, 39.05471927087203 ], [ 280, 37.602288431532806 ], [ 285, 39.05849194457171 ], [ 290, 39.19687555162837 ], [ 295, 39.024707812077914 ], [ 300, 39.06660906155075 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCFS1_R1", "pairs": [ [ 1, 32.253275322643724 ], [ 2, 33.08409105722852 ], [ 3, 33.57861589101812 ], [ 4, 33.43613935601616 ], [ 5, 33.20550612697171 ], [ 6, 33.081100899491595 ], [ 7, 33.526235171424844 ], [ 8, 33.4587895971842 ], [ 9, 33.37884565245731 ], [ 10, 33.30504171555208 ], [ 15, 33.43514372311302 ], [ 20, 33.705292660670054 ], [ 25, 33.61881436579324 ], [ 30, 33.54735366966497 ], [ 35, 33.58114912319723 ], [ 40, 33.40020091104883 ], [ 45, 33.59607756864663 ], [ 50, 33.54410005703577 ], [ 55, 33.358851136641405 ], [ 60, 33.3136262036178 ], [ 65, 33.52280149934811 ], [ 70, 33.55627933507171 ], [ 75, 33.351525423728816 ], [ 80, 33.597628748370276 ], [ 85, 33.543685412716364 ], [ 90, 33.084128691570506 ], [ 95, 33.2938363901683 ], [ 100, 33.26897603157433 ], [ 105, 33.33632461120285 ], [ 110, 33.20806947591759 ], [ 115, 33.01300293446364 ], [ 120, 33.18251411480217 ], [ 125, 33.24598115704496 ], [ 130, 32.95612892663383 ], [ 135, 33.13443178388608 ], [ 140, 33.192854630972974 ], [ 145, 33.29038443886164 ], [ 150, 32.975342666927745 ], [ 155, 33.08657853140302 ], [ 160, 33.19095564809383 ], [ 165, 33.24561544445932 ], [ 170, 32.8346619835677 ], [ 175, 33.19733980817332 ], [ 180, 32.87155681666068 ], [ 185, 33.115271122832866 ], [ 190, 33.07363600703881 ], [ 195, 32.50577722558252 ], [ 200, 32.91284877891892 ], [ 205, 32.63165959215861 ], [ 210, 32.673100585273616 ], [ 215, 32.88575376205287 ], [ 220, 32.8827460642261 ], [ 225, 33.0211597081898 ], [ 230, 32.73026549977031 ], [ 235, 32.81412008693395 ], [ 240, 32.59401440461613 ], [ 245, 32.820859651096136 ], [ 250, 32.361775748334395 ], [ 255, 32.2760004502779 ], [ 260, 32.601715933135736 ], [ 265, 32.69998551732917 ], [ 270, 32.44702526467372 ], [ 275, 32.51144239383457 ], [ 280, 31.95149515291603 ], [ 285, 31.70308293179185 ], [ 290, 31.79897838405836 ], [ 295, 31.869485192265643 ], [ 300, 31.68210762670249 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCFS2_R1", "pairs": [ [ 1, 32.21792803535106 ], [ 2, 33.0892894718384 ], [ 3, 33.56460685978817 ], [ 4, 33.43124079399593 ], [ 5, 33.22621869958617 ], [ 6, 33.04371186084029 ], [ 7, 33.489079048888264 ], [ 8, 33.46336536438241 ], [ 9, 33.38211404923897 ], [ 10, 33.316728624535315 ], [ 15, 33.446531528372034 ], [ 20, 33.67405765588833 ], [ 25, 33.62130602511047 ], [ 30, 33.52965701059129 ], [ 35, 33.56783895630217 ], [ 40, 33.34668898232905 ], [ 45, 33.58548321479175 ], [ 50, 33.54063017311523 ], [ 55, 33.33990229099383 ], [ 60, 33.291959377434374 ], [ 65, 33.51113106680324 ], [ 70, 33.55169030015254 ], [ 75, 33.36199202315941 ], [ 80, 33.58414190357677 ], [ 85, 33.54048631531439 ], [ 90, 33.03936435890172 ], [ 95, 33.282904637270235 ], [ 100, 33.265046576454516 ], [ 105, 33.34187370396037 ], [ 110, 33.198508553577945 ], [ 115, 33.0557198805581 ], [ 120, 33.2173082750768 ], [ 125, 33.278037941031464 ], [ 130, 32.99581033247411 ], [ 135, 33.099023894468985 ], [ 140, 33.21539452952827 ], [ 145, 33.315047512069 ], [ 150, 32.970665261074586 ], [ 155, 33.1090019382497 ], [ 160, 33.2171448861443 ], [ 165, 33.24746306942102 ], [ 170, 32.83823240813668 ], [ 175, 33.19201970391081 ], [ 180, 32.94268096111443 ], [ 185, 33.13983402085506 ], [ 190, 33.072608783504485 ], [ 195, 32.518833767968474 ], [ 200, 32.898205883213635 ], [ 205, 32.62524063902331 ], [ 210, 32.659880989252365 ], [ 215, 32.86975946459571 ], [ 220, 32.8556493150895 ], [ 225, 32.98952883106857 ], [ 230, 32.69611142765832 ], [ 235, 32.748260362702375 ], [ 240, 32.53530539024841 ], [ 245, 32.794924892974464 ], [ 250, 32.27972291920664 ], [ 255, 32.263786704371356 ], [ 260, 32.51279293519032 ], [ 265, 32.67653394475966 ], [ 270, 32.32913286611533 ], [ 275, 32.44499884832012 ], [ 280, 31.922337945351767 ], [ 285, 31.513470988631525 ], [ 290, 31.718839715712612 ], [ 295, 31.769205963620664 ], [ 300, 31.56817737751156 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCMS1_R1", "pairs": [ [ 1, 32.22336653163907 ], [ 2, 33.056314367404696 ], [ 3, 33.58042692993599 ], [ 4, 33.43345512022145 ], [ 5, 33.18404164201275 ], [ 6, 33.058743208967265 ], [ 7, 33.50931193856314 ], [ 8, 33.44469730510305 ], [ 9, 33.340877775892814 ], [ 10, 33.27897831421017 ], [ 15, 33.414221343186625 ], [ 20, 33.69069054406879 ], [ 25, 33.59934955043674 ], [ 30, 33.53508496807749 ], [ 35, 33.56780438208596 ], [ 40, 33.42502391979711 ], [ 45, 33.59240916990814 ], [ 50, 33.516553008358855 ], [ 55, 33.35746668873624 ], [ 60, 33.3144020654092 ], [ 65, 33.51532935519379 ], [ 70, 33.547056771305094 ], [ 75, 33.340927492931236 ], [ 80, 33.59269897935702 ], [ 85, 33.54211011035072 ], [ 90, 33.14807123258191 ], [ 95, 33.30665835021631 ], [ 100, 33.25019204244724 ], [ 105, 33.30416305439349 ], [ 110, 33.174384753699904 ], [ 115, 32.98090167543741 ], [ 120, 33.120028664277086 ], [ 125, 33.21626054042737 ], [ 130, 32.8801670052715 ], [ 135, 33.13193476874602 ], [ 140, 33.18382830930753 ], [ 145, 33.27106631774215 ], [ 150, 32.94864182194617 ], [ 155, 33.06558941210015 ], [ 160, 33.17279485047321 ], [ 165, 33.22118846689643 ], [ 170, 32.80711762601063 ], [ 175, 33.182327801527194 ], [ 180, 32.86355171706284 ], [ 185, 33.07062262521469 ], [ 190, 33.04258205433503 ], [ 195, 32.4539957043746 ], [ 200, 32.906003774195 ], [ 205, 32.58455564675518 ], [ 210, 32.579033446649795 ], [ 215, 32.84447138860817 ], [ 220, 32.844796913152685 ], [ 225, 32.99183858503928 ], [ 230, 32.701424914463715 ], [ 235, 32.8002231114766 ], [ 240, 32.606545520820816 ], [ 245, 32.79699441215821 ], [ 250, 32.40559336466298 ], [ 255, 32.30002112614795 ], [ 260, 32.6082285638538 ], [ 265, 32.649966239027684 ], [ 270, 32.41587416509857 ], [ 275, 32.462047964417465 ], [ 280, 31.947115288049282 ], [ 285, 31.695715134675886 ], [ 290, 31.7444058067929 ], [ 295, 31.86402415439942 ], [ 300, 31.53919808547557 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCMS2_R1", "pairs": [ [ 1, 32.15791764418637 ], [ 2, 33.051315803441575 ], [ 3, 33.58089616883048 ], [ 4, 33.438572838929524 ], [ 5, 33.218118703623105 ], [ 6, 33.03999957537606 ], [ 7, 33.50412416004077 ], [ 8, 33.457128905213324 ], [ 9, 33.36309593316419 ], [ 10, 33.31169520493413 ], [ 15, 33.43075551214955 ], [ 20, 33.66258319975372 ], [ 25, 33.59595970318786 ], [ 30, 33.53092217704695 ], [ 35, 33.5643506047995 ], [ 40, 33.408730042525995 ], [ 45, 33.58931531462006 ], [ 50, 33.52810857876956 ], [ 55, 33.37192750715344 ], [ 60, 33.3162286089581 ], [ 65, 33.50472943550529 ], [ 70, 33.54799796078764 ], [ 75, 33.35790974597684 ], [ 80, 33.585534871685965 ], [ 85, 33.54082453795491 ], [ 90, 33.13170797082735 ], [ 95, 33.313117179283 ], [ 100, 33.261410882883744 ], [ 105, 33.30767817687021 ], [ 110, 33.179461217208186 ], [ 115, 33.015596243145445 ], [ 120, 33.13040404786143 ], [ 125, 33.24240838035224 ], [ 130, 32.917727149684126 ], [ 135, 33.08502018505568 ], [ 140, 33.19846117300581 ], [ 145, 33.28631741385785 ], [ 150, 32.96322545825784 ], [ 155, 33.07870361154788 ], [ 160, 33.197644938966334 ], [ 165, 33.222610961500145 ], [ 170, 32.809388333386764 ], [ 175, 33.18851240805331 ], [ 180, 32.931903960805236 ], [ 185, 33.09991856829033 ], [ 190, 33.048412695430066 ], [ 195, 32.48753299166047 ], [ 200, 32.883774263314066 ], [ 205, 32.55972395117469 ], [ 210, 32.531924896618264 ], [ 215, 32.83839014968833 ], [ 220, 32.841568812062896 ], [ 225, 32.984399254563336 ], [ 230, 32.68507879557349 ], [ 235, 32.72954911317367 ], [ 240, 32.58957834105668 ], [ 245, 32.77044298912608 ], [ 250, 32.35332233217908 ], [ 255, 32.29678953624473 ], [ 260, 32.56928492424188 ], [ 265, 32.61855985295766 ], [ 270, 32.32619131585229 ], [ 275, 32.3918686583406 ], [ 280, 31.905441381473274 ], [ 285, 31.53043597913001 ], [ 290, 31.675257013812974 ], [ 295, 31.802608308571543 ], [ 300, 31.473507818308306 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPFS1_R1", "pairs": [ [ 1, 32.19252173177982 ], [ 2, 33.060729229772186 ], [ 3, 33.60810239648347 ], [ 4, 33.394003860296706 ], [ 5, 33.16046295383141 ], [ 6, 33.05814395807211 ], [ 7, 33.5078121697967 ], [ 8, 33.4460755998253 ], [ 9, 33.35635892306175 ], [ 10, 33.2827935023035 ], [ 15, 33.46386114202792 ], [ 20, 33.68701024246608 ], [ 25, 33.61379562969329 ], [ 30, 33.52830555516421 ], [ 35, 33.57078854309021 ], [ 40, 33.38768851308963 ], [ 45, 33.57865608129753 ], [ 50, 33.5291574243716 ], [ 55, 33.414672875469364 ], [ 60, 33.3374864014627 ], [ 65, 33.50782815853349 ], [ 70, 33.498150718225816 ], [ 75, 33.36097769632921 ], [ 80, 33.591320790762 ], [ 85, 33.5416286899112 ], [ 90, 33.121677434809875 ], [ 95, 33.28514796601816 ], [ 100, 33.259133792248235 ], [ 105, 33.36903393280049 ], [ 110, 33.22919678572116 ], [ 115, 33.05218491635577 ], [ 120, 33.14657094502869 ], [ 125, 33.22913188960314 ], [ 130, 32.94961401632835 ], [ 135, 33.12249746746606 ], [ 140, 33.1952598871022 ], [ 145, 33.28419924711323 ], [ 150, 32.964314813106924 ], [ 155, 33.059999528784154 ], [ 160, 33.222291696088476 ], [ 165, 33.2582344696701 ], [ 170, 32.864321144254674 ], [ 175, 33.23282636355349 ], [ 180, 33.06557627714221 ], [ 185, 33.18138511732285 ], [ 190, 33.1355025192541 ], [ 195, 32.52021291546097 ], [ 200, 32.96630177180905 ], [ 205, 32.5413396728141 ], [ 210, 32.60446651616375 ], [ 215, 32.93365925049 ], [ 220, 32.89838246993516 ], [ 225, 33.04879537269915 ], [ 230, 32.709163003675926 ], [ 235, 32.850264934771715 ], [ 240, 32.64262653109419 ], [ 245, 32.847090283069456 ], [ 250, 32.47692546496204 ], [ 255, 32.378792991067485 ], [ 260, 32.70344991361005 ], [ 265, 32.77746834708678 ], [ 270, 32.43219333215735 ], [ 275, 32.55010998781504 ], [ 280, 32.02188131282626 ], [ 285, 31.840760499901783 ], [ 290, 31.841295128769126 ], [ 295, 31.95735054624697 ], [ 300, 31.789199427022744 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPFS2_R1", "pairs": [ [ 1, 32.127313465599855 ], [ 2, 33.01946149711976 ], [ 3, 33.55945559281491 ], [ 4, 33.36627128009871 ], [ 5, 33.11377141256708 ], [ 6, 33.02430605494031 ], [ 7, 33.480156236989714 ], [ 8, 33.425473290590205 ], [ 9, 33.33212471708539 ], [ 10, 33.2533779436366 ], [ 15, 33.44714511721559 ], [ 20, 33.66890777930011 ], [ 25, 33.5947194319756 ], [ 30, 33.51410901769021 ], [ 35, 33.551433765068865 ], [ 40, 33.37425022027663 ], [ 45, 33.568405566159996 ], [ 50, 33.5172512472651 ], [ 55, 33.4069438030419 ], [ 60, 33.31932330349047 ], [ 65, 33.50352308046846 ], [ 70, 33.4769454289195 ], [ 75, 33.34039530115452 ], [ 80, 33.57355113175795 ], [ 85, 33.5326938300056 ], [ 90, 33.07082158984149 ], [ 95, 33.26652239511503 ], [ 100, 33.24720345217587 ], [ 105, 33.35515245654284 ], [ 110, 33.19877219010834 ], [ 115, 33.026365165559284 ], [ 120, 33.136967490707775 ], [ 125, 33.2305448554839 ], [ 130, 32.93483630017754 ], [ 135, 33.07621773183524 ], [ 140, 33.18566015656621 ], [ 145, 33.271294071927684 ], [ 150, 32.94788239616203 ], [ 155, 33.05715895263218 ], [ 160, 33.20966238137518 ], [ 165, 33.24184448762135 ], [ 170, 32.84406046706556 ], [ 175, 33.19628466399137 ], [ 180, 33.0105522459002 ], [ 185, 33.14272399683063 ], [ 190, 33.08539999546737 ], [ 195, 32.492188339030534 ], [ 200, 32.91862949731014 ], [ 205, 32.48702308514847 ], [ 210, 32.560475250521854 ], [ 215, 32.89064620336781 ], [ 220, 32.8466937003619 ], [ 225, 32.99889194242603 ], [ 230, 32.65654718964047 ], [ 235, 32.76303355628572 ], [ 240, 32.58119827350521 ], [ 245, 32.79758427028602 ], [ 250, 32.399106120603605 ], [ 255, 32.30073430668063 ], [ 260, 32.658389505855 ], [ 265, 32.71418221126696 ], [ 270, 32.36050270659016 ], [ 275, 32.46119379221721 ], [ 280, 31.92300533383197 ], [ 285, 31.71058029801382 ], [ 290, 31.74716135959481 ], [ 295, 31.87113899890225 ], [ 300, 31.722210451158805 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPMS1_R1", "pairs": [ [ 1, 32.61642866724388 ], [ 2, 33.447971415679916 ], [ 3, 33.62634293867298 ], [ 4, 32.696437935197494 ], [ 5, 32.82987207785081 ], [ 6, 33.398143970342545 ], [ 7, 32.563076960599005 ], [ 8, 33.5617355462605 ], [ 9, 33.668231650061585 ], [ 10, 33.24106679023938 ], [ 15, 33.54405814421424 ], [ 20, 33.60941916759143 ], [ 25, 33.472982695755036 ], [ 30, 33.57651793227077 ], [ 35, 33.62947997644746 ], [ 40, 33.592838233840254 ], [ 45, 33.75575365853659 ], [ 50, 33.62427946042514 ], [ 55, 33.61838902747539 ], [ 60, 33.455210882158966 ], [ 65, 33.64914007852328 ], [ 70, 33.60284034064567 ], [ 75, 33.633878472769595 ], [ 80, 33.73965519345039 ], [ 85, 33.769020918213606 ], [ 90, 33.04553542009885 ], [ 95, 33.59310214458313 ], [ 100, 33.59751160899754 ], [ 105, 33.62575002646321 ], [ 110, 33.38065864293248 ], [ 115, 33.48168990014892 ], [ 120, 33.5410138390298 ], [ 125, 33.642191490677064 ], [ 130, 33.27037428765409 ], [ 135, 33.52376999145404 ], [ 140, 33.57181735996071 ], [ 145, 33.5170456072626 ], [ 150, 33.38628825643802 ], [ 155, 33.31873693603725 ], [ 160, 33.54415673246042 ], [ 165, 33.52196730879556 ], [ 170, 32.781732040225876 ], [ 175, 33.491797596667354 ], [ 180, 33.3967962542081 ], [ 185, 33.5035466471979 ], [ 190, 33.450868431359346 ], [ 195, 33.009059313379005 ], [ 200, 33.507882178905405 ], [ 205, 32.98718078658597 ], [ 210, 33.06940101704166 ], [ 215, 33.418418849232026 ], [ 220, 33.2544491862214 ], [ 225, 33.255712318493785 ], [ 230, 32.73593767985676 ], [ 235, 33.44761893114834 ], [ 240, 33.22709795768619 ], [ 245, 33.320021826053036 ], [ 250, 33.1749005611004 ], [ 255, 32.92628720984273 ], [ 260, 33.13416808444025 ], [ 265, 32.975563464388316 ], [ 270, 32.947319648670124 ], [ 275, 32.965274192956485 ], [ 280, 32.51019925300973 ], [ 285, 32.644264481008015 ], [ 290, 32.833057912440985 ], [ 295, 32.49086914138614 ], [ 300, 31.578252742699 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPMS2_R1", "pairs": [ [ 1, 32.06059453854131 ], [ 2, 33.028413411683374 ], [ 3, 33.52794100702846 ], [ 4, 33.315531743288396 ], [ 5, 33.17631063486577 ], [ 6, 33.00584168683028 ], [ 7, 33.47156354418712 ], [ 8, 33.41576218458348 ], [ 9, 33.37351077313055 ], [ 10, 33.32868302799862 ], [ 15, 33.3736628643853 ], [ 20, 33.615010945961515 ], [ 25, 33.501970273072935 ], [ 30, 33.44137112570573 ], [ 35, 33.525620463186996 ], [ 40, 33.424502218225484 ], [ 45, 33.574080374780166 ], [ 50, 33.4641163321273 ], [ 55, 33.40617150231604 ], [ 60, 33.35684987415196 ], [ 65, 33.44332104171468 ], [ 70, 33.459416916340174 ], [ 75, 33.333117187557214 ], [ 80, 33.562425080682345 ], [ 85, 33.51347807050227 ], [ 90, 33.147670424418465 ], [ 95, 33.324124814127465 ], [ 100, 33.241852154968704 ], [ 105, 33.356349185906495 ], [ 110, 33.1404270156638 ], [ 115, 32.96767645784014 ], [ 120, 33.13691965366568 ], [ 125, 33.13759396298009 ], [ 130, 32.96217095144749 ], [ 135, 33.08479823091807 ], [ 140, 33.13749375400197 ], [ 145, 33.15379310344828 ], [ 150, 33.00709491408142 ], [ 155, 33.02199757140387 ], [ 160, 33.09987505173929 ], [ 165, 33.14509855221926 ], [ 170, 32.72660625083593 ], [ 175, 33.025920556935276 ], [ 180, 32.85224902555974 ], [ 185, 33.02887715668644 ], [ 190, 32.97106444842018 ], [ 195, 32.457252524966634 ], [ 200, 32.818892379155116 ], [ 205, 32.45893982246365 ], [ 210, 32.46480053346205 ], [ 215, 32.771148374598695 ], [ 220, 32.83381833298691 ], [ 225, 32.948796545278014 ], [ 230, 32.68114231604231 ], [ 235, 32.72997033314998 ], [ 240, 32.62919568104394 ], [ 245, 32.71825898304444 ], [ 250, 32.368972087813106 ], [ 255, 32.23229671702235 ], [ 260, 32.52820058554174 ], [ 265, 32.44772375562998 ], [ 270, 32.27813142395196 ], [ 275, 32.131785250749296 ], [ 280, 31.696974694769303 ], [ 285, 31.77106248653022 ], [ 290, 31.81132005729335 ], [ 295, 31.657747904886026 ], [ 300, 30.446561165741347 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVFS1_R1", "pairs": [ [ 1, 32.251792662590326 ], [ 2, 33.128529738743744 ], [ 3, 33.61357698721512 ], [ 4, 33.41988604780433 ], [ 5, 33.220136186770425 ], [ 6, 33.11514730405781 ], [ 7, 33.52602834908282 ], [ 8, 33.50220956086715 ], [ 9, 33.38155919955531 ], [ 10, 33.28310172317954 ], [ 15, 33.42952751528627 ], [ 20, 33.665214007782104 ], [ 25, 33.55327404113396 ], [ 30, 33.52937743190661 ], [ 35, 33.56265425236242 ], [ 40, 33.50938869897874 ], [ 45, 33.61877206148031 ], [ 50, 33.52097334556269 ], [ 55, 33.41973095416771 ], [ 60, 33.367494566362836 ], [ 65, 33.506575672277805 ], [ 70, 33.54037979394749 ], [ 75, 33.370247658226084 ], [ 80, 33.59054013598142 ], [ 85, 33.54049932706638 ], [ 90, 33.12860677155724 ], [ 95, 33.344281230992905 ], [ 100, 33.281525805339015 ], [ 105, 33.410760848414085 ], [ 110, 33.22619634366182 ], [ 115, 32.98066695394709 ], [ 120, 33.27128146556183 ], [ 125, 33.212428312101046 ], [ 130, 33.02361516469415 ], [ 135, 33.13309330867912 ], [ 140, 33.20810907310051 ], [ 145, 33.24483501814592 ], [ 150, 33.11509024668354 ], [ 155, 33.1023312918946 ], [ 160, 33.1939619807818 ], [ 165, 33.22670142550534 ], [ 170, 32.81536418914709 ], [ 175, 33.1634709246629 ], [ 180, 32.943029115105425 ], [ 185, 33.09333640374048 ], [ 190, 33.094793963165756 ], [ 195, 32.685183848855225 ], [ 200, 32.926871278312646 ], [ 205, 32.4942349565901 ], [ 210, 32.67683160148006 ], [ 215, 32.964508753364484 ], [ 220, 32.95756825202461 ], [ 225, 33.01829085775901 ], [ 230, 32.800236331538656 ], [ 235, 32.86311399477676 ], [ 240, 32.725830912407886 ], [ 245, 32.82986401489896 ], [ 250, 32.5437717466945 ], [ 255, 32.25576339596381 ], [ 260, 32.68097425191371 ], [ 265, 32.586471119227426 ], [ 270, 32.519655383587576 ], [ 275, 32.397493383897164 ], [ 280, 31.890597897519655 ], [ 285, 31.950036205768008 ], [ 290, 32.09378218192718 ], [ 295, 31.95980480403681 ], [ 300, 31.16584870475711 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVFS2_R1", "pairs": [ [ 1, 32.25788301604194 ], [ 2, 33.09889243624611 ], [ 3, 33.59187655196878 ], [ 4, 33.42975247329628 ], [ 5, 33.18367427377715 ], [ 6, 33.097089196326515 ], [ 7, 33.53597611446139 ], [ 8, 33.465856686768355 ], [ 9, 33.38489811201766 ], [ 10, 33.2992649087541 ], [ 15, 33.46600055181112 ], [ 20, 33.68056639470261 ], [ 25, 33.58857750975523 ], [ 30, 33.53470497812463 ], [ 35, 33.5717018435606 ], [ 40, 33.44074771143935 ], [ 45, 33.609148510558626 ], [ 50, 33.53066485351938 ], [ 55, 33.3770183581163 ], [ 60, 33.34730779547986 ], [ 65, 33.493784676028575 ], [ 70, 33.54317023897512 ], [ 75, 33.35607291836391 ], [ 80, 33.58587604584471 ], [ 85, 33.54488249154122 ], [ 90, 33.114461272991 ], [ 95, 33.325738787580086 ], [ 100, 33.268121374151626 ], [ 105, 33.37053164805934 ], [ 110, 33.2271347926292 ], [ 115, 33.0032044328665 ], [ 120, 33.25715328107282 ], [ 125, 33.23947982530526 ], [ 130, 33.04021115658724 ], [ 135, 33.123467699254434 ], [ 140, 33.18982679754127 ], [ 145, 33.2630184846205 ], [ 150, 33.06768247832757 ], [ 155, 33.097873094410076 ], [ 160, 33.192752446869214 ], [ 165, 33.22811647289603 ], [ 170, 32.821865741547136 ], [ 175, 33.18675456108794 ], [ 180, 32.948939490758335 ], [ 185, 33.127644870088055 ], [ 190, 33.090583667769494 ], [ 195, 32.614480540703084 ], [ 200, 32.90826085109696 ], [ 205, 32.527314674097035 ], [ 210, 32.67891532912661 ], [ 215, 32.93673062393784 ], [ 220, 32.9270192757247 ], [ 225, 33.01614697577187 ], [ 230, 32.74984391336376 ], [ 235, 32.82474881143767 ], [ 240, 32.661927023493526 ], [ 245, 32.82060814784328 ], [ 250, 32.44081458810012 ], [ 255, 32.27794227673618 ], [ 260, 32.65148630689667 ], [ 265, 32.65690109273267 ], [ 270, 32.4660608872061 ], [ 275, 32.456265040274026 ], [ 280, 31.94230243009028 ], [ 285, 31.845209607323504 ], [ 290, 31.981661297093137 ], [ 295, 31.88061874211049 ], [ 300, 31.446468891172945 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVMS1_R1", "pairs": [ [ 1, 32.22434115724803 ], [ 2, 33.10411252931707 ], [ 3, 33.60734117533568 ], [ 4, 33.40529003551209 ], [ 5, 33.18303498754967 ], [ 6, 33.11552583821197 ], [ 7, 33.524831332637966 ], [ 8, 33.48836059544553 ], [ 9, 33.34224853640743 ], [ 10, 33.24509613587445 ], [ 15, 33.40514895182052 ], [ 20, 33.5492689573674 ], [ 25, 33.407872952326976 ], [ 30, 33.4510035632676 ], [ 35, 33.52742081783862 ], [ 40, 33.54079855484134 ], [ 45, 33.59633997805193 ], [ 50, 33.44514094485815 ], [ 55, 33.384052579215535 ], [ 60, 33.391716253308765 ], [ 65, 33.42678743587359 ], [ 70, 33.48955582731275 ], [ 75, 33.36074362569363 ], [ 80, 33.577722084070075 ], [ 85, 33.53400525271067 ], [ 90, 33.20594139432763 ], [ 95, 33.41737669944936 ], [ 100, 33.27737919303176 ], [ 105, 33.42112022017447 ], [ 110, 33.131827568419986 ], [ 115, 33.080452420449404 ], [ 120, 33.15015412456643 ], [ 125, 33.15181956510624 ], [ 130, 33.07294888899118 ], [ 135, 33.1378241050708 ], [ 140, 33.23067550114975 ], [ 145, 33.127022881727086 ], [ 150, 33.14719877391676 ], [ 155, 32.96730544222897 ], [ 160, 33.02097889623962 ], [ 165, 33.125817597838505 ], [ 170, 32.68915497793821 ], [ 175, 32.98238590840981 ], [ 180, 32.90190982779815 ], [ 185, 32.974603901304576 ], [ 190, 33.001534201494856 ], [ 195, 32.759536225952004 ], [ 200, 32.815669329218416 ], [ 205, 32.589584856227184 ], [ 210, 32.41958312041682 ], [ 215, 32.88963575748339 ], [ 220, 32.95435505566818 ], [ 225, 32.975887861795584 ], [ 230, 32.77057584801859 ], [ 235, 32.824773180308064 ], [ 240, 32.767842992016575 ], [ 245, 32.67986759207243 ], [ 250, 32.50840761697123 ], [ 255, 32.37334714548548 ], [ 260, 32.494874461027244 ], [ 265, 32.276036745674126 ], [ 270, 32.32921905684354 ], [ 275, 31.896689581045884 ], [ 280, 31.76818141088284 ], [ 285, 31.933858486079078 ], [ 290, 31.946776339152137 ], [ 295, 31.65101680796562 ], [ 300, 29.571489512647318 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVMS2_R1", "pairs": [ [ 1, 32.268435790610894 ], [ 2, 33.10439652549687 ], [ 3, 33.61469399412638 ], [ 4, 33.43864670710733 ], [ 5, 33.20665718773866 ], [ 6, 33.11138775231437 ], [ 7, 33.555274775082424 ], [ 8, 33.48870289769587 ], [ 9, 33.362966366362635 ], [ 10, 33.27531525714179 ], [ 15, 33.444644509155026 ], [ 20, 33.61935812342061 ], [ 25, 33.49171173296742 ], [ 30, 33.50223582662254 ], [ 35, 33.548184268471445 ], [ 40, 33.53309421760623 ], [ 45, 33.61148225563812 ], [ 50, 33.47647734540419 ], [ 55, 33.38816873000157 ], [ 60, 33.38134805345117 ], [ 65, 33.47661727996423 ], [ 70, 33.515761720027186 ], [ 75, 33.35902722268209 ], [ 80, 33.589876291626474 ], [ 85, 33.53961063821058 ], [ 90, 33.212485867985244 ], [ 95, 33.38453615932216 ], [ 100, 33.27467627678386 ], [ 105, 33.40736104730927 ], [ 110, 33.175202596674396 ], [ 115, 33.03334077353411 ], [ 120, 33.267122909225705 ], [ 125, 33.18290065233335 ], [ 130, 33.03674088544602 ], [ 135, 33.14300671150836 ], [ 140, 33.222807276263254 ], [ 145, 33.197184673966056 ], [ 150, 33.11978176936259 ], [ 155, 33.058913108242386 ], [ 160, 33.18459236418139 ], [ 165, 33.183822773653105 ], [ 170, 32.77941101255323 ], [ 175, 33.121182076323336 ], [ 180, 32.93712064549356 ], [ 185, 33.03592404639264 ], [ 190, 33.07843685628147 ], [ 195, 32.73084595676939 ], [ 200, 32.87716090838992 ], [ 205, 32.53371602394286 ], [ 210, 32.61335703588889 ], [ 215, 32.941602222888925 ], [ 220, 32.95482966731638 ], [ 225, 32.98104212954759 ], [ 230, 32.74954112979175 ], [ 235, 32.833127587389676 ], [ 240, 32.74370433967785 ], [ 245, 32.74345952473559 ], [ 250, 32.52375300901304 ], [ 255, 32.3093669720776 ], [ 260, 32.595152095336246 ], [ 265, 32.43103010699179 ], [ 270, 32.3897944551789 ], [ 275, 32.201308189632115 ], [ 280, 31.871123781654866 ], [ 285, 31.91411841981907 ], [ 290, 31.98129025002934 ], [ 295, 31.77154286825253 ], [ 300, 30.7280168411702 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAFS1_R1", "pairs": [ [ 1, 39.788353740834864 ], [ 2, 39.319913425177226 ], [ 3, 39.36574214807699 ], [ 4, 39.243734876764634 ], [ 5, 39.31387021072214 ], [ 6, 39.33281453289722 ], [ 7, 39.4016852907917 ], [ 8, 39.50525893410829 ], [ 9, 39.01348475821062 ], [ 10, 39.598895927821886 ], [ 15, 39.48964141972982 ], [ 20, 39.476227185953476 ], [ 25, 39.62235381379118 ], [ 30, 39.52425189382425 ], [ 35, 39.63658029450032 ], [ 40, 39.54542867912598 ], [ 45, 39.495098551817215 ], [ 50, 39.56518384373286 ], [ 55, 39.47777068475994 ], [ 60, 39.47923468364127 ], [ 65, 39.2823000832923 ], [ 70, 39.45091773517914 ], [ 75, 39.46406940619281 ], [ 80, 39.51373350113387 ], [ 85, 39.59854816057782 ], [ 90, 39.487580936399944 ], [ 95, 39.38407962013849 ], [ 100, 39.286148584669704 ], [ 105, 39.361108949416334 ], [ 110, 39.367611867704284 ], [ 115, 39.25305447470818 ], [ 120, 39.16845817120623 ], [ 125, 39.29911478599222 ], [ 130, 39.307636186770424 ], [ 135, 38.89749027237354 ], [ 140, 39.39808365758755 ], [ 145, 38.99767996108949 ], [ 150, 39.161702334630355 ], [ 155, 39.26900217581856 ], [ 160, 39.23548173323039 ], [ 165, 39.26097313334833 ], [ 170, 39.09054894545808 ], [ 175, 39.345210026811934 ], [ 180, 39.27976215808705 ], [ 185, 39.226634403176085 ], [ 190, 39.23743699803622 ], [ 195, 39.190119103350575 ], [ 200, 39.41689820584999 ], [ 205, 39.22213534858554 ], [ 210, 39.322422923291114 ], [ 215, 39.30781193951812 ], [ 220, 39.2995628621283 ], [ 225, 39.34042886933894 ], [ 230, 39.164080520917565 ], [ 235, 39.224713185269856 ], [ 240, 39.2655743286377 ], [ 245, 39.16616710947902 ], [ 250, 39.26161029675521 ], [ 255, 38.91756151241192 ], [ 260, 39.08552945968786 ], [ 265, 38.75285233981238 ], [ 270, 38.132089810857316 ], [ 275, 38.836709853537535 ], [ 280, 38.471201794757995 ], [ 285, 38.975932489861925 ], [ 290, 38.90593579493599 ], [ 295, 38.9412643574761 ], [ 300, 38.60164353609776 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAFS2_R1", "pairs": [ [ 1, 39.721281840591615 ], [ 2, 39.303658488868024 ], [ 3, 39.22022146574324 ], [ 4, 38.9781586258168 ], [ 5, 39.30473842782799 ], [ 6, 39.30805650115428 ], [ 7, 39.36640450757131 ], [ 8, 39.40985248659858 ], [ 9, 38.99938177407364 ], [ 10, 39.5967100989944 ], [ 15, 39.49561529130962 ], [ 20, 39.45493446022617 ], [ 25, 39.617388582384464 ], [ 30, 39.491583519192396 ], [ 35, 39.62607817818993 ], [ 40, 39.57792855186447 ], [ 45, 39.433967993113434 ], [ 50, 39.552872072357715 ], [ 55, 39.41682213735679 ], [ 60, 39.346722594378015 ], [ 65, 39.48028548175046 ], [ 70, 39.38885619482877 ], [ 75, 39.41391097476993 ], [ 80, 39.47326738871847 ], [ 85, 39.58063607337382 ], [ 90, 39.44543917861391 ], [ 95, 39.22439116008265 ], [ 100, 39.35638890627935 ], [ 105, 39.3635322106054 ], [ 110, 39.35419770863332 ], [ 115, 39.32848556939835 ], [ 120, 39.174970262317665 ], [ 125, 39.36445877418143 ], [ 130, 39.343097727415014 ], [ 135, 39.050848306517246 ], [ 140, 39.40772553684342 ], [ 145, 38.96902898641458 ], [ 150, 39.23419520440744 ], [ 155, 39.233562887372436 ], [ 160, 39.37922118575095 ], [ 165, 39.276078382270086 ], [ 170, 38.99635009077819 ], [ 175, 39.2901959556752 ], [ 180, 39.34808113691855 ], [ 185, 39.25225067301071 ], [ 190, 39.3366806485945 ], [ 195, 39.25730920929068 ], [ 200, 39.48466161647781 ], [ 205, 39.28546296875978 ], [ 210, 39.354535779127275 ], [ 215, 39.34694797470731 ], [ 220, 39.26260564702936 ], [ 225, 39.37410630438866 ], [ 230, 39.19045889939273 ], [ 235, 39.35234458148125 ], [ 240, 39.25115507418769 ], [ 245, 39.243717523320605 ], [ 250, 39.37962186189195 ], [ 255, 39.19328867463845 ], [ 260, 39.09584924560196 ], [ 265, 39.15836724472548 ], [ 270, 37.325403222650905 ], [ 275, 39.125682690832 ], [ 280, 38.191499518707786 ], [ 285, 39.08199810613471 ], [ 290, 38.98045340243062 ], [ 295, 38.910479631707595 ], [ 300, 38.274739092409305 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAMS1_R1", "pairs": [ [ 1, 39.754906742239505 ], [ 2, 39.072813550385554 ], [ 3, 39.18668687800699 ], [ 4, 39.077651090753314 ], [ 5, 39.19433203717129 ], [ 6, 39.355407631977855 ], [ 7, 39.33194490212878 ], [ 8, 39.43958347063863 ], [ 9, 38.977077703815986 ], [ 10, 39.57473933961642 ], [ 15, 39.45421999604561 ], [ 20, 39.421498714822384 ], [ 25, 39.59412113622883 ], [ 30, 39.487921966651285 ], [ 35, 39.6167191722138 ], [ 40, 39.54403216239373 ], [ 45, 39.44008963290055 ], [ 50, 39.53756155979276 ], [ 55, 39.40749508983299 ], [ 60, 39.43560892661772 ], [ 65, 39.34212989204224 ], [ 70, 39.3855502682467 ], [ 75, 39.41075359529678 ], [ 80, 39.449270395317875 ], [ 85, 39.56779457706655 ], [ 90, 39.43643673464008 ], [ 95, 39.281794814336365 ], [ 100, 39.27366436866456 ], [ 105, 39.32355957449613 ], [ 110, 39.327666978632536 ], [ 115, 39.25593767712851 ], [ 120, 39.11940735272795 ], [ 125, 39.3071879572387 ], [ 130, 39.3015936622596 ], [ 135, 38.90092930677669 ], [ 140, 39.37434288576626 ], [ 145, 38.919000290000255 ], [ 150, 39.166750151591046 ], [ 155, 39.236376578524165 ], [ 160, 39.282787166170145 ], [ 165, 39.247813134375576 ], [ 170, 39.02404365822151 ], [ 175, 39.292536447760405 ], [ 180, 39.29340644855132 ], [ 185, 39.206192662890864 ], [ 190, 39.26434884625271 ], [ 195, 39.19898762877085 ], [ 200, 39.41984801249646 ], [ 205, 39.24263559249421 ], [ 210, 39.311909202955384 ], [ 215, 39.29866928547419 ], [ 220, 39.24706471662174 ], [ 225, 39.342095792991174 ], [ 230, 39.15195982151684 ], [ 235, 39.25191038932792 ], [ 240, 39.232664790440474 ], [ 245, 39.11880993652907 ], [ 250, 39.26895197168525 ], [ 255, 38.97911325244031 ], [ 260, 39.047548492977334 ], [ 265, 38.86532167173071 ], [ 270, 37.76919254167134 ], [ 275, 38.939082406754416 ], [ 280, 38.30692033695108 ], [ 285, 38.98284494008779 ], [ 290, 38.95304173187122 ], [ 295, 38.97375869851111 ], [ 300, 38.40188593522383 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAMS2_R1", "pairs": [ [ 1, 39.70974398871256 ], [ 2, 39.331205949641664 ], [ 3, 39.33749579687881 ], [ 4, 39.04486625833207 ], [ 5, 39.2144943397968 ], [ 6, 39.38897496588054 ], [ 7, 39.38201261925326 ], [ 8, 39.438476195499526 ], [ 9, 39.03603146242245 ], [ 10, 39.59523448471382 ], [ 15, 39.49221812715513 ], [ 20, 39.44112399701991 ], [ 25, 39.61226058692055 ], [ 30, 39.51065252220237 ], [ 35, 39.6055619655443 ], [ 40, 39.5652172766412 ], [ 45, 39.51119052171448 ], [ 50, 39.48853487003831 ], [ 55, 39.43685320955747 ], [ 60, 39.414388944564585 ], [ 65, 39.42505406403292 ], [ 70, 39.42876929815784 ], [ 75, 39.46145011241437 ], [ 80, 39.44331085045922 ], [ 85, 39.576346170329195 ], [ 90, 39.46886616426344 ], [ 95, 39.38241061244404 ], [ 100, 39.29782947358642 ], [ 105, 39.37010008835203 ], [ 110, 39.3718249310986 ], [ 115, 39.27707462450384 ], [ 120, 39.243284585866306 ], [ 125, 39.31417720517453 ], [ 130, 39.320907784210036 ], [ 135, 39.074835493782395 ], [ 140, 39.40789503181354 ], [ 145, 39.07411202320905 ], [ 150, 39.191417927669534 ], [ 155, 39.21762305080276 ], [ 160, 39.20536445455444 ], [ 165, 39.23983516302377 ], [ 170, 39.09466257870966 ], [ 175, 39.351359905053904 ], [ 180, 39.26013780371213 ], [ 185, 39.18167540302641 ], [ 190, 39.268060528137674 ], [ 195, 39.233188936142156 ], [ 200, 39.361703754986316 ], [ 205, 39.21997560412752 ], [ 210, 39.28169584281146 ], [ 215, 39.3443127946461 ], [ 220, 39.23417532060792 ], [ 225, 39.30236571502817 ], [ 230, 39.157879744957505 ], [ 235, 39.235220656595956 ], [ 240, 39.256984986252235 ], [ 245, 39.0502818786636 ], [ 250, 39.249035678256114 ], [ 255, 38.98198218394973 ], [ 260, 38.972761619664915 ], [ 265, 38.889386196846914 ], [ 270, 38.32393034465024 ], [ 275, 38.84541444405615 ], [ 280, 38.577944230883354 ], [ 285, 38.96403689808191 ], [ 290, 38.94588572315299 ], [ 295, 38.93559371906413 ], [ 300, 38.401412175468835 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICFS1_R1", "pairs": [ [ 1, 32.193447169231426 ], [ 2, 33.091602398702015 ], [ 3, 33.59455074369769 ], [ 4, 33.418000271605116 ], [ 5, 33.21937116268432 ], [ 6, 33.09768492377188 ], [ 7, 33.51527778770487 ], [ 8, 33.4653810691235 ], [ 9, 33.34874811484608 ], [ 10, 33.2798790642489 ], [ 15, 33.458991201423785 ], [ 20, 33.652162477038644 ], [ 25, 33.52809754912121 ], [ 30, 33.476040855127266 ], [ 35, 33.555767113799625 ], [ 40, 33.39823867496192 ], [ 45, 33.55260475940506 ], [ 50, 33.49214512957998 ], [ 55, 33.356685612153704 ], [ 60, 33.29878677390527 ], [ 65, 33.45383716884581 ], [ 70, 33.50117963309835 ], [ 75, 33.36870040179018 ], [ 80, 33.576407353054535 ], [ 85, 33.54650687858216 ], [ 90, 33.17736135042576 ], [ 95, 33.326774721699906 ], [ 100, 33.243045178633984 ], [ 105, 33.36533668042265 ], [ 110, 33.21660732415312 ], [ 115, 33.18948565055124 ], [ 120, 33.225398420876274 ], [ 125, 33.22564999195597 ], [ 130, 33.13850377747483 ], [ 135, 33.21364032892385 ], [ 140, 33.24276725062567 ], [ 145, 33.22473686758191 ], [ 150, 33.05306022072335 ], [ 155, 33.1140511133354 ], [ 160, 33.24358938508438 ], [ 165, 33.25378360402497 ], [ 170, 32.75008384249206 ], [ 175, 33.126091900590026 ], [ 180, 33.04100554264259 ], [ 185, 33.08076657132845 ], [ 190, 33.11772868045175 ], [ 195, 32.65570154420548 ], [ 200, 32.95621580253625 ], [ 205, 32.632321744043836 ], [ 210, 32.5923025755831 ], [ 215, 32.94530122377748 ], [ 220, 32.98484690264854 ], [ 225, 33.0755454144926 ], [ 230, 32.765864614328216 ], [ 235, 32.89950646601053 ], [ 240, 32.714339665827424 ], [ 245, 32.77406300068665 ], [ 250, 32.488848143150975 ], [ 255, 32.4712367764132 ], [ 260, 32.61544128691696 ], [ 265, 32.65641205375982 ], [ 270, 32.40931087616396 ], [ 275, 32.24809159814146 ], [ 280, 32.056468154662625 ], [ 285, 31.8798308928201 ], [ 290, 31.844812064096192 ], [ 295, 31.627618242828554 ], [ 300, 30.811174440311113 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICFS2_R1", "pairs": [ [ 1, 32.20616146653088 ], [ 2, 33.11498356633645 ], [ 3, 33.62024928247384 ], [ 4, 33.40062262753449 ], [ 5, 33.18241366540135 ], [ 6, 33.1448361262846 ], [ 7, 33.531287612258126 ], [ 8, 33.4903481159152 ], [ 9, 33.35173247847422 ], [ 10, 33.18959239885196 ], [ 15, 33.39703268215906 ], [ 20, 33.49269049162115 ], [ 25, 33.27984098694565 ], [ 30, 33.36987663179335 ], [ 35, 33.51647137689594 ], [ 40, 33.56518621053993 ], [ 45, 33.57786239662965 ], [ 50, 33.4291340906592 ], [ 55, 33.41594203737246 ], [ 60, 33.40344558191214 ], [ 65, 33.403909699596646 ], [ 70, 33.458761781623295 ], [ 75, 33.370582992858715 ], [ 80, 33.5538223822035 ], [ 85, 33.54505005952147 ], [ 90, 33.24877224456726 ], [ 95, 33.4316363320698 ], [ 100, 33.265730154407564 ], [ 105, 33.39161327290723 ], [ 110, 33.175635081870425 ], [ 115, 33.19285073477916 ], [ 120, 33.210626490889965 ], [ 125, 33.15881429811451 ], [ 130, 33.13092920422288 ], [ 135, 33.19639975458134 ], [ 140, 33.28461965896067 ], [ 145, 33.105663151314495 ], [ 150, 33.18094521372667 ], [ 155, 33.06953517788811 ], [ 160, 33.17155118902322 ], [ 165, 33.168985579400136 ], [ 170, 32.59587585895484 ], [ 175, 33.001346540155964 ], [ 180, 32.949777409849546 ], [ 185, 32.914233554438916 ], [ 190, 32.98441692287205 ], [ 195, 32.90003416071748 ], [ 200, 32.88915484068947 ], [ 205, 32.65909456728792 ], [ 210, 32.38858684638679 ], [ 215, 32.93406981524263 ], [ 220, 33.010850370267434 ], [ 225, 33.07291277702353 ], [ 230, 32.800041691034686 ], [ 235, 32.92260964370878 ], [ 240, 32.86736499554135 ], [ 245, 32.67292383235474 ], [ 250, 32.64192173621003 ], [ 255, 32.530300292997026 ], [ 260, 32.49819106185364 ], [ 265, 32.25608851950246 ], [ 270, 32.28817165289068 ], [ 275, 31.878024445809494 ], [ 280, 31.905948754983648 ], [ 285, 32.09177933570676 ], [ 290, 32.00085400860787 ], [ 295, 31.732030384508597 ], [ 300, 29.349951827385233 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICMS1_R1", "pairs": [ [ 1, 32.213970863672984 ], [ 2, 33.13698897253139 ], [ 3, 33.610102782780935 ], [ 4, 33.47971797595407 ], [ 5, 33.26101592286417 ], [ 6, 33.14301841674492 ], [ 7, 33.55131698455949 ], [ 8, 33.48486481216357 ], [ 9, 33.38870672270201 ], [ 10, 33.25902594970161 ], [ 15, 33.427769310898675 ], [ 20, 33.63629366215613 ], [ 25, 33.54749303406764 ], [ 30, 33.472125494542716 ], [ 35, 33.53702750747048 ], [ 40, 33.43538875413539 ], [ 45, 33.50398719172388 ], [ 50, 33.451530732678556 ], [ 55, 33.40967599577162 ], [ 60, 33.31413118219978 ], [ 65, 33.38041606371296 ], [ 70, 33.32106899842976 ], [ 75, 33.405316715394505 ], [ 80, 33.55085850927442 ], [ 85, 33.520265790964615 ], [ 90, 33.249393942504085 ], [ 95, 33.28146623833814 ], [ 100, 33.19560313240894 ], [ 105, 33.387273305758825 ], [ 110, 33.29397637350795 ], [ 115, 33.27961039494212 ], [ 120, 33.112005296001314 ], [ 125, 33.07194966746038 ], [ 130, 33.20477871746449 ], [ 135, 33.05515231135561 ], [ 140, 33.237324492979724 ], [ 145, 33.17000369488464 ], [ 150, 33.08332418160451 ], [ 155, 32.96401471803267 ], [ 160, 33.24618116317618 ], [ 165, 33.2909364050408 ], [ 170, 32.80630201035119 ], [ 175, 33.214433878508274 ], [ 180, 33.10074975441943 ], [ 185, 33.03765314303679 ], [ 190, 33.19461345814345 ], [ 195, 32.722748080633906 ], [ 200, 32.991414172517146 ], [ 205, 32.4554686537751 ], [ 210, 32.43180502524941 ], [ 215, 33.03311265755225 ], [ 220, 33.045100997659816 ], [ 225, 33.17365376635165 ], [ 230, 32.66913997146582 ], [ 235, 32.88699231219272 ], [ 240, 32.75229248565593 ], [ 245, 32.733325464193705 ], [ 250, 32.720727313783655 ], [ 255, 32.43461771377544 ], [ 260, 32.646245907192046 ], [ 265, 32.72976717720464 ], [ 270, 32.41896879498346 ], [ 275, 32.33853184384604 ], [ 280, 32.12848292444709 ], [ 285, 32.16008309332769 ], [ 290, 31.785661369992475 ], [ 295, 31.77789321617953 ], [ 300, 31.27652903851729 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICMS2_R1", "pairs": [ [ 1, 32.29904905900609 ], [ 2, 33.165041976684044 ], [ 3, 33.643297656467595 ], [ 4, 33.46878605817053 ], [ 5, 33.30524012254804 ], [ 6, 33.18889905701667 ], [ 7, 33.56589344686269 ], [ 8, 33.514399395217445 ], [ 9, 33.40912744200851 ], [ 10, 33.228423188636455 ], [ 15, 33.435782437432856 ], [ 20, 33.61973341821509 ], [ 25, 33.5249830899614 ], [ 30, 33.466602474833884 ], [ 35, 33.544145250577344 ], [ 40, 33.5864062103049 ], [ 45, 33.6055934724411 ], [ 50, 33.4865184902237 ], [ 55, 33.524907489197126 ], [ 60, 33.46699771607738 ], [ 65, 33.3128576089638 ], [ 70, 33.38918041397092 ], [ 75, 33.47827249504619 ], [ 80, 33.57604507365054 ], [ 85, 33.54165731611239 ], [ 90, 33.400401079093754 ], [ 95, 33.4144436221262 ], [ 100, 33.212998464121725 ], [ 105, 33.34123713801418 ], [ 110, 33.261699333922216 ], [ 115, 33.36189748609354 ], [ 120, 33.11724083048837 ], [ 125, 33.07586602048368 ], [ 130, 33.32045091686628 ], [ 135, 33.13732293490371 ], [ 140, 33.33486073531753 ], [ 145, 33.19088894426096 ], [ 150, 33.22643545524722 ], [ 155, 33.15074050789053 ], [ 160, 33.32406312421911 ], [ 165, 33.348537685922786 ], [ 170, 32.59903865284067 ], [ 175, 33.22295773414931 ], [ 180, 33.003294683145384 ], [ 185, 32.83360682226079 ], [ 190, 33.17032533265423 ], [ 195, 32.88089068568154 ], [ 200, 33.003256509836376 ], [ 205, 32.4006056315711 ], [ 210, 32.60387091639807 ], [ 215, 33.02525963948908 ], [ 220, 33.12338705184832 ], [ 225, 33.26224289271872 ], [ 230, 32.76629454144711 ], [ 235, 32.91427843789544 ], [ 240, 32.97295952862926 ], [ 245, 32.748703272920565 ], [ 250, 32.92046415013251 ], [ 255, 32.53958843162516 ], [ 260, 32.76393228648516 ], [ 265, 32.63192435951515 ], [ 270, 32.6315573385044 ], [ 275, 32.181147365284254 ], [ 280, 32.10363618513869 ], [ 285, 32.24078619512854 ], [ 290, 31.832824319429193 ], [ 295, 31.581770326899743 ], [ 300, 31.02947636251652 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPFS1_R1", "pairs": [ [ 1, 32.167169891030184 ], [ 2, 33.061412010288144 ], [ 3, 33.564251189721794 ], [ 4, 33.37900249748388 ], [ 5, 33.13371478982617 ], [ 6, 33.02221021110573 ], [ 7, 33.48738211503336 ], [ 8, 33.42260906300866 ], [ 9, 33.36524148556802 ], [ 10, 33.315942893353714 ], [ 15, 33.47495930716567 ], [ 20, 33.71096407847815 ], [ 25, 33.62709956387222 ], [ 30, 33.51816702078751 ], [ 35, 33.59240938855133 ], [ 40, 33.23210964187108 ], [ 45, 33.5929658668721 ], [ 50, 33.537056871979026 ], [ 55, 33.355213161197334 ], [ 60, 33.268544589271734 ], [ 65, 33.522946358677416 ], [ 70, 33.562082323370035 ], [ 75, 33.34115161907602 ], [ 80, 33.60471184671588 ], [ 85, 33.56818316156044 ], [ 90, 32.97912322775452 ], [ 95, 33.20094261777624 ], [ 100, 33.217555435437674 ], [ 105, 33.360916540853545 ], [ 110, 33.19203866967376 ], [ 115, 33.13625140570732 ], [ 120, 33.2795534077258 ], [ 125, 33.31542375161864 ], [ 130, 33.13625403034689 ], [ 135, 33.25327625414735 ], [ 140, 33.213749584692934 ], [ 145, 33.342975550653954 ], [ 150, 32.89422473515798 ], [ 155, 33.10306489435373 ], [ 160, 33.224973747491255 ], [ 165, 33.25826876355344 ], [ 170, 32.8582369776888 ], [ 175, 33.21598647909728 ], [ 180, 33.03539804450177 ], [ 185, 33.18006151551869 ], [ 190, 33.095365209556654 ], [ 195, 32.47197564234008 ], [ 200, 32.96861217261627 ], [ 205, 32.72041922205579 ], [ 210, 32.90546376442371 ], [ 215, 32.946107077312305 ], [ 220, 32.931735113000144 ], [ 225, 33.046084887001356 ], [ 230, 32.71123552915297 ], [ 235, 32.85209567070784 ], [ 240, 32.54946279990306 ], [ 245, 32.8548124304809 ], [ 250, 32.22940587968458 ], [ 255, 32.42851852081999 ], [ 260, 32.50148700963791 ], [ 265, 32.88281767509492 ], [ 270, 32.31981716144145 ], [ 275, 32.47089140561468 ], [ 280, 32.04453954745337 ], [ 285, 31.759066144194776 ], [ 290, 31.80638037255426 ], [ 295, 31.665167410045 ], [ 300, 31.44239455036634 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPFS2_R1", "pairs": [ [ 1, 32.26506942092787 ], [ 2, 33.11922754736486 ], [ 3, 33.63883294419591 ], [ 4, 33.418432637638794 ], [ 5, 33.16661468265992 ], [ 6, 33.14426007450051 ], [ 7, 33.567326715026645 ], [ 8, 33.507837702960416 ], [ 9, 33.34504161691055 ], [ 10, 33.21329513251466 ], [ 15, 33.395507690662484 ], [ 20, 33.51841214108756 ], [ 25, 33.31570837863369 ], [ 30, 33.373604897784595 ], [ 35, 33.53808793911633 ], [ 40, 33.60016147168433 ], [ 45, 33.60394604927215 ], [ 50, 33.44223422215432 ], [ 55, 33.43912648267135 ], [ 60, 33.43862921408393 ], [ 65, 33.402290287221625 ], [ 70, 33.42731552304805 ], [ 75, 33.37769678066169 ], [ 80, 33.56381508298986 ], [ 85, 33.548603765177674 ], [ 90, 33.2389306004233 ], [ 95, 33.47027470201627 ], [ 100, 33.24535930330827 ], [ 105, 33.40564301596567 ], [ 110, 33.14636015667122 ], [ 115, 33.16515446553099 ], [ 120, 33.17295861758585 ], [ 125, 33.16125729104933 ], [ 130, 33.11355669958131 ], [ 135, 33.17054233859288 ], [ 140, 33.26872474010436 ], [ 145, 33.06725782806115 ], [ 150, 33.203821457376215 ], [ 155, 33.07218473722027 ], [ 160, 33.100206843940725 ], [ 165, 33.130686142575776 ], [ 170, 32.58607395260545 ], [ 175, 32.86332670867237 ], [ 180, 32.93707879187573 ], [ 185, 32.942594063764865 ], [ 190, 32.916481812388874 ], [ 195, 32.936923769333944 ], [ 200, 32.82242502562274 ], [ 205, 32.77029179413235 ], [ 210, 32.1517211876529 ], [ 215, 32.92712948232914 ], [ 220, 33.00841677472828 ], [ 225, 33.05211816718689 ], [ 230, 32.78694419935296 ], [ 235, 32.871778511387255 ], [ 240, 32.873753258617235 ], [ 245, 32.627010093357995 ], [ 250, 32.55926739600277 ], [ 255, 32.51362937545955 ], [ 260, 32.45564938392639 ], [ 265, 32.25379470154409 ], [ 270, 32.240136719008255 ], [ 275, 31.792442372532708 ], [ 280, 31.835467714901522 ], [ 285, 31.996728894624816 ], [ 290, 31.908975508280133 ], [ 295, 31.655959918359105 ], [ 300, 28.2151648869829 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPMS1_R1", "pairs": [ [ 1, 32.292703877556335 ], [ 2, 33.137167796066045 ], [ 3, 33.61947772870699 ], [ 4, 33.4717939373957 ], [ 5, 33.311101084859686 ], [ 6, 33.15177334501777 ], [ 7, 33.5487261358345 ], [ 8, 33.50002747578516 ], [ 9, 33.42986588924656 ], [ 10, 33.454864804676085 ], [ 15, 33.41690368146599 ], [ 20, 33.61501508275996 ], [ 25, 33.50151290349637 ], [ 30, 33.469939466507014 ], [ 35, 33.55816045280094 ], [ 40, 33.62242916043688 ], [ 45, 33.627592190889374 ], [ 50, 33.50687866328834 ], [ 55, 33.56078589030161 ], [ 60, 33.54086965072827 ], [ 65, 33.274342006316736 ], [ 70, 33.53107232681188 ], [ 75, 33.524041926732345 ], [ 80, 33.60779451912872 ], [ 85, 33.57037639225288 ], [ 90, 33.45452505047116 ], [ 95, 33.49866952814527 ], [ 100, 33.249916990125584 ], [ 105, 33.28853306801026 ], [ 110, 33.16671390805861 ], [ 115, 33.33157209711288 ], [ 120, 33.1509615579292 ], [ 125, 33.09533321185511 ], [ 130, 33.31362725277013 ], [ 135, 33.23085778082437 ], [ 140, 33.37016784240226 ], [ 145, 33.229716464058356 ], [ 150, 33.266452818400595 ], [ 155, 33.24599822127213 ], [ 160, 33.32507997662889 ], [ 165, 33.304214320010644 ], [ 170, 32.41765422721312 ], [ 175, 33.239964827434605 ], [ 180, 33.041742982930714 ], [ 185, 32.68329653315987 ], [ 190, 33.13076417995065 ], [ 195, 32.95636199550499 ], [ 200, 32.99590763543592 ], [ 205, 32.494767685708254 ], [ 210, 32.974085740649144 ], [ 215, 32.96575407052589 ], [ 220, 33.14464084786111 ], [ 225, 33.272718821697865 ], [ 230, 32.84049440711354 ], [ 235, 32.97939411119821 ], [ 240, 33.14316921554958 ], [ 245, 32.77095633007142 ], [ 250, 32.90142808794731 ], [ 255, 32.543929975383776 ], [ 260, 32.767541877948666 ], [ 265, 32.50074774303095 ], [ 270, 32.64460455861517 ], [ 275, 32.085125281973056 ], [ 280, 32.00709903139729 ], [ 285, 32.31436030533304 ], [ 290, 31.912748890379874 ], [ 295, 31.491018900951552 ], [ 300, 31.320723993484528 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPMS2_R1", "pairs": [ [ 1, 32.29685483573615 ], [ 2, 33.12114843356317 ], [ 3, 33.62333411173793 ], [ 4, 33.42536533805292 ], [ 5, 33.28254448172593 ], [ 6, 33.13642974488813 ], [ 7, 33.54877933868384 ], [ 8, 33.48915354645232 ], [ 9, 33.411653126523525 ], [ 10, 33.43549279156373 ], [ 15, 33.43601309358472 ], [ 20, 33.59686835539496 ], [ 25, 33.458296768801546 ], [ 30, 33.443847121336894 ], [ 35, 33.54406224133341 ], [ 40, 33.52137671659402 ], [ 45, 33.605887221002256 ], [ 50, 33.445050965225654 ], [ 55, 33.42472052124232 ], [ 60, 33.397230495683914 ], [ 65, 33.41917021389914 ], [ 70, 33.50856691572587 ], [ 75, 33.40633137500717 ], [ 80, 33.58954666551233 ], [ 85, 33.53425405084295 ], [ 90, 33.29341336009996 ], [ 95, 33.42193006534609 ], [ 100, 33.244686909267415 ], [ 105, 33.364889955916816 ], [ 110, 33.076662132708414 ], [ 115, 33.212142541092405 ], [ 120, 33.261091263663324 ], [ 125, 33.14565477458579 ], [ 130, 33.19559741728258 ], [ 135, 33.20409940840038 ], [ 140, 33.27464971075532 ], [ 145, 33.14351396136326 ], [ 150, 33.1210664626425 ], [ 155, 33.117057742455856 ], [ 160, 33.20145286783655 ], [ 165, 33.177214640122266 ], [ 170, 32.70493295835331 ], [ 175, 33.071364537751776 ], [ 180, 32.96405151370884 ], [ 185, 32.93510275229901 ], [ 190, 33.07567095806666 ], [ 195, 32.811769526416285 ], [ 200, 32.88776746129955 ], [ 205, 32.62329002306876 ], [ 210, 32.70962700724843 ], [ 215, 32.89547680217002 ], [ 220, 33.026296747018066 ], [ 225, 33.042753851919585 ], [ 230, 32.788832707783584 ], [ 235, 32.89555571782931 ], [ 240, 32.85420014669065 ], [ 245, 32.663276938017056 ], [ 250, 32.5409299153016 ], [ 255, 32.50240032780168 ], [ 260, 32.501343593652045 ], [ 265, 32.349775547179334 ], [ 270, 32.34821713939176 ], [ 275, 31.843497316339267 ], [ 280, 31.856724459895833 ], [ 285, 31.949435197318714 ], [ 290, 31.890512006374497 ], [ 295, 31.330255134787173 ], [ 300, 30.104236663591706 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVFS1_R1", "pairs": [ [ 1, 32.333170265087816 ], [ 2, 33.11860157331738 ], [ 3, 33.63787492956762 ], [ 4, 33.40165892820484 ], [ 5, 33.204570569967196 ], [ 6, 33.171680287233066 ], [ 7, 33.56379972307518 ], [ 8, 33.49659085449217 ], [ 9, 33.393320608186315 ], [ 10, 33.20806488951398 ], [ 15, 33.404849241951055 ], [ 20, 33.64412976155637 ], [ 25, 33.54067518989443 ], [ 30, 33.466359748933144 ], [ 35, 33.561061050130384 ], [ 40, 33.63467063854322 ], [ 45, 33.63318380557606 ], [ 50, 33.45403143390672 ], [ 55, 33.39364290363019 ], [ 60, 33.36019236397151 ], [ 65, 33.14038289340922 ], [ 70, 33.44865795117519 ], [ 75, 33.49320567307734 ], [ 80, 33.57807340280358 ], [ 85, 33.53531049333769 ], [ 90, 33.444395425835815 ], [ 95, 33.48007058679642 ], [ 100, 33.192127965335445 ], [ 105, 33.303072024181326 ], [ 110, 33.211112227381335 ], [ 115, 33.29540424023281 ], [ 120, 33.18587640213859 ], [ 125, 33.088533913408114 ], [ 130, 33.29018677709054 ], [ 135, 33.01837806199113 ], [ 140, 33.023265890904 ], [ 145, 33.21573540203376 ], [ 150, 33.22291752208059 ], [ 155, 33.23539710134798 ], [ 160, 33.3174731582028 ], [ 165, 33.336251496064364 ], [ 170, 32.4515406186936 ], [ 175, 33.264115421911995 ], [ 180, 32.9810635379629 ], [ 185, 32.77529891491925 ], [ 190, 33.137960014502056 ], [ 195, 32.874424641961966 ], [ 200, 32.98610417067077 ], [ 205, 32.254437363222976 ], [ 210, 32.532507174650874 ], [ 215, 32.90320402217262 ], [ 220, 32.97734164442561 ], [ 225, 33.213620697939554 ], [ 230, 32.41283006670132 ], [ 235, 32.157318143894884 ], [ 240, 32.91546186405511 ], [ 245, 32.653773407708 ], [ 250, 32.885640651550034 ], [ 255, 32.45248568345921 ], [ 260, 32.79011226138995 ], [ 265, 32.597373869741844 ], [ 270, 32.59055169702529 ], [ 275, 32.216466168697856 ], [ 280, 32.02547611084242 ], [ 285, 32.271173063272634 ], [ 290, 32.04270659542918 ], [ 295, 31.567889120373515 ], [ 300, 31.858797442872756 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVFS2_R1", "pairs": [ [ 1, 32.0478731753257 ], [ 2, 32.97928896562549 ], [ 3, 33.524093548893426 ], [ 4, 33.29639773975828 ], [ 5, 33.09562078166693 ], [ 6, 32.95746350651389 ], [ 7, 33.44037827656569 ], [ 8, 33.40015696123058 ], [ 9, 33.35734578559096 ], [ 10, 33.29790456757181 ], [ 15, 33.44258358185528 ], [ 20, 33.703774917595354 ], [ 25, 33.6256396170146 ], [ 30, 33.50451420499137 ], [ 35, 33.57595667870036 ], [ 40, 33.14711404262209 ], [ 45, 33.56860737242776 ], [ 50, 33.53742748361267 ], [ 55, 33.30730933783413 ], [ 60, 33.23580327354084 ], [ 65, 33.504904031086866 ], [ 70, 33.58210464340385 ], [ 75, 33.29965537543667 ], [ 80, 33.58632532293696 ], [ 85, 33.55916990881732 ], [ 90, 32.88964916274797 ], [ 95, 33.1438142266115 ], [ 100, 33.18046647459197 ], [ 105, 33.42582331744923 ], [ 110, 33.12719479357204 ], [ 115, 33.09268415226761 ], [ 120, 33.300097189681274 ], [ 125, 33.32779971580872 ], [ 130, 33.16280954125444 ], [ 135, 33.280657570381074 ], [ 140, 33.19582659485939 ], [ 145, 33.35407998241455 ], [ 150, 32.85989888363768 ], [ 155, 33.10379000940228 ], [ 160, 33.21052152272389 ], [ 165, 33.24954426623331 ], [ 170, 32.817152233134706 ], [ 175, 33.186997652637444 ], [ 180, 32.99767565487629 ], [ 185, 33.152064000502456 ], [ 190, 33.07338075274389 ], [ 195, 32.41158635200276 ], [ 200, 32.940509052082845 ], [ 205, 32.743090426617684 ], [ 210, 32.98495454331339 ], [ 215, 32.90874463215318 ], [ 220, 32.90018606769095 ], [ 225, 33.026964513620655 ], [ 230, 32.698680233334116 ], [ 235, 32.813064198286895 ], [ 240, 32.475335829977 ], [ 245, 32.862720713506214 ], [ 250, 32.07817007011015 ], [ 255, 32.34518532475995 ], [ 260, 32.392434698636265 ], [ 265, 32.85035212096945 ], [ 270, 32.27689956357909 ], [ 275, 32.42015695207033 ], [ 280, 31.98409804765306 ], [ 285, 31.635450246253207 ], [ 290, 31.673241540077633 ], [ 295, 31.53867501479102 ], [ 300, 31.416618960978067 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVMS1_R1", "pairs": [ [ 1, 32.31794336371614 ], [ 2, 33.111773711079366 ], [ 3, 33.62368449708235 ], [ 4, 33.368737949897195 ], [ 5, 33.260397517278484 ], [ 6, 33.131367738712136 ], [ 7, 33.53591811374657 ], [ 8, 33.49169543745476 ], [ 9, 33.39464767260871 ], [ 10, 33.410178133347 ], [ 15, 33.38626432400925 ], [ 20, 33.63795309987894 ], [ 25, 33.54352128824807 ], [ 30, 33.457809747692465 ], [ 35, 33.54089618215357 ], [ 40, 33.561874216089066 ], [ 45, 33.59596796925048 ], [ 50, 33.44147853939782 ], [ 55, 33.35444202434337 ], [ 60, 33.31039846252403 ], [ 65, 33.247260730301086 ], [ 70, 33.42642088020333 ], [ 75, 33.36578453417383 ], [ 80, 33.54692625455566 ], [ 85, 33.507222203485014 ], [ 90, 33.31485735048375 ], [ 95, 33.413689450384716 ], [ 100, 33.14018801758694 ], [ 105, 33.33582420398488 ], [ 110, 33.19642770196681 ], [ 115, 33.173870203087965 ], [ 120, 33.18113590921212 ], [ 125, 33.06903413459074 ], [ 130, 33.173494808769426 ], [ 135, 33.0553963840447 ], [ 140, 32.997743551631785 ], [ 145, 33.09198671829717 ], [ 150, 33.10170919309926 ], [ 155, 33.09179361632642 ], [ 160, 33.18592789617048 ], [ 165, 33.210641884313404 ], [ 170, 32.55439961544624 ], [ 175, 32.956802799569296 ], [ 180, 32.936853304619795 ], [ 185, 32.875138602864595 ], [ 190, 33.07429721449539 ], [ 195, 32.6541086692492 ], [ 200, 32.88290422443133 ], [ 205, 32.551861889832786 ], [ 210, 32.22462761184463 ], [ 215, 32.81593129086015 ], [ 220, 32.893793184945 ], [ 225, 33.05118824297533 ], [ 230, 32.501381295148484 ], [ 235, 32.29545742982956 ], [ 240, 32.64087992667278 ], [ 245, 32.575286674828384 ], [ 250, 32.61950991263548 ], [ 255, 32.38034290092003 ], [ 260, 32.6096147066553 ], [ 265, 32.53411746607611 ], [ 270, 32.45229696113587 ], [ 275, 31.868315544709766 ], [ 280, 31.9654479257474 ], [ 285, 31.850938512114396 ], [ 290, 31.776634876680184 ], [ 295, 31.28508375052965 ], [ 300, 30.048343956378815 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVMS2_R1", "pairs": [ [ 1, 32.19092922168457 ], [ 2, 33.1063998469067 ], [ 3, 33.5807977254709 ], [ 4, 33.35380956286394 ], [ 5, 33.25443560512863 ], [ 6, 33.05634380382187 ], [ 7, 33.513290868166614 ], [ 8, 33.45655521838578 ], [ 9, 33.402115968178464 ], [ 10, 33.42622634116115 ], [ 15, 33.43988262846624 ], [ 20, 33.70207496104322 ], [ 25, 33.62423430565808 ], [ 30, 33.491309221137804 ], [ 35, 33.58132261680199 ], [ 40, 33.23102326471472 ], [ 45, 33.579729717415276 ], [ 50, 33.52141392602313 ], [ 55, 33.34270483064053 ], [ 60, 33.31372280999116 ], [ 65, 33.486721889608795 ], [ 70, 33.56086643520417 ], [ 75, 33.32560394397514 ], [ 80, 33.59224919344612 ], [ 85, 33.55141093916036 ], [ 90, 33.06537021005149 ], [ 95, 33.244693124345005 ], [ 100, 33.19836332984007 ], [ 105, 33.38423110220076 ], [ 110, 33.16386385382968 ], [ 115, 33.11009978584772 ], [ 120, 33.270981910967336 ], [ 125, 33.2729594021962 ], [ 130, 33.17746024513601 ], [ 135, 33.2578502756641 ], [ 140, 33.18918179715263 ], [ 145, 33.302074106475665 ], [ 150, 32.91540999143383 ], [ 155, 33.10884502524286 ], [ 160, 33.19896659194051 ], [ 165, 33.22833331562034 ], [ 170, 32.78056555457337 ], [ 175, 33.13393600831108 ], [ 180, 32.98293494208671 ], [ 185, 33.08818860324605 ], [ 190, 33.076531216680486 ], [ 195, 32.48532528956649 ], [ 200, 32.94073979568589 ], [ 205, 32.772939771992014 ], [ 210, 32.85676141179043 ], [ 215, 32.894068335735945 ], [ 220, 32.93404051726495 ], [ 225, 33.03605539340261 ], [ 230, 32.71208785200036 ], [ 235, 32.76773899571676 ], [ 240, 32.51951517360795 ], [ 245, 32.81931832680215 ], [ 250, 32.20714663264376 ], [ 255, 32.398542553128294 ], [ 260, 32.41619823563722 ], [ 265, 32.810710119568384 ], [ 270, 32.346747158819355 ], [ 275, 32.352194873896764 ], [ 280, 32.08945968074743 ], [ 285, 31.71953701928901 ], [ 290, 31.675216329708615 ], [ 295, 31.464489062774 ], [ 300, 31.1036817124539 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAFS1_R1", "pairs": [ [ 1, 39.56020246279368 ], [ 2, 39.24715569993201 ], [ 3, 39.13412404623404 ], [ 4, 38.76833119286847 ], [ 5, 39.300475938656795 ], [ 6, 39.23952557225957 ], [ 7, 39.23949535393216 ], [ 8, 39.397688297952705 ], [ 9, 39.01947571201934 ], [ 10, 39.532443907229734 ], [ 15, 39.45307244843998 ], [ 20, 39.430160912593486 ], [ 25, 39.58577321145275 ], [ 30, 39.41448968799577 ], [ 35, 39.57970467132934 ], [ 40, 39.496002840544236 ], [ 45, 39.425938097288636 ], [ 50, 39.52398330729978 ], [ 55, 39.43169346065514 ], [ 60, 39.415333010999646 ], [ 65, 39.46452919134534 ], [ 70, 39.31835488939926 ], [ 75, 39.27167291188202 ], [ 80, 39.44249365405536 ], [ 85, 39.5411673102304 ], [ 90, 39.36102263455321 ], [ 95, 39.241286150312774 ], [ 100, 39.20511317276602 ], [ 105, 39.28497174458312 ], [ 110, 39.241243842736694 ], [ 115, 39.164910562511054 ], [ 120, 39.0866260709267 ], [ 125, 39.18453936930539 ], [ 130, 39.22488782193728 ], [ 135, 39.21154418597623 ], [ 140, 39.32265244294014 ], [ 145, 38.96253248715624 ], [ 150, 39.18683892414627 ], [ 155, 39.05130250831067 ], [ 160, 39.28785131459655 ], [ 165, 39.21338773043216 ], [ 170, 38.98209731036567 ], [ 175, 39.24001208824418 ], [ 180, 39.23927470534905 ], [ 185, 39.16455401938514 ], [ 190, 39.26782160638869 ], [ 195, 39.18437582635106 ], [ 200, 39.40915238102433 ], [ 205, 39.06818878957986 ], [ 210, 39.2284498976269 ], [ 215, 39.21908748177306 ], [ 220, 39.162804191630336 ], [ 225, 39.26858921569368 ], [ 230, 39.06396391631849 ], [ 235, 39.25512280993359 ], [ 240, 39.170561880945 ], [ 245, 39.034492554340844 ], [ 250, 39.17592003566059 ], [ 255, 39.04569239719248 ], [ 260, 39.05562296481539 ], [ 265, 39.08846092823306 ], [ 270, 37.86382792254399 ], [ 275, 39.017658896740855 ], [ 280, 37.96174286210778 ], [ 285, 38.95196778409907 ], [ 290, 39.04326322389594 ], [ 295, 38.924495309595116 ], [ 300, 38.21424484813444 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAFS2_R1", "pairs": [ [ 1, 39.65727459625189 ], [ 2, 39.095627993202534 ], [ 3, 39.30480457284103 ], [ 4, 39.011943100928114 ], [ 5, 39.29791203698202 ], [ 6, 39.326337805559184 ], [ 7, 39.44916754803979 ], [ 8, 39.48282213692379 ], [ 9, 38.95380812606211 ], [ 10, 39.60086037861413 ], [ 15, 39.49486743752154 ], [ 20, 39.465709634101415 ], [ 25, 39.61783978419233 ], [ 30, 39.47256414217638 ], [ 35, 39.61563417271744 ], [ 40, 39.54511164719723 ], [ 45, 39.473676454859834 ], [ 50, 39.525831560684026 ], [ 55, 39.38780971847556 ], [ 60, 39.383484058039905 ], [ 65, 39.490190020083425 ], [ 70, 39.387220287822785 ], [ 75, 39.3714724937238 ], [ 80, 39.45636525570876 ], [ 85, 39.57213923253354 ], [ 90, 39.43082737147339 ], [ 95, 39.26814821857248 ], [ 100, 39.227590140945495 ], [ 105, 39.353865899745685 ], [ 110, 39.348056948636895 ], [ 115, 39.287856820288546 ], [ 120, 39.18703703090174 ], [ 125, 39.34131796303999 ], [ 130, 39.340129538296985 ], [ 135, 39.14012240774853 ], [ 140, 39.41122364448277 ], [ 145, 39.02891030745279 ], [ 150, 39.25846724351051 ], [ 155, 39.086840353713036 ], [ 160, 39.320737852999905 ], [ 165, 39.269287819720454 ], [ 170, 38.98921745744984 ], [ 175, 39.280060853855666 ], [ 180, 39.32236379195588 ], [ 185, 39.21491390019229 ], [ 190, 39.33725560111726 ], [ 195, 39.243678584320165 ], [ 200, 39.44741483823425 ], [ 205, 39.227888843986975 ], [ 210, 39.3247723869066 ], [ 215, 39.32060760215846 ], [ 220, 39.24032614638553 ], [ 225, 39.34393229847624 ], [ 230, 39.1527325457009 ], [ 235, 39.33493712411153 ], [ 240, 39.25545439418071 ], [ 245, 39.130710533197046 ], [ 250, 39.24430075831411 ], [ 255, 39.11901490479473 ], [ 260, 39.09245727054461 ], [ 265, 39.15994960420282 ], [ 270, 37.86005657641381 ], [ 275, 39.12461733247409 ], [ 280, 38.23054449502574 ], [ 285, 39.048221268705504 ], [ 290, 39.11465227977 ], [ 295, 39.030167468086034 ], [ 300, 38.18311457839241 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAMS1_R1", "pairs": [ [ 1, 39.683608352759066 ], [ 2, 39.0554627607178 ], [ 3, 39.19771418782083 ], [ 4, 38.90797403376101 ], [ 5, 39.10500908573631 ], [ 6, 39.29582790330574 ], [ 7, 39.33794656241014 ], [ 8, 39.38899799930251 ], [ 9, 38.89084267909914 ], [ 10, 39.542852248184374 ], [ 15, 39.593115642762314 ], [ 20, 39.59836273196161 ], [ 25, 39.64037370826527 ], [ 30, 39.328803313693456 ], [ 35, 39.56741861076951 ], [ 40, 39.34711917916338 ], [ 45, 39.56830944121192 ], [ 50, 39.52269109108374 ], [ 55, 39.40451900662616 ], [ 60, 39.42625624835569 ], [ 65, 39.508912587262834 ], [ 70, 39.331730328004255 ], [ 75, 39.18447899267635 ], [ 80, 39.64583616306602 ], [ 85, 39.579707594951444 ], [ 90, 39.279162026896394 ], [ 95, 39.30406137957196 ], [ 100, 39.16585944861174 ], [ 105, 39.273234541917006 ], [ 110, 39.072620256727156 ], [ 115, 38.990580144638464 ], [ 120, 39.08822456896024 ], [ 125, 38.956380023249906 ], [ 130, 39.04747930210429 ], [ 135, 39.18525005764013 ], [ 140, 39.2400599626763 ], [ 145, 39.06892893199131 ], [ 150, 39.23351165622212 ], [ 155, 38.757320026595934 ], [ 160, 39.289436038009455 ], [ 165, 39.21728904199274 ], [ 170, 39.14137291734228 ], [ 175, 39.26178923473228 ], [ 180, 39.14793707513171 ], [ 185, 39.18938770015848 ], [ 190, 39.25640476525549 ], [ 195, 39.16662118421617 ], [ 200, 39.41808080375444 ], [ 205, 38.61569205729565 ], [ 210, 39.08115986367502 ], [ 215, 39.07505093830499 ], [ 220, 39.20884031988644 ], [ 225, 39.28445295625731 ], [ 230, 38.90784847613395 ], [ 235, 39.26343394540883 ], [ 240, 39.22671675854938 ], [ 245, 39.165328911541735 ], [ 250, 39.117891735451224 ], [ 255, 39.194033028825274 ], [ 260, 39.276826589489275 ], [ 265, 39.302951056396196 ], [ 270, 39.04781531269694 ], [ 275, 39.122571328923776 ], [ 280, 37.5659897327957 ], [ 285, 39.119247642764925 ], [ 290, 39.27013760990742 ], [ 295, 39.10370242192009 ], [ 300, 39.17870504557976 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAMS2_R1", "pairs": [ [ 1, 39.66260787167079 ], [ 2, 39.03233273545636 ], [ 3, 39.2360079867339 ], [ 4, 39.06308842938847 ], [ 5, 39.20032488409083 ], [ 6, 39.35586314257674 ], [ 7, 39.39165453991675 ], [ 8, 39.37248637855765 ], [ 9, 38.954062743240044 ], [ 10, 39.526654709127214 ], [ 15, 39.57086601915463 ], [ 20, 39.58543707062845 ], [ 25, 39.628809096754544 ], [ 30, 39.33713898947511 ], [ 35, 39.55699888321094 ], [ 40, 39.35004230261599 ], [ 45, 39.55608379302176 ], [ 50, 39.51299333310772 ], [ 55, 39.38616399878168 ], [ 60, 39.43421977055061 ], [ 65, 39.497907881823416 ], [ 70, 39.3294067481133 ], [ 75, 39.19764459034146 ], [ 80, 39.63934802989882 ], [ 85, 39.571821939618886 ], [ 90, 39.26586617211085 ], [ 95, 39.30432239985922 ], [ 100, 39.15136386403325 ], [ 105, 39.26541673999269 ], [ 110, 39.068267655778314 ], [ 115, 38.979475030796934 ], [ 120, 39.07078164978742 ], [ 125, 38.94204046270163 ], [ 130, 39.025803358834345 ], [ 135, 39.15261882521761 ], [ 140, 39.20734814333482 ], [ 145, 39.04846146556743 ], [ 150, 39.20557665365264 ], [ 155, 38.759965328924295 ], [ 160, 39.261696726683994 ], [ 165, 39.193324998264075 ], [ 170, 39.12682916923327 ], [ 175, 39.24484908380773 ], [ 180, 39.11911244085534 ], [ 185, 39.16403441486134 ], [ 190, 39.23393217355988 ], [ 195, 39.15642490268842 ], [ 200, 39.39095635221488 ], [ 205, 38.574569479042566 ], [ 210, 39.06343441031549 ], [ 215, 39.05872596626042 ], [ 220, 39.17963173571622 ], [ 225, 39.26045932864311 ], [ 230, 38.892237288365074 ], [ 235, 39.21632829900013 ], [ 240, 39.19346868039995 ], [ 245, 39.12282103182393 ], [ 250, 39.0772534338846 ], [ 255, 39.145431528780996 ], [ 260, 39.23018162863274 ], [ 265, 39.25536328246214 ], [ 270, 38.994592741131534 ], [ 275, 39.09413811545049 ], [ 280, 37.5837418848203 ], [ 285, 39.06870612419051 ], [ 290, 39.23196178331434 ], [ 295, 39.04315591664307 ], [ 300, 39.089741291818996 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCFS1_R1", "pairs": [ [ 1, 32.22045324153758 ], [ 2, 33.08150060559699 ], [ 3, 33.58508637725505 ], [ 4, 33.398116274622296 ], [ 5, 33.20949937315399 ], [ 6, 33.04863368819192 ], [ 7, 33.50454197743355 ], [ 8, 33.45689105628865 ], [ 9, 33.421888612651664 ], [ 10, 33.35692399226536 ], [ 15, 33.509845732134885 ], [ 20, 33.73591721382886 ], [ 25, 33.663327383608504 ], [ 30, 33.539321306389574 ], [ 35, 33.615879390578186 ], [ 40, 33.19239374292042 ], [ 45, 33.605065891098114 ], [ 50, 33.57278594992589 ], [ 55, 33.28385991661957 ], [ 60, 33.20290905227369 ], [ 65, 33.546081597960054 ], [ 70, 33.60802727803626 ], [ 75, 33.352761640711854 ], [ 80, 33.61655988695162 ], [ 85, 33.58848491113129 ], [ 90, 33.02129689641616 ], [ 95, 33.237398132112155 ], [ 100, 33.27148549146275 ], [ 105, 33.43458992530574 ], [ 110, 33.21263958689716 ], [ 115, 33.21377115717671 ], [ 120, 33.35675170266796 ], [ 125, 33.383603873462974 ], [ 130, 33.20853128541935 ], [ 135, 33.32617833312083 ], [ 140, 33.246227859155276 ], [ 145, 33.409240350093896 ], [ 150, 32.926715836235815 ], [ 155, 33.16563384601267 ], [ 160, 33.26742226309219 ], [ 165, 33.2971628341905 ], [ 170, 32.89446912058486 ], [ 175, 33.252446125727886 ], [ 180, 33.05793790842064 ], [ 185, 33.21601112986915 ], [ 190, 33.13346804609963 ], [ 195, 32.52856262353616 ], [ 200, 32.999791687478236 ], [ 205, 32.80108185083636 ], [ 210, 33.02272843206019 ], [ 215, 32.97155105401314 ], [ 220, 32.98101331066181 ], [ 225, 33.078805375172465 ], [ 230, 32.77969329521663 ], [ 235, 32.892454594726715 ], [ 240, 32.58528752245024 ], [ 245, 32.93799377238381 ], [ 250, 32.20323921060183 ], [ 255, 32.4967873577266 ], [ 260, 32.530643910007754 ], [ 265, 32.94596320817879 ], [ 270, 32.357861568381566 ], [ 275, 32.55315668745346 ], [ 280, 32.141760059292885 ], [ 285, 31.81432901037241 ], [ 290, 31.80240039219125 ], [ 295, 31.574198641612412 ], [ 300, 31.675358962497498 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCFS2_R1", "pairs": [ [ 1, 32.18270873301621 ], [ 2, 33.09169929831016 ], [ 3, 33.56166066594833 ], [ 4, 33.38387953010433 ], [ 5, 33.21201151086699 ], [ 6, 33.04621429134583 ], [ 7, 33.5059065464771 ], [ 8, 33.446256340175026 ], [ 9, 33.40289348505952 ], [ 10, 33.361228351423094 ], [ 15, 33.45457412420173 ], [ 20, 33.72328059709338 ], [ 25, 33.64786996399569 ], [ 30, 33.54076108380857 ], [ 35, 33.59921914662611 ], [ 40, 33.176081387108425 ], [ 45, 33.598132266463566 ], [ 50, 33.553052951109414 ], [ 55, 33.27036012536384 ], [ 60, 33.20211436493493 ], [ 65, 33.53566364645821 ], [ 70, 33.60609331059812 ], [ 75, 33.33956266344271 ], [ 80, 33.61210428794828 ], [ 85, 33.57360462179573 ], [ 90, 32.97621394309745 ], [ 95, 33.20936357852848 ], [ 100, 33.233687060168606 ], [ 105, 33.41103890557137 ], [ 110, 33.185970076680974 ], [ 115, 33.181474350971484 ], [ 120, 33.32727463877153 ], [ 125, 33.34529222925776 ], [ 130, 33.181299445422766 ], [ 135, 33.301040817935714 ], [ 140, 33.21694614555681 ], [ 145, 33.37577075722133 ], [ 150, 32.889240529254344 ], [ 155, 33.13353838562129 ], [ 160, 33.234464554179354 ], [ 165, 33.260013536690344 ], [ 170, 32.87265522838237 ], [ 175, 33.20688925541632 ], [ 180, 33.00125960229445 ], [ 185, 33.16673435189749 ], [ 190, 33.10204698537867 ], [ 195, 32.49104386397241 ], [ 200, 32.961976421727755 ], [ 205, 32.82223770157846 ], [ 210, 33.01054450826028 ], [ 215, 32.921349369071926 ], [ 220, 32.93553436594358 ], [ 225, 33.04822071397926 ], [ 230, 32.73020700532299 ], [ 235, 32.84436354077676 ], [ 240, 32.514082933561156 ], [ 245, 32.881855819149635 ], [ 250, 32.134834724321486 ], [ 255, 32.40963182717115 ], [ 260, 32.41024131223385 ], [ 265, 32.89323648452107 ], [ 270, 32.33844367704934 ], [ 275, 32.503393842141136 ], [ 280, 32.14570068503045 ], [ 285, 31.72190370814291 ], [ 290, 31.68871088108949 ], [ 295, 31.5713433012873 ], [ 300, 31.44047715375335 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCMS1_R1", "pairs": [ [ 1, 32.18581422295476 ], [ 2, 33.070928885226195 ], [ 3, 33.57547386096773 ], [ 4, 33.3848079461171 ], [ 5, 33.19062254084901 ], [ 6, 33.054589279186054 ], [ 7, 33.50440246116478 ], [ 8, 33.444515357494716 ], [ 9, 33.38930644971404 ], [ 10, 33.320424817364476 ], [ 15, 33.48623866854207 ], [ 20, 33.700358764956285 ], [ 25, 33.61270362544691 ], [ 30, 33.51801198361703 ], [ 35, 33.593791645037484 ], [ 40, 33.255591997854545 ], [ 45, 33.6057514638907 ], [ 50, 33.536914830994206 ], [ 55, 33.297866592310314 ], [ 60, 33.22632710598878 ], [ 65, 33.52430399355578 ], [ 70, 33.591382171689766 ], [ 75, 33.356328462901686 ], [ 80, 33.61338175737707 ], [ 85, 33.581172509122005 ], [ 90, 33.10183670434266 ], [ 95, 33.27150164941687 ], [ 100, 33.257907358636714 ], [ 105, 33.42562230828814 ], [ 110, 33.18372610379551 ], [ 115, 33.153393028659956 ], [ 120, 33.31882645253292 ], [ 125, 33.326674681175405 ], [ 130, 33.16750285148694 ], [ 135, 33.3069480076842 ], [ 140, 33.24566400198302 ], [ 145, 33.353245336803624 ], [ 150, 32.94412220363141 ], [ 155, 33.12766778355957 ], [ 160, 33.25114644787071 ], [ 165, 33.26395939715433 ], [ 170, 32.8666303108423 ], [ 175, 33.2201712855089 ], [ 180, 33.040820980615734 ], [ 185, 33.16192018105882 ], [ 190, 33.132155450753885 ], [ 195, 32.54636688708068 ], [ 200, 32.97461073267328 ], [ 205, 32.76440621242733 ], [ 210, 32.951262441588064 ], [ 215, 32.963043990232656 ], [ 220, 32.98760737260929 ], [ 225, 33.05990587959754 ], [ 230, 32.758981319648456 ], [ 235, 32.896782939247956 ], [ 240, 32.61873252967244 ], [ 245, 32.876557686944125 ], [ 250, 32.268627172328536 ], [ 255, 32.483529601348664 ], [ 260, 32.516946400238 ], [ 265, 32.832228034510116 ], [ 270, 32.3248252181674 ], [ 275, 32.42600654502182 ], [ 280, 32.07469141508669 ], [ 285, 31.81263966551142 ], [ 290, 31.78094254489654 ], [ 295, 31.54318017151216 ], [ 300, 31.360310852918683 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCMS2_R1", "pairs": [ [ 1, 32.19847471989455 ], [ 2, 33.07585600853655 ], [ 3, 33.58185826821078 ], [ 4, 33.389707497724636 ], [ 5, 33.20800772055362 ], [ 6, 33.08341964033519 ], [ 7, 33.50320120515959 ], [ 8, 33.46304491102533 ], [ 9, 33.37581991651759 ], [ 10, 33.32507924551988 ], [ 15, 33.44283181119167 ], [ 20, 33.67616200608857 ], [ 25, 33.58202931299626 ], [ 30, 33.503232589523904 ], [ 35, 33.578399711263856 ], [ 40, 33.291313565378985 ], [ 45, 33.59235899689275 ], [ 50, 33.511277109946334 ], [ 55, 33.28876055365494 ], [ 60, 33.24844009918082 ], [ 65, 33.49701515959951 ], [ 70, 33.56633010846364 ], [ 75, 33.336169110896634 ], [ 80, 33.60470125806046 ], [ 85, 33.55266589020913 ], [ 90, 33.10775520453244 ], [ 95, 33.281277807858 ], [ 100, 33.23560347465807 ], [ 105, 33.38969686982587 ], [ 110, 33.1713301474454 ], [ 115, 33.10769870602729 ], [ 120, 33.277316634886255 ], [ 125, 33.275310937953655 ], [ 130, 33.11805459688172 ], [ 135, 33.26278956620001 ], [ 140, 33.2265898675372 ], [ 145, 33.30557787682842 ], [ 150, 32.95315361977634 ], [ 155, 33.07496149780891 ], [ 160, 33.20185051481668 ], [ 165, 33.2254028055038 ], [ 170, 32.797115120504145 ], [ 175, 33.168977343179805 ], [ 180, 32.981103882344634 ], [ 185, 33.09754316520307 ], [ 190, 33.08801356155676 ], [ 195, 32.54243558652948 ], [ 200, 32.93270234423438 ], [ 205, 32.75132437077673 ], [ 210, 32.860810397193504 ], [ 215, 32.93015327384457 ], [ 220, 32.951635382697646 ], [ 225, 33.03364433662898 ], [ 230, 32.73251865979139 ], [ 235, 32.86032194517043 ], [ 240, 32.59239951967224 ], [ 245, 32.80688312809525 ], [ 250, 32.2511407784135 ], [ 255, 32.40446108324896 ], [ 260, 32.43805420169057 ], [ 265, 32.716052522113124 ], [ 270, 32.32061452551451 ], [ 275, 32.33869536515208 ], [ 280, 32.068751177705416 ], [ 285, 31.767792038666833 ], [ 290, 31.704361593073976 ], [ 295, 31.55999861816441 ], [ 300, 31.124576544600245 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPFS1_R1", "pairs": [ [ 1, 32.171464282198244 ], [ 2, 33.05450233923886 ], [ 3, 33.564922974193465 ], [ 4, 33.333349028135075 ], [ 5, 33.1605920649936 ], [ 6, 33.02402160746159 ], [ 7, 33.49237446655509 ], [ 8, 33.438462822581684 ], [ 9, 33.38906272070815 ], [ 10, 33.339939132705254 ], [ 15, 33.48808807352016 ], [ 20, 33.72444065866802 ], [ 25, 33.651867324706906 ], [ 30, 33.53985352469577 ], [ 35, 33.60646768511662 ], [ 40, 33.185787358265245 ], [ 45, 33.601752395954165 ], [ 50, 33.56793637612735 ], [ 55, 33.32750713756779 ], [ 60, 33.25409998159428 ], [ 65, 33.54164101993383 ], [ 70, 33.60307932010118 ], [ 75, 33.336587579133905 ], [ 80, 33.61631517444773 ], [ 85, 33.57438950788236 ], [ 90, 32.935228980023375 ], [ 95, 33.16980263073413 ], [ 100, 33.20446103337428 ], [ 105, 33.455180354673985 ], [ 110, 33.16943854762216 ], [ 115, 33.13666007482172 ], [ 120, 33.327535934115794 ], [ 125, 33.34848294635084 ], [ 130, 33.187611558892385 ], [ 135, 33.288422920014504 ], [ 140, 33.20688271199212 ], [ 145, 33.37440608172315 ], [ 150, 32.8993382359236 ], [ 155, 33.14712051297417 ], [ 160, 33.24392212928798 ], [ 165, 33.28147916684502 ], [ 170, 32.88342336635019 ], [ 175, 33.243969214700925 ], [ 180, 33.01620352847466 ], [ 185, 33.19779040052735 ], [ 190, 33.119563345589874 ], [ 195, 32.46993613451134 ], [ 200, 32.98808557633039 ], [ 205, 32.79075320183549 ], [ 210, 33.02361567700843 ], [ 215, 32.96320885555784 ], [ 220, 32.96087168687076 ], [ 225, 33.06770762623938 ], [ 230, 32.75321427654164 ], [ 235, 32.87248623798231 ], [ 240, 32.57000265395053 ], [ 245, 32.91183747549377 ], [ 250, 32.176411516433085 ], [ 255, 32.442170417868795 ], [ 260, 32.49928172112973 ], [ 265, 32.936500380970315 ], [ 270, 32.35200202042686 ], [ 275, 32.53089424397316 ], [ 280, 32.08000410936036 ], [ 285, 31.768664191694096 ], [ 290, 31.83592979548377 ], [ 295, 31.640522760567773 ], [ 300, 31.614088494323 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPFS2_R1", "pairs": [ [ 1, 32.15125983783677 ], [ 2, 33.048559760521776 ], [ 3, 33.554432726047224 ], [ 4, 33.2905854132387 ], [ 5, 33.11828202129136 ], [ 6, 33.03168427730309 ], [ 7, 33.48148900739449 ], [ 8, 33.43873778324049 ], [ 9, 33.36483258331186 ], [ 10, 33.31312967111393 ], [ 15, 33.47825367246198 ], [ 20, 33.715533374303675 ], [ 25, 33.64769938346252 ], [ 30, 33.51571873203418 ], [ 35, 33.58712903673453 ], [ 40, 33.16808774260056 ], [ 45, 33.58244553258133 ], [ 50, 33.55370715461016 ], [ 55, 33.34033860000396 ], [ 60, 33.25837083440716 ], [ 65, 33.5344150823702 ], [ 70, 33.5805333546882 ], [ 75, 33.3230801254888 ], [ 80, 33.6055378256442 ], [ 85, 33.56363582305249 ], [ 90, 32.93841975357593 ], [ 95, 33.17067692277192 ], [ 100, 33.20174162148231 ], [ 105, 33.4488615524915 ], [ 110, 33.163372421518 ], [ 115, 33.114725969687655 ], [ 120, 33.31690175748143 ], [ 125, 33.34282089152781 ], [ 130, 33.18532359267666 ], [ 135, 33.28227748976537 ], [ 140, 33.223727486296 ], [ 145, 33.36936748510651 ], [ 150, 32.888738439578525 ], [ 155, 33.123468770754236 ], [ 160, 33.23137313210914 ], [ 165, 33.26832304909177 ], [ 170, 32.85305776522192 ], [ 175, 33.21665601070553 ], [ 180, 33.040528337422245 ], [ 185, 33.186593726060266 ], [ 190, 33.10621524370298 ], [ 195, 32.45989109038324 ], [ 200, 32.968652018972946 ], [ 205, 32.74572984868236 ], [ 210, 32.985485797552556 ], [ 215, 32.951622258286726 ], [ 220, 32.94451967208239 ], [ 225, 33.052258646497286 ], [ 230, 32.73189266348794 ], [ 235, 32.85217885388406 ], [ 240, 32.53595959495829 ], [ 245, 32.89145054369424 ], [ 250, 32.15660916710647 ], [ 255, 32.419936061064156 ], [ 260, 32.499266932665854 ], [ 265, 32.898464969889226 ], [ 270, 32.31271193611654 ], [ 275, 32.50090139631019 ], [ 280, 32.02008997867746 ], [ 285, 31.745378392846522 ], [ 290, 31.804100184885034 ], [ 295, 31.618504234964625 ], [ 300, 31.6216436142754 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPMS1_R1", "pairs": [ [ 1, 32.237502543740504 ], [ 2, 33.0974666710837 ], [ 3, 33.5894710439511 ], [ 4, 33.36265457660327 ], [ 5, 33.236849453154946 ], [ 6, 33.078706880640596 ], [ 7, 33.51767367240409 ], [ 8, 33.46807191568506 ], [ 9, 33.38895330402313 ], [ 10, 33.39607577743809 ], [ 15, 33.41166003322243 ], [ 20, 33.681371300928056 ], [ 25, 33.58272906679034 ], [ 30, 33.5061376317421 ], [ 35, 33.57007046752768 ], [ 40, 33.3809155572803 ], [ 45, 33.60387216461669 ], [ 50, 33.526444962920536 ], [ 55, 33.38671102634605 ], [ 60, 33.352657558103765 ], [ 65, 33.51342858359796 ], [ 70, 33.529093589075906 ], [ 75, 33.341504576388296 ], [ 80, 33.593601223474785 ], [ 85, 33.54614955040227 ], [ 90, 33.09173970657832 ], [ 95, 33.2879687647894 ], [ 100, 33.25626881211547 ], [ 105, 33.42069758637009 ], [ 110, 33.18645716990061 ], [ 115, 32.96444297207762 ], [ 120, 33.26654229540178 ], [ 125, 33.22707632312505 ], [ 130, 33.06586117302969 ], [ 135, 33.17149347606946 ], [ 140, 33.17908556121893 ], [ 145, 33.263038632459214 ], [ 150, 33.02680189880307 ], [ 155, 33.107687502070604 ], [ 160, 33.19323208276737 ], [ 165, 33.2211026498999 ], [ 170, 32.850610769034176 ], [ 175, 33.16489296751873 ], [ 180, 32.956626642876415 ], [ 185, 33.125409731874214 ], [ 190, 33.1015898258717 ], [ 195, 32.530454702505196 ], [ 200, 32.92747762458527 ], [ 205, 32.587432965160914 ], [ 210, 32.79732202443215 ], [ 215, 32.91663250961998 ], [ 220, 32.93847471826353 ], [ 225, 33.009447455881485 ], [ 230, 32.76466935205214 ], [ 235, 32.846615395056425 ], [ 240, 32.63339258868237 ], [ 245, 32.861353276690416 ], [ 250, 32.38252431779991 ], [ 255, 32.25862778974274 ], [ 260, 32.59403119305138 ], [ 265, 32.68011549475777 ], [ 270, 32.43170047097247 ], [ 275, 32.42337290901596 ], [ 280, 31.883324426839625 ], [ 285, 31.89422802018347 ], [ 290, 31.995175091085223 ], [ 295, 31.79661489828327 ], [ 300, 31.24348805989202 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPMS2_R1", "pairs": [ [ 1, 32.13068685679367 ], [ 2, 33.06248556162485 ], [ 3, 33.54606493729088 ], [ 4, 33.308925337764826 ], [ 5, 33.2132482804361 ], [ 6, 33.0310080407777 ], [ 7, 33.502537427994426 ], [ 8, 33.449955660215664 ], [ 9, 33.39782846837716 ], [ 10, 33.37169109701843 ], [ 15, 33.40742970840071 ], [ 20, 33.69405250724713 ], [ 25, 33.60664575120537 ], [ 30, 33.50130336609758 ], [ 35, 33.57715495077911 ], [ 40, 33.285817526010305 ], [ 45, 33.59691906394396 ], [ 50, 33.525331644060216 ], [ 55, 33.36759874795051 ], [ 60, 33.33608585482188 ], [ 65, 33.50696527053212 ], [ 70, 33.54351751188942 ], [ 75, 33.32023580616792 ], [ 80, 33.58762283246906 ], [ 85, 33.54993956325805 ], [ 90, 33.04992547102314 ], [ 95, 33.24471887669927 ], [ 100, 33.23261537085618 ], [ 105, 33.40716819699499 ], [ 110, 33.176903528325916 ], [ 115, 32.980002235885976 ], [ 120, 33.26241848332402 ], [ 125, 33.24023104155022 ], [ 130, 33.07346273393333 ], [ 135, 33.19286294560008 ], [ 140, 33.18229450038383 ], [ 145, 33.294879624744375 ], [ 150, 32.95355260902295 ], [ 155, 33.09527387101342 ], [ 160, 33.1955041775671 ], [ 165, 33.22696449999628 ], [ 170, 32.833237185937136 ], [ 175, 33.16255916046181 ], [ 180, 32.968325022918854 ], [ 185, 33.12344499030788 ], [ 190, 33.079298389460654 ], [ 195, 32.48648688937585 ], [ 200, 32.92872560857445 ], [ 205, 32.60700177392185 ], [ 210, 32.830211827139514 ], [ 215, 32.9016032497298 ], [ 220, 32.91623895949018 ], [ 225, 32.998064245190854 ], [ 230, 32.726830249996276 ], [ 235, 32.8286534190009 ], [ 240, 32.56457864372922 ], [ 245, 32.85939941248148 ], [ 250, 32.276076326774 ], [ 255, 32.254488670244484 ], [ 260, 32.52737626714371 ], [ 265, 32.734853905784135 ], [ 270, 32.35957513416816 ], [ 275, 32.436191444737105 ], [ 280, 31.911713755317447 ], [ 285, 31.800747559371974 ], [ 290, 31.85768065034482 ], [ 295, 31.688285430417018 ], [ 300, 31.333521898581935 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVFS1_R1", "pairs": [ [ 1, 32.185063072088894 ], [ 2, 33.07481214991575 ], [ 3, 33.5637324104012 ], [ 4, 33.371410355662825 ], [ 5, 33.20295095405073 ], [ 6, 33.03248781820666 ], [ 7, 33.50565144132246 ], [ 8, 33.44303474657316 ], [ 9, 33.37680222232342 ], [ 10, 33.328546837287675 ], [ 15, 33.48923721480942 ], [ 20, 33.723215082654036 ], [ 25, 33.63834965162348 ], [ 30, 33.52353021540143 ], [ 35, 33.591261996733735 ], [ 40, 33.19879115155223 ], [ 45, 33.5886593054189 ], [ 50, 33.54021588198222 ], [ 55, 33.279006586919095 ], [ 60, 33.20587811922051 ], [ 65, 33.523770305111924 ], [ 70, 33.591855631266526 ], [ 75, 33.33066890428922 ], [ 80, 33.604850538898155 ], [ 85, 33.564490487903576 ], [ 90, 33.0072722303207 ], [ 95, 33.219207361516034 ], [ 100, 33.22969752186589 ], [ 105, 33.39507835276968 ], [ 110, 33.18130284256559 ], [ 115, 33.14354956268222 ], [ 120, 33.30335670133451 ], [ 125, 33.328601104247525 ], [ 130, 33.15868095218239 ], [ 135, 33.26721999468657 ], [ 140, 33.2022570912238 ], [ 145, 33.35229556740012 ], [ 150, 32.89361019744335 ], [ 155, 33.12319636495498 ], [ 160, 33.2197299365843 ], [ 165, 33.255634521466575 ], [ 170, 32.85079451855091 ], [ 175, 33.20574750346235 ], [ 180, 33.00528099715723 ], [ 185, 33.15932648152198 ], [ 190, 33.09628617246155 ], [ 195, 32.48176616371456 ], [ 200, 32.96207631751585 ], [ 205, 32.7388566950944 ], [ 210, 32.97574349442379 ], [ 215, 32.937448131508475 ], [ 220, 32.93171633971444 ], [ 225, 33.04639566129907 ], [ 230, 32.731644646924835 ], [ 235, 32.84090964456461 ], [ 240, 32.561042014050244 ], [ 245, 32.8897028674521 ], [ 250, 32.18970377862213 ], [ 255, 32.4240002186808 ], [ 260, 32.51024610702603 ], [ 265, 32.87783032191637 ], [ 270, 32.327314860986675 ], [ 275, 32.506776995107785 ], [ 280, 32.0865104242601 ], [ 285, 31.785217817287513 ], [ 290, 31.770769919411357 ], [ 295, 31.567173105252742 ], [ 300, 31.611887050848466 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVFS2_R1", "pairs": [ [ 1, 32.29152644030522 ], [ 2, 33.118969711105926 ], [ 3, 33.63192829295925 ], [ 4, 33.40719736096764 ], [ 5, 33.25837859451534 ], [ 6, 33.15960814368065 ], [ 7, 33.53999533504382 ], [ 8, 33.50489487188031 ], [ 9, 33.412382126553595 ], [ 10, 33.24568458231982 ], [ 15, 33.42405651261204 ], [ 20, 33.631528439572165 ], [ 25, 33.526073772949914 ], [ 30, 33.448566192396115 ], [ 35, 33.56300156609244 ], [ 40, 33.60512745326713 ], [ 45, 33.62498550531472 ], [ 50, 33.48718136683216 ], [ 55, 33.440061310852684 ], [ 60, 33.416864483022884 ], [ 65, 33.2182466428976 ], [ 70, 33.500233914231444 ], [ 75, 33.48941388157675 ], [ 80, 33.589380249931295 ], [ 85, 33.55040871617441 ], [ 90, 33.40998333888704 ], [ 95, 33.46607397534156 ], [ 100, 33.17037581670672 ], [ 105, 33.269144079600665 ], [ 110, 33.16880885577378 ], [ 115, 33.29881438730015 ], [ 120, 33.18362534905265 ], [ 125, 33.10404467873828 ], [ 130, 33.305646822038135 ], [ 135, 33.114923791561424 ], [ 140, 33.159816407146124 ], [ 145, 33.21526578161655 ], [ 150, 33.20215132591788 ], [ 155, 33.218983385205966 ], [ 160, 33.31558111791639 ], [ 165, 33.32215372516611 ], [ 170, 32.45100268582511 ], [ 175, 33.21360906915833 ], [ 180, 32.90040320699514 ], [ 185, 32.6584828789244 ], [ 190, 33.10862802074031 ], [ 195, 32.86632272314405 ], [ 200, 32.97820387217168 ], [ 205, 32.41262021393582 ], [ 210, 32.660136625678966 ], [ 215, 32.935375387383786 ], [ 220, 33.034048452131024 ], [ 225, 33.22895531340598 ], [ 230, 32.65933819854043 ], [ 235, 32.586616015195446 ], [ 240, 32.974225065813584 ], [ 245, 32.745485687627045 ], [ 250, 32.85840247925622 ], [ 255, 32.52448265520344 ], [ 260, 32.79518204423282 ], [ 265, 32.57669201495571 ], [ 270, 32.56502683604993 ], [ 275, 32.09811184942782 ], [ 280, 31.983129976195762 ], [ 285, 32.29468605227534 ], [ 290, 32.06591832304467 ], [ 295, 31.523035051546707 ], [ 300, 31.427538442926085 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVMS1_R1", "pairs": [ [ 1, 32.17708912185333 ], [ 2, 33.06937874124344 ], [ 3, 33.57206077550092 ], [ 4, 33.38159747315806 ], [ 5, 33.185404435793856 ], [ 6, 33.038495757404746 ], [ 7, 33.49749648009997 ], [ 8, 33.44759883792912 ], [ 9, 33.37441946843031 ], [ 10, 33.31939788834791 ], [ 15, 33.480374649809534 ], [ 20, 33.702258782474495 ], [ 25, 33.616178583459785 ], [ 30, 33.5157400715785 ], [ 35, 33.596778140241284 ], [ 40, 33.23411554253899 ], [ 45, 33.599428701418745 ], [ 50, 33.53368987341152 ], [ 55, 33.2768562271616 ], [ 60, 33.21027249141176 ], [ 65, 33.50587628895666 ], [ 70, 33.580951229134094 ], [ 75, 33.337995317858656 ], [ 80, 33.60067486885321 ], [ 85, 33.566146340828475 ], [ 90, 33.07945759314879 ], [ 95, 33.25432952026763 ], [ 100, 33.228470394452664 ], [ 105, 33.3993024682613 ], [ 110, 33.17172649129627 ], [ 115, 33.11568225994558 ], [ 120, 33.31134263458741 ], [ 125, 33.30535239658474 ], [ 130, 33.17228538850593 ], [ 135, 33.27985843541764 ], [ 140, 33.2135227640819 ], [ 145, 33.33060191931726 ], [ 150, 32.91956635479751 ], [ 155, 33.09851673909485 ], [ 160, 33.20391901621404 ], [ 165, 33.249340624305276 ], [ 170, 32.83461491938968 ], [ 175, 33.18804006612408 ], [ 180, 33.01366833128856 ], [ 185, 33.15092204919547 ], [ 190, 33.098887983249185 ], [ 195, 32.51916868035495 ], [ 200, 32.94397002364583 ], [ 205, 32.76269890872016 ], [ 210, 32.92139040975557 ], [ 215, 32.9447943157828 ], [ 220, 32.963034155417375 ], [ 225, 33.04305326854224 ], [ 230, 32.74810475137103 ], [ 235, 32.852961619997934 ], [ 240, 32.56992249044452 ], [ 245, 32.85295420570708 ], [ 250, 32.21454045849019 ], [ 255, 32.45483332997295 ], [ 260, 32.484021395056786 ], [ 265, 32.81935924282007 ], [ 270, 32.30965056441584 ], [ 275, 32.42988000227326 ], [ 280, 32.0692286633836 ], [ 285, 31.769555646866422 ], [ 290, 31.770165082111976 ], [ 295, 31.50262781968309 ], [ 300, 31.343766984211612 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVMS2_R1", "pairs": [ [ 1, 32.18046605980021 ], [ 2, 33.06505062902731 ], [ 3, 33.56332037775732 ], [ 4, 33.34442228359074 ], [ 5, 33.21992942620436 ], [ 6, 33.035056765879105 ], [ 7, 33.49667587194436 ], [ 8, 33.439100269339605 ], [ 9, 33.37226824861069 ], [ 10, 33.33978043708022 ], [ 15, 33.42940063414135 ], [ 20, 33.664694350686986 ], [ 25, 33.58133544713784 ], [ 30, 33.452909890559475 ], [ 35, 33.56753941120438 ], [ 40, 33.24092557310479 ], [ 45, 33.5686245429207 ], [ 50, 33.50999906240144 ], [ 55, 33.26581275768591 ], [ 60, 33.209708655108344 ], [ 65, 33.47084164407848 ], [ 70, 33.51781779864916 ], [ 75, 33.3065267608275 ], [ 80, 33.56428006711131 ], [ 85, 33.53675409121547 ], [ 90, 33.09097976371107 ], [ 95, 33.232834955759756 ], [ 100, 33.18364560069558 ], [ 105, 33.370659938285286 ], [ 110, 33.14066351842065 ], [ 115, 33.09079052798472 ], [ 120, 33.267877661660165 ], [ 125, 33.24192338510323 ], [ 130, 33.12851151610209 ], [ 135, 33.23636906081116 ], [ 140, 33.1739741207358 ], [ 145, 33.25374330984971 ], [ 150, 32.898289133826054 ], [ 155, 33.03676402400216 ], [ 160, 33.16072902103863 ], [ 165, 33.20157193030313 ], [ 170, 32.778143008149485 ], [ 175, 33.118169263818324 ], [ 180, 32.96922460531251 ], [ 185, 33.101231803368755 ], [ 190, 33.05415455436682 ], [ 195, 32.48439196965176 ], [ 200, 32.903666510378926 ], [ 205, 32.68367759260049 ], [ 210, 32.760983760283025 ], [ 215, 32.887638208090024 ], [ 220, 32.90869954392396 ], [ 225, 32.98541206895519 ], [ 230, 32.67671648662705 ], [ 235, 32.793876663625745 ], [ 240, 32.54795969912267 ], [ 245, 32.77672887873336 ], [ 250, 32.214313606793596 ], [ 255, 32.39358496679087 ], [ 260, 32.460571077783555 ], [ 265, 32.68317545849071 ], [ 270, 32.25261964241561 ], [ 275, 32.23379642145227 ], [ 280, 31.941430961488965 ], [ 285, 31.729552342923945 ], [ 290, 31.691787800964637 ], [ 295, 31.373487639718185 ], [ 300, 30.653848988993786 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null } ] } ], "pconfig": { "id": "fastqc_per_base_sequence_quality_plot", "title": "FastQC: Mean Quality Scores", "anchor": null, "table_title": null, "height": null, "width": null, "square": false, "logswitch": false, "logswitch_active": false, "logswitch_label": "Log10", "cpswitch": true, "cpswitch_c_active": true, "cpswitch_counts_label": "Counts", "cpswitch_percent_label": "Percentages", "xLog": null, "yLog": null, "xlog": false, "ylog": false, "data_labels": [], "xTitle": null, "yTitle": null, "xlab": "Position (bp)", "ylab": "Phred Score", "xsuffix": null, "ysuffix": null, "tt_suffix": null, "xLabFormat": null, "yLabFormat": null, "xLabelFormat": null, "yLabelFormat": null, "xlab_format": null, "ylab_format": null, "tt_label": "Base {point.x}: {point.y:.2f}", "xDecimals": null, "yDecimals": null, "decimalPlaces": null, "x_decimals": 0, "y_decimals": null, "tt_decimals": null, "xmin": 0, "xmax": null, "ymin": 0, "ymax": null, "xFloor": null, "xCeiling": null, "yFloor": null, "yCeiling": null, "x_clipmin": null, "x_clipmax": null, "y_clipmin": null, "y_clipmax": null, "save_data_file": true, "showlegend": false, "xMinRange": null, "yMinRange": null, "x_minrange": null, "y_minrange": null, "xPlotBands": null, "yPlotBands": null, "xPlotLines": null, "yPlotLines": null, "x_bands": null, "y_bands": [ { "from_": 28, "to": 100, "color": "#c3e6c3" }, { "from_": 20, "to": 28, "color": "#e6dcc3" }, { "from_": 0, "to": 20, "color": "#e6c3c3" } ], "x_lines": null, "y_lines": null, "categories": false, "smooth_points": 500, "smooth_points_sumcounts": null, "extra_series": null, "style": null, "hide_zero_cats": false, "hide_empty": false, "colors": { "CAFS1_R1": "#5cb85c", "CAFS2_R1": "#5cb85c", "CAMS1_R1": "#5cb85c", "CAMS2_R1": "#5cb85c", "CCFS1_R1": "#5cb85c", "CCFS2_R1": "#5cb85c", "CCMS1_R1": "#5cb85c", "CCMS2_R1": "#5cb85c", "CPFS1_R1": "#5cb85c", "CPFS2_R1": "#5cb85c", "CPMS1_R1": "#5cb85c", "CPMS2_R1": "#5cb85c", "CVFS1_R1": "#5cb85c", "CVFS2_R1": "#5cb85c", "CVMS1_R1": "#5cb85c", "CVMS2_R1": "#5cb85c", "DAFS1_R1": "#5cb85c", "DAFS2_R1": "#5cb85c", "DAMS1_R1": "#5cb85c", "DAMS2_R1": "#5cb85c", "DCFS1_R1": "#5cb85c", "DCFS2_R1": "#5cb85c", "DCMS1_R1": "#5cb85c", "DCMS2_R1": "#5cb85c", "DPFS1_R1": "#5cb85c", "DPFS2_R1": "#5cb85c", "DPMS1_R1": "#5cb85c", "DPMS2_R1": "#5cb85c", "DVFS1_R1": "#5cb85c", "DVFS2_R1": "#5cb85c", "DVMS1_R1": "#5cb85c", "DVMS2_R1": "#5cb85c", "IAFS1_R1": "#5cb85c", "IAFS2_R1": "#5cb85c", "IAMS1_R1": "#5cb85c", "IAMS2_R1": "#5cb85c", "ICFS1_R1": "#5cb85c", "ICFS2_R1": "#5cb85c", "ICMS1_R1": "#5cb85c", "ICMS2_R1": "#5cb85c", "IPFS1_R1": "#5cb85c", "IPFS2_R1": "#5cb85c", "IPMS1_R1": "#5cb85c", "IPMS2_R1": "#5cb85c", "IVFS1_R1": "#5cb85c", "IVFS2_R1": "#5cb85c", "IVMS1_R1": "#5cb85c", "IVMS2_R1": "#5cb85c", "JAFS1_R1": "#5cb85c", "JAFS2_R1": "#5cb85c", "JAMS1_R1": "#5cb85c", "JAMS2_R1": "#5cb85c", "JCFS1_R1": "#5cb85c", "JCFS2_R1": "#5cb85c", "JCMS1_R1": "#5cb85c", "JCMS2_R1": "#5cb85c", "JPFS1_R1": "#5cb85c", "JPFS2_R1": "#5cb85c", "JPMS1_R1": "#5cb85c", "JPMS2_R1": "#5cb85c", "JVFS1_R1": "#5cb85c", "JVFS2_R1": "#5cb85c", "JVMS1_R1": "#5cb85c", "JVMS2_R1": "#5cb85c" } }, "add_log_tab": false, "add_pct_tab": false, "l_active": false, "p_active": false, "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "yaxis" ], "square": false, "flat": false, "defer_render": false }, "fastqc_per_sequence_quality_scores_plot": { "id": "fastqc_per_sequence_quality_scores_plot", "anchor": "fastqc_per_sequence_quality_scores_plot", "plot_type": "xy_line", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 500, "hoverlabel": { "namelength": -1 }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "white", "plot_bgcolor": "white", "showlegend": false, "title": { "font": { "size": 20 }, "text": "FastQC: Per Sequence Quality Scores", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "shapes": [ { "fillcolor": "#c3e6c3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 28, "x1": 100, "y0": 0, "y1": 1, "yref": "paper" }, { "fillcolor": "#e6dcc3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 20, "x1": 28, "y0": 0, "y1": 1, "yref": "paper" }, { "fillcolor": "#e6c3c3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 20, "y0": 0, "y1": 1, "yref": "paper" }, { "fillcolor": "#c3e6c3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 28, "x1": 100, "y0": 0, "y1": 1, "yref": "paper" }, { "fillcolor": "#e6dcc3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 20, "x1": 28, "y0": 0, "y1": 1, "yref": "paper" }, { "fillcolor": "#e6c3c3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 20, "y0": 0, "y1": 1, "yref": "paper" } ], "hoverdistance": -1 }, "datasets": [ { "plot_id": "fastqc_per_sequence_quality_scores_plot", "label": "1", "uid": "fastqc_per_sequence_quality_scores_plot", "dconfig": { "title": "FastQC: Per Sequence Quality Scores
64 samples" }, "layout": { "title": { "text": "FastQC: Per Sequence Quality Scores
64 samples" }, "xaxis": { "hoverformat": ",.0f", "ticksuffix": "", "title": { "text": "Mean Sequence Quality (Phred Score)" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": null }, "range": [ 0, 40.0 ] }, "yaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "Count" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": null } } }, "trace_params": { "hovertemplate": "%{text}
Phred %{x}: %{y} reads", "mode": "lines", "line": { "width": 2 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "n_samples": 64, "lines": [ { "name": "CAFS1_R1", "pairs": [ [ 15.0, 1.0 ], [ 16.0, 4.0 ], [ 17.0, 12.0 ], [ 18.0, 24.0 ], [ 19.0, 40.0 ], [ 20.0, 56.0 ], [ 21.0, 68.0 ], [ 22.0, 120.0 ], [ 23.0, 245.0 ], [ 24.0, 383.0 ], [ 25.0, 411.0 ], [ 26.0, 378.0 ], [ 27.0, 372.0 ], [ 28.0, 459.0 ], [ 29.0, 485.0 ], [ 30.0, 545.0 ], [ 31.0, 648.0 ], [ 32.0, 804.0 ], [ 33.0, 928.0 ], [ 34.0, 1200.0 ], [ 35.0, 1554.0 ], [ 36.0, 2183.0 ], [ 37.0, 3298.0 ], [ 38.0, 7110.0 ], [ 39.0, 129720.0 ], [ 40.0, 12893.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAFS2_R1", "pairs": [ [ 17.0, 8.0 ], [ 18.0, 21.0 ], [ 19.0, 35.0 ], [ 20.0, 45.0 ], [ 21.0, 60.0 ], [ 22.0, 84.0 ], [ 23.0, 206.0 ], [ 24.0, 312.0 ], [ 25.0, 327.0 ], [ 26.0, 338.0 ], [ 27.0, 334.0 ], [ 28.0, 386.0 ], [ 29.0, 440.0 ], [ 30.0, 515.0 ], [ 31.0, 605.0 ], [ 32.0, 710.0 ], [ 33.0, 898.0 ], [ 34.0, 1106.0 ], [ 35.0, 1521.0 ], [ 36.0, 2211.0 ], [ 37.0, 3316.0 ], [ 38.0, 7327.0 ], [ 39.0, 121923.0 ], [ 40.0, 8716.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAMS1_R1", "pairs": [ [ 16.0, 2.0 ], [ 17.0, 9.0 ], [ 18.0, 17.0 ], [ 19.0, 33.0 ], [ 20.0, 54.0 ], [ 21.0, 62.0 ], [ 22.0, 127.0 ], [ 23.0, 213.0 ], [ 24.0, 308.0 ], [ 25.0, 372.0 ], [ 26.0, 349.0 ], [ 27.0, 364.0 ], [ 28.0, 422.0 ], [ 29.0, 441.0 ], [ 30.0, 534.0 ], [ 31.0, 580.0 ], [ 32.0, 710.0 ], [ 33.0, 897.0 ], [ 34.0, 1054.0 ], [ 35.0, 1439.0 ], [ 36.0, 2072.0 ], [ 37.0, 3040.0 ], [ 38.0, 6616.0 ], [ 39.0, 115401.0 ], [ 40.0, 11862.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAMS2_R1", "pairs": [ [ 16.0, 6.0 ], [ 17.0, 8.0 ], [ 18.0, 20.0 ], [ 19.0, 38.0 ], [ 20.0, 58.0 ], [ 21.0, 72.0 ], [ 22.0, 121.0 ], [ 23.0, 216.0 ], [ 24.0, 364.0 ], [ 25.0, 385.0 ], [ 26.0, 379.0 ], [ 27.0, 403.0 ], [ 28.0, 423.0 ], [ 29.0, 477.0 ], [ 30.0, 583.0 ], [ 31.0, 664.0 ], [ 32.0, 792.0 ], [ 33.0, 955.0 ], [ 34.0, 1223.0 ], [ 35.0, 1569.0 ], [ 36.0, 2303.0 ], [ 37.0, 3410.0 ], [ 38.0, 7034.0 ], [ 39.0, 131068.0 ], [ 40.0, 14703.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCFS1_R1", "pairs": [ [ 14.0, 1.0 ], [ 15.0, 17.0 ], [ 16.0, 70.0 ], [ 17.0, 84.0 ], [ 18.0, 177.0 ], [ 19.0, 303.0 ], [ 20.0, 598.0 ], [ 21.0, 837.0 ], [ 22.0, 922.0 ], [ 23.0, 853.0 ], [ 24.0, 842.0 ], [ 25.0, 907.0 ], [ 26.0, 1086.0 ], [ 27.0, 1257.0 ], [ 28.0, 1614.0 ], [ 29.0, 2417.0 ], [ 30.0, 3748.0 ], [ 31.0, 6730.0 ], [ 32.0, 20509.0 ], [ 33.0, 170909.0 ], [ 34.0, 2806.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCFS2_R1", "pairs": [ [ 15.0, 21.0 ], [ 16.0, 46.0 ], [ 17.0, 63.0 ], [ 18.0, 168.0 ], [ 19.0, 283.0 ], [ 20.0, 517.0 ], [ 21.0, 758.0 ], [ 22.0, 850.0 ], [ 23.0, 844.0 ], [ 24.0, 817.0 ], [ 25.0, 835.0 ], [ 26.0, 937.0 ], [ 27.0, 1189.0 ], [ 28.0, 1496.0 ], [ 29.0, 2250.0 ], [ 30.0, 3561.0 ], [ 31.0, 6372.0 ], [ 32.0, 19788.0 ], [ 33.0, 159546.0 ], [ 34.0, 2658.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCMS1_R1", "pairs": [ [ 15.0, 14.0 ], [ 16.0, 55.0 ], [ 17.0, 56.0 ], [ 18.0, 166.0 ], [ 19.0, 328.0 ], [ 20.0, 569.0 ], [ 21.0, 794.0 ], [ 22.0, 917.0 ], [ 23.0, 865.0 ], [ 24.0, 832.0 ], [ 25.0, 886.0 ], [ 26.0, 1031.0 ], [ 27.0, 1208.0 ], [ 28.0, 1664.0 ], [ 29.0, 2334.0 ], [ 30.0, 3710.0 ], [ 31.0, 6764.0 ], [ 32.0, 21336.0 ], [ 33.0, 164098.0 ], [ 34.0, 2363.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCMS2_R1", "pairs": [ [ 15.0, 17.0 ], [ 16.0, 39.0 ], [ 17.0, 62.0 ], [ 18.0, 150.0 ], [ 19.0, 264.0 ], [ 20.0, 509.0 ], [ 21.0, 761.0 ], [ 22.0, 854.0 ], [ 23.0, 832.0 ], [ 24.0, 802.0 ], [ 25.0, 786.0 ], [ 26.0, 899.0 ], [ 27.0, 1192.0 ], [ 28.0, 1441.0 ], [ 29.0, 2185.0 ], [ 30.0, 3496.0 ], [ 31.0, 6405.0 ], [ 32.0, 20400.0 ], [ 33.0, 153644.0 ], [ 34.0, 2185.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPFS1_R1", "pairs": [ [ 15.0, 17.0 ], [ 16.0, 38.0 ], [ 17.0, 73.0 ], [ 18.0, 110.0 ], [ 19.0, 185.0 ], [ 20.0, 402.0 ], [ 21.0, 560.0 ], [ 22.0, 585.0 ], [ 23.0, 502.0 ], [ 24.0, 568.0 ], [ 25.0, 579.0 ], [ 26.0, 736.0 ], [ 27.0, 931.0 ], [ 28.0, 1181.0 ], [ 29.0, 1697.0 ], [ 30.0, 2592.0 ], [ 31.0, 4696.0 ], [ 32.0, 13539.0 ], [ 33.0, 117702.0 ], [ 34.0, 3009.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPFS2_R1", "pairs": [ [ 15.0, 24.0 ], [ 16.0, 51.0 ], [ 17.0, 83.0 ], [ 18.0, 121.0 ], [ 19.0, 272.0 ], [ 20.0, 525.0 ], [ 21.0, 743.0 ], [ 22.0, 785.0 ], [ 23.0, 756.0 ], [ 24.0, 710.0 ], [ 25.0, 752.0 ], [ 26.0, 897.0 ], [ 27.0, 1061.0 ], [ 28.0, 1399.0 ], [ 29.0, 2042.0 ], [ 30.0, 3185.0 ], [ 31.0, 5697.0 ], [ 32.0, 18142.0 ], [ 33.0, 139961.0 ], [ 34.0, 1986.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPMS1_R1", "pairs": [ [ 15.0, 20.0 ], [ 16.0, 46.0 ], [ 17.0, 97.0 ], [ 18.0, 215.0 ], [ 19.0, 422.0 ], [ 20.0, 777.0 ], [ 21.0, 1081.0 ], [ 22.0, 1158.0 ], [ 23.0, 1061.0 ], [ 24.0, 1029.0 ], [ 25.0, 1088.0 ], [ 26.0, 1243.0 ], [ 27.0, 1487.0 ], [ 28.0, 2045.0 ], [ 29.0, 2998.0 ], [ 30.0, 4968.0 ], [ 31.0, 9584.0 ], [ 32.0, 34907.0 ], [ 33.0, 160284.0 ], [ 34.0, 1434.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPMS2_R1", "pairs": [ [ 15.0, 15.0 ], [ 16.0, 45.0 ], [ 17.0, 85.0 ], [ 18.0, 148.0 ], [ 19.0, 346.0 ], [ 20.0, 622.0 ], [ 21.0, 895.0 ], [ 22.0, 953.0 ], [ 23.0, 878.0 ], [ 24.0, 878.0 ], [ 25.0, 863.0 ], [ 26.0, 977.0 ], [ 27.0, 1134.0 ], [ 28.0, 1631.0 ], [ 29.0, 2342.0 ], [ 30.0, 3651.0 ], [ 31.0, 6596.0 ], [ 32.0, 20903.0 ], [ 33.0, 159155.0 ], [ 34.0, 2660.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVFS1_R1", "pairs": [ [ 2.0, 1.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 2.0 ], [ 15.0, 28.0 ], [ 16.0, 58.0 ], [ 17.0, 80.0 ], [ 18.0, 149.0 ], [ 19.0, 307.0 ], [ 20.0, 527.0 ], [ 21.0, 764.0 ], [ 22.0, 880.0 ], [ 23.0, 909.0 ], [ 24.0, 952.0 ], [ 25.0, 891.0 ], [ 26.0, 1002.0 ], [ 27.0, 1325.0 ], [ 28.0, 1781.0 ], [ 29.0, 2546.0 ], [ 30.0, 4010.0 ], [ 31.0, 7259.0 ], [ 32.0, 23480.0 ], [ 33.0, 170096.0 ], [ 34.0, 2355.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVFS2_R1", "pairs": [ [ 15.0, 22.0 ], [ 16.0, 48.0 ], [ 17.0, 94.0 ], [ 18.0, 168.0 ], [ 19.0, 304.0 ], [ 20.0, 547.0 ], [ 21.0, 810.0 ], [ 22.0, 886.0 ], [ 23.0, 873.0 ], [ 24.0, 848.0 ], [ 25.0, 891.0 ], [ 26.0, 1056.0 ], [ 27.0, 1192.0 ], [ 28.0, 1629.0 ], [ 29.0, 2357.0 ], [ 30.0, 3596.0 ], [ 31.0, 6531.0 ], [ 32.0, 20855.0 ], [ 33.0, 161490.0 ], [ 34.0, 2541.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVMS1_R1", "pairs": [ [ 15.0, 20.0 ], [ 16.0, 40.0 ], [ 17.0, 67.0 ], [ 18.0, 139.0 ], [ 19.0, 281.0 ], [ 20.0, 550.0 ], [ 21.0, 766.0 ], [ 22.0, 789.0 ], [ 23.0, 805.0 ], [ 24.0, 778.0 ], [ 25.0, 862.0 ], [ 26.0, 892.0 ], [ 27.0, 1106.0 ], [ 28.0, 1447.0 ], [ 29.0, 2074.0 ], [ 30.0, 3394.0 ], [ 31.0, 6351.0 ], [ 32.0, 20491.0 ], [ 33.0, 140869.0 ], [ 34.0, 1643.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVMS2_R1", "pairs": [ [ 14.0, 2.0 ], [ 15.0, 24.0 ], [ 16.0, 42.0 ], [ 17.0, 78.0 ], [ 18.0, 185.0 ], [ 19.0, 332.0 ], [ 20.0, 678.0 ], [ 21.0, 1007.0 ], [ 22.0, 1078.0 ], [ 23.0, 1027.0 ], [ 24.0, 960.0 ], [ 25.0, 994.0 ], [ 26.0, 1097.0 ], [ 27.0, 1396.0 ], [ 28.0, 1822.0 ], [ 29.0, 2555.0 ], [ 30.0, 4025.0 ], [ 31.0, 7386.0 ], [ 32.0, 22816.0 ], [ 33.0, 178338.0 ], [ 34.0, 2513.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAFS1_R1", "pairs": [ [ 17.0, 6.0 ], [ 18.0, 10.0 ], [ 19.0, 14.0 ], [ 20.0, 27.0 ], [ 21.0, 43.0 ], [ 22.0, 82.0 ], [ 23.0, 124.0 ], [ 24.0, 186.0 ], [ 25.0, 222.0 ], [ 26.0, 207.0 ], [ 27.0, 205.0 ], [ 28.0, 224.0 ], [ 29.0, 277.0 ], [ 30.0, 263.0 ], [ 31.0, 335.0 ], [ 32.0, 430.0 ], [ 33.0, 487.0 ], [ 34.0, 629.0 ], [ 35.0, 829.0 ], [ 36.0, 1107.0 ], [ 37.0, 1777.0 ], [ 38.0, 3626.0 ], [ 39.0, 70435.0 ], [ 40.0, 8374.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAFS2_R1", "pairs": [ [ 17.0, 1.0 ], [ 18.0, 5.0 ], [ 19.0, 5.0 ], [ 20.0, 9.0 ], [ 21.0, 18.0 ], [ 22.0, 44.0 ], [ 23.0, 44.0 ], [ 24.0, 86.0 ], [ 25.0, 79.0 ], [ 26.0, 101.0 ], [ 27.0, 82.0 ], [ 28.0, 88.0 ], [ 29.0, 114.0 ], [ 30.0, 110.0 ], [ 31.0, 156.0 ], [ 32.0, 163.0 ], [ 33.0, 212.0 ], [ 34.0, 259.0 ], [ 35.0, 350.0 ], [ 36.0, 504.0 ], [ 37.0, 764.0 ], [ 38.0, 1568.0 ], [ 39.0, 29648.0 ], [ 40.0, 3110.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAMS1_R1", "pairs": [ [ 16.0, 2.0 ], [ 17.0, 5.0 ], [ 18.0, 8.0 ], [ 19.0, 18.0 ], [ 20.0, 19.0 ], [ 21.0, 45.0 ], [ 22.0, 59.0 ], [ 23.0, 99.0 ], [ 24.0, 142.0 ], [ 25.0, 134.0 ], [ 26.0, 161.0 ], [ 27.0, 147.0 ], [ 28.0, 137.0 ], [ 29.0, 174.0 ], [ 30.0, 209.0 ], [ 31.0, 246.0 ], [ 32.0, 288.0 ], [ 33.0, 356.0 ], [ 34.0, 470.0 ], [ 35.0, 585.0 ], [ 36.0, 866.0 ], [ 37.0, 1342.0 ], [ 38.0, 2688.0 ], [ 39.0, 50032.0 ], [ 40.0, 5394.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAMS2_R1", "pairs": [ [ 16.0, 1.0 ], [ 17.0, 7.0 ], [ 18.0, 19.0 ], [ 19.0, 17.0 ], [ 20.0, 26.0 ], [ 21.0, 51.0 ], [ 22.0, 82.0 ], [ 23.0, 121.0 ], [ 24.0, 203.0 ], [ 25.0, 177.0 ], [ 26.0, 138.0 ], [ 27.0, 200.0 ], [ 28.0, 201.0 ], [ 29.0, 245.0 ], [ 30.0, 286.0 ], [ 31.0, 312.0 ], [ 32.0, 355.0 ], [ 33.0, 444.0 ], [ 34.0, 586.0 ], [ 35.0, 750.0 ], [ 36.0, 1066.0 ], [ 37.0, 1678.0 ], [ 38.0, 3318.0 ], [ 39.0, 63859.0 ], [ 40.0, 6677.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCFS1_R1", "pairs": [ [ 2.0, 3.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 1.0 ], [ 15.0, 22.0 ], [ 16.0, 51.0 ], [ 17.0, 61.0 ], [ 18.0, 119.0 ], [ 19.0, 202.0 ], [ 20.0, 379.0 ], [ 21.0, 436.0 ], [ 22.0, 475.0 ], [ 23.0, 446.0 ], [ 24.0, 448.0 ], [ 25.0, 500.0 ], [ 26.0, 573.0 ], [ 27.0, 656.0 ], [ 28.0, 873.0 ], [ 29.0, 1264.0 ], [ 30.0, 2082.0 ], [ 31.0, 3692.0 ], [ 32.0, 10828.0 ], [ 33.0, 96351.0 ], [ 34.0, 3274.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCFS2_R1", "pairs": [ [ 15.0, 10.0 ], [ 16.0, 20.0 ], [ 17.0, 31.0 ], [ 18.0, 64.0 ], [ 19.0, 115.0 ], [ 20.0, 183.0 ], [ 21.0, 231.0 ], [ 22.0, 236.0 ], [ 23.0, 272.0 ], [ 24.0, 283.0 ], [ 25.0, 289.0 ], [ 26.0, 371.0 ], [ 27.0, 407.0 ], [ 28.0, 586.0 ], [ 29.0, 817.0 ], [ 30.0, 1220.0 ], [ 31.0, 2204.0 ], [ 32.0, 6841.0 ], [ 33.0, 55282.0 ], [ 34.0, 1823.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCMS1_R1", "pairs": [ [ 15.0, 22.0 ], [ 16.0, 84.0 ], [ 17.0, 99.0 ], [ 18.0, 218.0 ], [ 19.0, 422.0 ], [ 20.0, 755.0 ], [ 21.0, 928.0 ], [ 22.0, 989.0 ], [ 23.0, 870.0 ], [ 24.0, 926.0 ], [ 25.0, 925.0 ], [ 26.0, 1137.0 ], [ 27.0, 1404.0 ], [ 28.0, 1874.0 ], [ 29.0, 2625.0 ], [ 30.0, 4115.0 ], [ 31.0, 7502.0 ], [ 32.0, 21762.0 ], [ 33.0, 189301.0 ], [ 34.0, 5721.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCMS2_R1", "pairs": [ [ 15.0, 10.0 ], [ 16.0, 27.0 ], [ 17.0, 37.0 ], [ 18.0, 79.0 ], [ 19.0, 148.0 ], [ 20.0, 294.0 ], [ 21.0, 331.0 ], [ 22.0, 335.0 ], [ 23.0, 338.0 ], [ 24.0, 345.0 ], [ 25.0, 417.0 ], [ 26.0, 455.0 ], [ 27.0, 566.0 ], [ 28.0, 665.0 ], [ 29.0, 1074.0 ], [ 30.0, 1609.0 ], [ 31.0, 3136.0 ], [ 32.0, 9054.0 ], [ 33.0, 72996.0 ], [ 34.0, 2285.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPFS1_R1", "pairs": [ [ 14.0, 1.0 ], [ 15.0, 17.0 ], [ 16.0, 41.0 ], [ 17.0, 70.0 ], [ 18.0, 97.0 ], [ 19.0, 213.0 ], [ 20.0, 374.0 ], [ 21.0, 485.0 ], [ 22.0, 585.0 ], [ 23.0, 470.0 ], [ 24.0, 516.0 ], [ 25.0, 529.0 ], [ 26.0, 659.0 ], [ 27.0, 794.0 ], [ 28.0, 1069.0 ], [ 29.0, 1494.0 ], [ 30.0, 2476.0 ], [ 31.0, 4214.0 ], [ 32.0, 12376.0 ], [ 33.0, 111440.0 ], [ 34.0, 4038.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPFS2_R1", "pairs": [ [ 15.0, 15.0 ], [ 16.0, 40.0 ], [ 17.0, 51.0 ], [ 18.0, 100.0 ], [ 19.0, 194.0 ], [ 20.0, 351.0 ], [ 21.0, 454.0 ], [ 22.0, 536.0 ], [ 23.0, 452.0 ], [ 24.0, 505.0 ], [ 25.0, 502.0 ], [ 26.0, 691.0 ], [ 27.0, 735.0 ], [ 28.0, 995.0 ], [ 29.0, 1497.0 ], [ 30.0, 2358.0 ], [ 31.0, 4262.0 ], [ 32.0, 12523.0 ], [ 33.0, 102578.0 ], [ 34.0, 3268.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPMS1_R1", "pairs": [ [ 16.0, 3.0 ], [ 17.0, 14.0 ], [ 18.0, 31.0 ], [ 19.0, 56.0 ], [ 20.0, 48.0 ], [ 21.0, 73.0 ], [ 22.0, 60.0 ], [ 23.0, 84.0 ], [ 24.0, 140.0 ], [ 25.0, 148.0 ], [ 26.0, 148.0 ], [ 27.0, 213.0 ], [ 28.0, 299.0 ], [ 29.0, 530.0 ], [ 30.0, 929.0 ], [ 31.0, 1807.0 ], [ 32.0, 6585.0 ], [ 33.0, 68992.0 ], [ 34.0, 1843.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPMS2_R1", "pairs": [ [ 15.0, 10.0 ], [ 16.0, 20.0 ], [ 17.0, 39.0 ], [ 18.0, 93.0 ], [ 19.0, 138.0 ], [ 20.0, 291.0 ], [ 21.0, 351.0 ], [ 22.0, 353.0 ], [ 23.0, 334.0 ], [ 24.0, 343.0 ], [ 25.0, 353.0 ], [ 26.0, 399.0 ], [ 27.0, 514.0 ], [ 28.0, 692.0 ], [ 29.0, 975.0 ], [ 30.0, 1557.0 ], [ 31.0, 2864.0 ], [ 32.0, 9171.0 ], [ 33.0, 66668.0 ], [ 34.0, 1625.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVFS1_R1", "pairs": [ [ 14.0, 1.0 ], [ 15.0, 6.0 ], [ 16.0, 30.0 ], [ 17.0, 47.0 ], [ 18.0, 57.0 ], [ 19.0, 108.0 ], [ 20.0, 215.0 ], [ 21.0, 254.0 ], [ 22.0, 272.0 ], [ 23.0, 251.0 ], [ 24.0, 250.0 ], [ 25.0, 256.0 ], [ 26.0, 327.0 ], [ 27.0, 362.0 ], [ 28.0, 497.0 ], [ 29.0, 782.0 ], [ 30.0, 1158.0 ], [ 31.0, 2166.0 ], [ 32.0, 6101.0 ], [ 33.0, 56882.0 ], [ 34.0, 1938.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVFS2_R1", "pairs": [ [ 14.0, 1.0 ], [ 15.0, 14.0 ], [ 16.0, 26.0 ], [ 17.0, 44.0 ], [ 18.0, 107.0 ], [ 19.0, 163.0 ], [ 20.0, 279.0 ], [ 21.0, 372.0 ], [ 22.0, 382.0 ], [ 23.0, 351.0 ], [ 24.0, 360.0 ], [ 25.0, 412.0 ], [ 26.0, 455.0 ], [ 27.0, 549.0 ], [ 28.0, 750.0 ], [ 29.0, 1110.0 ], [ 30.0, 1745.0 ], [ 31.0, 2987.0 ], [ 32.0, 8729.0 ], [ 33.0, 79752.0 ], [ 34.0, 2896.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVMS1_R1", "pairs": [ [ 14.0, 2.0 ], [ 15.0, 24.0 ], [ 16.0, 75.0 ], [ 17.0, 75.0 ], [ 18.0, 144.0 ], [ 19.0, 294.0 ], [ 20.0, 465.0 ], [ 21.0, 620.0 ], [ 22.0, 696.0 ], [ 23.0, 640.0 ], [ 24.0, 624.0 ], [ 25.0, 673.0 ], [ 26.0, 757.0 ], [ 27.0, 958.0 ], [ 28.0, 1351.0 ], [ 29.0, 1841.0 ], [ 30.0, 2892.0 ], [ 31.0, 5243.0 ], [ 32.0, 16036.0 ], [ 33.0, 129533.0 ], [ 34.0, 2916.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVMS2_R1", "pairs": [ [ 14.0, 1.0 ], [ 15.0, 13.0 ], [ 16.0, 36.0 ], [ 17.0, 69.0 ], [ 18.0, 145.0 ], [ 19.0, 272.0 ], [ 20.0, 452.0 ], [ 21.0, 624.0 ], [ 22.0, 636.0 ], [ 23.0, 618.0 ], [ 24.0, 617.0 ], [ 25.0, 638.0 ], [ 26.0, 753.0 ], [ 27.0, 920.0 ], [ 28.0, 1130.0 ], [ 29.0, 1770.0 ], [ 30.0, 2691.0 ], [ 31.0, 4776.0 ], [ 32.0, 14410.0 ], [ 33.0, 126480.0 ], [ 34.0, 4008.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAFS1_R1", "pairs": [ [ 16.0, 1.0 ], [ 17.0, 10.0 ], [ 18.0, 20.0 ], [ 19.0, 47.0 ], [ 20.0, 44.0 ], [ 21.0, 56.0 ], [ 22.0, 113.0 ], [ 23.0, 203.0 ], [ 24.0, 385.0 ], [ 25.0, 376.0 ], [ 26.0, 360.0 ], [ 27.0, 316.0 ], [ 28.0, 364.0 ], [ 29.0, 481.0 ], [ 30.0, 512.0 ], [ 31.0, 659.0 ], [ 32.0, 703.0 ], [ 33.0, 877.0 ], [ 34.0, 1146.0 ], [ 35.0, 1439.0 ], [ 36.0, 2085.0 ], [ 37.0, 3097.0 ], [ 38.0, 6446.0 ], [ 39.0, 126487.0 ], [ 40.0, 18255.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAFS2_R1", "pairs": [ [ 16.0, 1.0 ], [ 17.0, 8.0 ], [ 18.0, 15.0 ], [ 19.0, 32.0 ], [ 20.0, 34.0 ], [ 21.0, 41.0 ], [ 22.0, 78.0 ], [ 23.0, 155.0 ], [ 24.0, 233.0 ], [ 25.0, 264.0 ], [ 26.0, 253.0 ], [ 27.0, 263.0 ], [ 28.0, 289.0 ], [ 29.0, 319.0 ], [ 30.0, 419.0 ], [ 31.0, 443.0 ], [ 32.0, 588.0 ], [ 33.0, 676.0 ], [ 34.0, 816.0 ], [ 35.0, 1115.0 ], [ 36.0, 1565.0 ], [ 37.0, 2453.0 ], [ 38.0, 4902.0 ], [ 39.0, 102888.0 ], [ 40.0, 9935.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAMS1_R1", "pairs": [ [ 16.0, 3.0 ], [ 17.0, 8.0 ], [ 18.0, 17.0 ], [ 19.0, 40.0 ], [ 20.0, 43.0 ], [ 21.0, 68.0 ], [ 22.0, 130.0 ], [ 23.0, 201.0 ], [ 24.0, 318.0 ], [ 25.0, 337.0 ], [ 26.0, 318.0 ], [ 27.0, 327.0 ], [ 28.0, 381.0 ], [ 29.0, 433.0 ], [ 30.0, 506.0 ], [ 31.0, 543.0 ], [ 32.0, 659.0 ], [ 33.0, 805.0 ], [ 34.0, 1039.0 ], [ 35.0, 1417.0 ], [ 36.0, 1963.0 ], [ 37.0, 2999.0 ], [ 38.0, 6233.0 ], [ 39.0, 119858.0 ], [ 40.0, 13084.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAMS2_R1", "pairs": [ [ 16.0, 4.0 ], [ 17.0, 12.0 ], [ 18.0, 26.0 ], [ 19.0, 35.0 ], [ 20.0, 45.0 ], [ 21.0, 67.0 ], [ 22.0, 85.0 ], [ 23.0, 146.0 ], [ 24.0, 327.0 ], [ 25.0, 307.0 ], [ 26.0, 313.0 ], [ 27.0, 339.0 ], [ 28.0, 339.0 ], [ 29.0, 393.0 ], [ 30.0, 480.0 ], [ 31.0, 552.0 ], [ 32.0, 737.0 ], [ 33.0, 828.0 ], [ 34.0, 1093.0 ], [ 35.0, 1342.0 ], [ 36.0, 1924.0 ], [ 37.0, 2984.0 ], [ 38.0, 5991.0 ], [ 39.0, 116584.0 ], [ 40.0, 16720.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICFS1_R1", "pairs": [ [ 15.0, 23.0 ], [ 16.0, 68.0 ], [ 17.0, 74.0 ], [ 18.0, 96.0 ], [ 19.0, 233.0 ], [ 20.0, 381.0 ], [ 21.0, 450.0 ], [ 22.0, 540.0 ], [ 23.0, 490.0 ], [ 24.0, 499.0 ], [ 25.0, 567.0 ], [ 26.0, 633.0 ], [ 27.0, 789.0 ], [ 28.0, 1057.0 ], [ 29.0, 1567.0 ], [ 30.0, 2291.0 ], [ 31.0, 4283.0 ], [ 32.0, 12230.0 ], [ 33.0, 110091.0 ], [ 34.0, 3547.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICFS2_R1", "pairs": [ [ 15.0, 21.0 ], [ 16.0, 53.0 ], [ 17.0, 55.0 ], [ 18.0, 123.0 ], [ 19.0, 239.0 ], [ 20.0, 435.0 ], [ 21.0, 667.0 ], [ 22.0, 699.0 ], [ 23.0, 679.0 ], [ 24.0, 667.0 ], [ 25.0, 667.0 ], [ 26.0, 782.0 ], [ 27.0, 976.0 ], [ 28.0, 1347.0 ], [ 29.0, 1775.0 ], [ 30.0, 2966.0 ], [ 31.0, 5518.0 ], [ 32.0, 16854.0 ], [ 33.0, 135284.0 ], [ 34.0, 3009.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICMS1_R1", "pairs": [ [ 14.0, 1.0 ], [ 15.0, 24.0 ], [ 16.0, 52.0 ], [ 17.0, 84.0 ], [ 18.0, 151.0 ], [ 19.0, 243.0 ], [ 20.0, 532.0 ], [ 21.0, 765.0 ], [ 22.0, 806.0 ], [ 23.0, 733.0 ], [ 24.0, 717.0 ], [ 25.0, 751.0 ], [ 26.0, 883.0 ], [ 27.0, 1097.0 ], [ 28.0, 1537.0 ], [ 29.0, 2156.0 ], [ 30.0, 3229.0 ], [ 31.0, 5653.0 ], [ 32.0, 16267.0 ], [ 33.0, 153841.0 ], [ 34.0, 5355.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICMS2_R1", "pairs": [ [ 15.0, 6.0 ], [ 16.0, 25.0 ], [ 17.0, 48.0 ], [ 18.0, 88.0 ], [ 19.0, 110.0 ], [ 20.0, 364.0 ], [ 21.0, 469.0 ], [ 22.0, 505.0 ], [ 23.0, 441.0 ], [ 24.0, 438.0 ], [ 25.0, 458.0 ], [ 26.0, 565.0 ], [ 27.0, 681.0 ], [ 28.0, 899.0 ], [ 29.0, 1331.0 ], [ 30.0, 2115.0 ], [ 31.0, 3509.0 ], [ 32.0, 10063.0 ], [ 33.0, 99816.0 ], [ 34.0, 3734.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPFS1_R1", "pairs": [ [ 15.0, 22.0 ], [ 16.0, 68.0 ], [ 17.0, 80.0 ], [ 18.0, 129.0 ], [ 19.0, 262.0 ], [ 20.0, 456.0 ], [ 21.0, 516.0 ], [ 22.0, 581.0 ], [ 23.0, 529.0 ], [ 24.0, 577.0 ], [ 25.0, 617.0 ], [ 26.0, 717.0 ], [ 27.0, 926.0 ], [ 28.0, 1226.0 ], [ 29.0, 1678.0 ], [ 30.0, 2727.0 ], [ 31.0, 4895.0 ], [ 32.0, 14419.0 ], [ 33.0, 126289.0 ], [ 34.0, 4248.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPFS2_R1", "pairs": [ [ 15.0, 23.0 ], [ 16.0, 59.0 ], [ 17.0, 97.0 ], [ 18.0, 186.0 ], [ 19.0, 344.0 ], [ 20.0, 641.0 ], [ 21.0, 917.0 ], [ 22.0, 965.0 ], [ 23.0, 951.0 ], [ 24.0, 865.0 ], [ 25.0, 950.0 ], [ 26.0, 1037.0 ], [ 27.0, 1302.0 ], [ 28.0, 1826.0 ], [ 29.0, 2442.0 ], [ 30.0, 3906.0 ], [ 31.0, 6946.0 ], [ 32.0, 21349.0 ], [ 33.0, 176524.0 ], [ 34.0, 3098.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPMS1_R1", "pairs": [ [ 15.0, 31.0 ], [ 16.0, 92.0 ], [ 17.0, 117.0 ], [ 18.0, 245.0 ], [ 19.0, 443.0 ], [ 20.0, 841.0 ], [ 21.0, 1311.0 ], [ 22.0, 1395.0 ], [ 23.0, 1269.0 ], [ 24.0, 1176.0 ], [ 25.0, 1236.0 ], [ 26.0, 1488.0 ], [ 27.0, 1871.0 ], [ 28.0, 2540.0 ], [ 29.0, 3645.0 ], [ 30.0, 5530.0 ], [ 31.0, 9246.0 ], [ 32.0, 26072.0 ], [ 33.0, 274311.0 ], [ 34.0, 12900.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPMS2_R1", "pairs": [ [ 15.0, 23.0 ], [ 16.0, 57.0 ], [ 17.0, 108.0 ], [ 18.0, 178.0 ], [ 19.0, 412.0 ], [ 20.0, 758.0 ], [ 21.0, 1006.0 ], [ 22.0, 1057.0 ], [ 23.0, 987.0 ], [ 24.0, 917.0 ], [ 25.0, 994.0 ], [ 26.0, 1166.0 ], [ 27.0, 1355.0 ], [ 28.0, 1866.0 ], [ 29.0, 2708.0 ], [ 30.0, 4219.0 ], [ 31.0, 7146.0 ], [ 32.0, 21076.0 ], [ 33.0, 191810.0 ], [ 34.0, 6246.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVFS1_R1", "pairs": [ [ 14.0, 1.0 ], [ 15.0, 29.0 ], [ 16.0, 90.0 ], [ 17.0, 114.0 ], [ 18.0, 151.0 ], [ 19.0, 290.0 ], [ 20.0, 637.0 ], [ 21.0, 954.0 ], [ 22.0, 877.0 ], [ 23.0, 858.0 ], [ 24.0, 772.0 ], [ 25.0, 908.0 ], [ 26.0, 975.0 ], [ 27.0, 1268.0 ], [ 28.0, 1814.0 ], [ 29.0, 2499.0 ], [ 30.0, 3837.0 ], [ 31.0, 6669.0 ], [ 32.0, 19627.0 ], [ 33.0, 179452.0 ], [ 34.0, 7121.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVFS2_R1", "pairs": [ [ 15.0, 24.0 ], [ 16.0, 38.0 ], [ 17.0, 50.0 ], [ 18.0, 95.0 ], [ 19.0, 182.0 ], [ 20.0, 351.0 ], [ 21.0, 457.0 ], [ 22.0, 472.0 ], [ 23.0, 420.0 ], [ 24.0, 451.0 ], [ 25.0, 530.0 ], [ 26.0, 558.0 ], [ 27.0, 732.0 ], [ 28.0, 958.0 ], [ 29.0, 1392.0 ], [ 30.0, 2246.0 ], [ 31.0, 4143.0 ], [ 32.0, 12756.0 ], [ 33.0, 98745.0 ], [ 34.0, 2820.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVMS1_R1", "pairs": [ [ 15.0, 20.0 ], [ 16.0, 52.0 ], [ 17.0, 73.0 ], [ 18.0, 138.0 ], [ 19.0, 254.0 ], [ 20.0, 540.0 ], [ 21.0, 744.0 ], [ 22.0, 700.0 ], [ 23.0, 651.0 ], [ 24.0, 667.0 ], [ 25.0, 700.0 ], [ 26.0, 805.0 ], [ 27.0, 919.0 ], [ 28.0, 1217.0 ], [ 29.0, 1784.0 ], [ 30.0, 2673.0 ], [ 31.0, 4770.0 ], [ 32.0, 14261.0 ], [ 33.0, 121625.0 ], [ 34.0, 3526.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVMS2_R1", "pairs": [ [ 14.0, 1.0 ], [ 15.0, 14.0 ], [ 16.0, 30.0 ], [ 17.0, 46.0 ], [ 18.0, 92.0 ], [ 19.0, 170.0 ], [ 20.0, 316.0 ], [ 21.0, 472.0 ], [ 22.0, 414.0 ], [ 23.0, 409.0 ], [ 24.0, 411.0 ], [ 25.0, 399.0 ], [ 26.0, 534.0 ], [ 27.0, 669.0 ], [ 28.0, 824.0 ], [ 29.0, 1204.0 ], [ 30.0, 1878.0 ], [ 31.0, 3199.0 ], [ 32.0, 10038.0 ], [ 33.0, 85652.0 ], [ 34.0, 2965.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAFS1_R1", "pairs": [ [ 16.0, 5.0 ], [ 17.0, 8.0 ], [ 18.0, 19.0 ], [ 19.0, 26.0 ], [ 20.0, 51.0 ], [ 21.0, 62.0 ], [ 22.0, 108.0 ], [ 23.0, 199.0 ], [ 24.0, 294.0 ], [ 25.0, 305.0 ], [ 26.0, 300.0 ], [ 27.0, 288.0 ], [ 28.0, 336.0 ], [ 29.0, 375.0 ], [ 30.0, 419.0 ], [ 31.0, 451.0 ], [ 32.0, 630.0 ], [ 33.0, 741.0 ], [ 34.0, 954.0 ], [ 35.0, 1255.0 ], [ 36.0, 1716.0 ], [ 37.0, 2681.0 ], [ 38.0, 5835.0 ], [ 39.0, 105794.0 ], [ 40.0, 9518.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAFS2_R1", "pairs": [ [ 16.0, 5.0 ], [ 17.0, 15.0 ], [ 18.0, 10.0 ], [ 19.0, 18.0 ], [ 20.0, 21.0 ], [ 21.0, 29.0 ], [ 22.0, 55.0 ], [ 23.0, 98.0 ], [ 24.0, 156.0 ], [ 25.0, 161.0 ], [ 26.0, 167.0 ], [ 27.0, 192.0 ], [ 28.0, 174.0 ], [ 29.0, 232.0 ], [ 30.0, 261.0 ], [ 31.0, 270.0 ], [ 32.0, 407.0 ], [ 33.0, 448.0 ], [ 34.0, 603.0 ], [ 35.0, 732.0 ], [ 36.0, 1017.0 ], [ 37.0, 1581.0 ], [ 38.0, 3348.0 ], [ 39.0, 66733.0 ], [ 40.0, 7416.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAMS1_R1", "pairs": [ [ 16.0, 2.0 ], [ 17.0, 12.0 ], [ 18.0, 38.0 ], [ 19.0, 37.0 ], [ 20.0, 51.0 ], [ 21.0, 100.0 ], [ 22.0, 164.0 ], [ 23.0, 265.0 ], [ 24.0, 398.0 ], [ 25.0, 322.0 ], [ 26.0, 305.0 ], [ 27.0, 370.0 ], [ 28.0, 426.0 ], [ 29.0, 473.0 ], [ 30.0, 529.0 ], [ 31.0, 579.0 ], [ 32.0, 726.0 ], [ 33.0, 845.0 ], [ 34.0, 1113.0 ], [ 35.0, 1519.0 ], [ 36.0, 2163.0 ], [ 37.0, 3216.0 ], [ 38.0, 6669.0 ], [ 39.0, 129159.0 ], [ 40.0, 13962.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAMS2_R1", "pairs": [ [ 17.0, 6.0 ], [ 18.0, 20.0 ], [ 19.0, 51.0 ], [ 20.0, 58.0 ], [ 21.0, 92.0 ], [ 22.0, 125.0 ], [ 23.0, 249.0 ], [ 24.0, 398.0 ], [ 25.0, 334.0 ], [ 26.0, 374.0 ], [ 27.0, 312.0 ], [ 28.0, 373.0 ], [ 29.0, 402.0 ], [ 30.0, 456.0 ], [ 31.0, 578.0 ], [ 32.0, 665.0 ], [ 33.0, 763.0 ], [ 34.0, 1091.0 ], [ 35.0, 1358.0 ], [ 36.0, 2008.0 ], [ 37.0, 2952.0 ], [ 38.0, 5858.0 ], [ 39.0, 116672.0 ], [ 40.0, 12550.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCFS1_R1", "pairs": [ [ 15.0, 25.0 ], [ 16.0, 68.0 ], [ 17.0, 72.0 ], [ 18.0, 143.0 ], [ 19.0, 260.0 ], [ 20.0, 448.0 ], [ 21.0, 581.0 ], [ 22.0, 647.0 ], [ 23.0, 595.0 ], [ 24.0, 619.0 ], [ 25.0, 713.0 ], [ 26.0, 813.0 ], [ 27.0, 980.0 ], [ 28.0, 1351.0 ], [ 29.0, 1984.0 ], [ 30.0, 3042.0 ], [ 31.0, 5644.0 ], [ 32.0, 16631.0 ], [ 33.0, 148153.0 ], [ 34.0, 5475.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCFS2_R1", "pairs": [ [ 15.0, 14.0 ], [ 16.0, 38.0 ], [ 17.0, 64.0 ], [ 18.0, 131.0 ], [ 19.0, 215.0 ], [ 20.0, 381.0 ], [ 21.0, 551.0 ], [ 22.0, 583.0 ], [ 23.0, 551.0 ], [ 24.0, 524.0 ], [ 25.0, 601.0 ], [ 26.0, 717.0 ], [ 27.0, 788.0 ], [ 28.0, 1139.0 ], [ 29.0, 1640.0 ], [ 30.0, 2593.0 ], [ 31.0, 4648.0 ], [ 32.0, 13725.0 ], [ 33.0, 119193.0 ], [ 34.0, 4108.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCMS1_R1", "pairs": [ [ 14.0, 1.0 ], [ 15.0, 17.0 ], [ 16.0, 36.0 ], [ 17.0, 63.0 ], [ 18.0, 103.0 ], [ 19.0, 242.0 ], [ 20.0, 422.0 ], [ 21.0, 539.0 ], [ 22.0, 554.0 ], [ 23.0, 565.0 ], [ 24.0, 513.0 ], [ 25.0, 572.0 ], [ 26.0, 735.0 ], [ 27.0, 913.0 ], [ 28.0, 1162.0 ], [ 29.0, 1729.0 ], [ 30.0, 2675.0 ], [ 31.0, 4942.0 ], [ 32.0, 14690.0 ], [ 33.0, 126725.0 ], [ 34.0, 4189.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCMS2_R1", "pairs": [ [ 15.0, 9.0 ], [ 16.0, 45.0 ], [ 17.0, 45.0 ], [ 18.0, 108.0 ], [ 19.0, 187.0 ], [ 20.0, 352.0 ], [ 21.0, 485.0 ], [ 22.0, 486.0 ], [ 23.0, 444.0 ], [ 24.0, 445.0 ], [ 25.0, 477.0 ], [ 26.0, 543.0 ], [ 27.0, 722.0 ], [ 28.0, 948.0 ], [ 29.0, 1384.0 ], [ 30.0, 2259.0 ], [ 31.0, 3979.0 ], [ 32.0, 12022.0 ], [ 33.0, 99476.0 ], [ 34.0, 3036.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPFS1_R1", "pairs": [ [ 15.0, 41.0 ], [ 16.0, 71.0 ], [ 17.0, 107.0 ], [ 18.0, 176.0 ], [ 19.0, 335.0 ], [ 20.0, 610.0 ], [ 21.0, 783.0 ], [ 22.0, 766.0 ], [ 23.0, 773.0 ], [ 24.0, 827.0 ], [ 25.0, 870.0 ], [ 26.0, 1073.0 ], [ 27.0, 1315.0 ], [ 28.0, 1678.0 ], [ 29.0, 2501.0 ], [ 30.0, 3897.0 ], [ 31.0, 7038.0 ], [ 32.0, 20890.0 ], [ 33.0, 183272.0 ], [ 34.0, 6600.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPFS2_R1", "pairs": [ [ 14.0, 1.0 ], [ 15.0, 25.0 ], [ 16.0, 49.0 ], [ 17.0, 81.0 ], [ 18.0, 150.0 ], [ 19.0, 286.0 ], [ 20.0, 563.0 ], [ 21.0, 674.0 ], [ 22.0, 701.0 ], [ 23.0, 690.0 ], [ 24.0, 736.0 ], [ 25.0, 774.0 ], [ 26.0, 922.0 ], [ 27.0, 1151.0 ], [ 28.0, 1462.0 ], [ 29.0, 2150.0 ], [ 30.0, 3319.0 ], [ 31.0, 6246.0 ], [ 32.0, 18819.0 ], [ 33.0, 157532.0 ], [ 34.0, 5441.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPMS1_R1", "pairs": [ [ 14.0, 1.0 ], [ 15.0, 28.0 ], [ 16.0, 53.0 ], [ 17.0, 70.0 ], [ 18.0, 181.0 ], [ 19.0, 341.0 ], [ 20.0, 596.0 ], [ 21.0, 808.0 ], [ 22.0, 810.0 ], [ 23.0, 768.0 ], [ 24.0, 766.0 ], [ 25.0, 856.0 ], [ 26.0, 995.0 ], [ 27.0, 1157.0 ], [ 28.0, 1535.0 ], [ 29.0, 2256.0 ], [ 30.0, 3472.0 ], [ 31.0, 6389.0 ], [ 32.0, 18508.0 ], [ 33.0, 165563.0 ], [ 34.0, 6150.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPMS2_R1", "pairs": [ [ 15.0, 9.0 ], [ 16.0, 32.0 ], [ 17.0, 42.0 ], [ 18.0, 124.0 ], [ 19.0, 195.0 ], [ 20.0, 386.0 ], [ 21.0, 490.0 ], [ 22.0, 502.0 ], [ 23.0, 499.0 ], [ 24.0, 472.0 ], [ 25.0, 571.0 ], [ 26.0, 586.0 ], [ 27.0, 755.0 ], [ 28.0, 991.0 ], [ 29.0, 1354.0 ], [ 30.0, 2371.0 ], [ 31.0, 4244.0 ], [ 32.0, 12683.0 ], [ 33.0, 104503.0 ], [ 34.0, 3382.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVFS1_R1", "pairs": [ [ 15.0, 16.0 ], [ 16.0, 45.0 ], [ 17.0, 50.0 ], [ 18.0, 102.0 ], [ 19.0, 188.0 ], [ 20.0, 311.0 ], [ 21.0, 387.0 ], [ 22.0, 397.0 ], [ 23.0, 351.0 ], [ 24.0, 390.0 ], [ 25.0, 430.0 ], [ 26.0, 498.0 ], [ 27.0, 619.0 ], [ 28.0, 804.0 ], [ 29.0, 1223.0 ], [ 30.0, 1860.0 ], [ 31.0, 3274.0 ], [ 32.0, 9566.0 ], [ 33.0, 86024.0 ], [ 34.0, 3260.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVFS2_R1", "pairs": [ [ 15.0, 15.0 ], [ 16.0, 49.0 ], [ 17.0, 62.0 ], [ 18.0, 84.0 ], [ 19.0, 208.0 ], [ 20.0, 401.0 ], [ 21.0, 557.0 ], [ 22.0, 594.0 ], [ 23.0, 566.0 ], [ 24.0, 544.0 ], [ 25.0, 556.0 ], [ 26.0, 663.0 ], [ 27.0, 802.0 ], [ 28.0, 1080.0 ], [ 29.0, 1672.0 ], [ 30.0, 2468.0 ], [ 31.0, 4374.0 ], [ 32.0, 12776.0 ], [ 33.0, 117728.0 ], [ 34.0, 4856.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVMS1_R1", "pairs": [ [ 15.0, 38.0 ], [ 16.0, 83.0 ], [ 17.0, 129.0 ], [ 18.0, 303.0 ], [ 19.0, 531.0 ], [ 20.0, 981.0 ], [ 21.0, 1251.0 ], [ 22.0, 1254.0 ], [ 23.0, 1253.0 ], [ 24.0, 1236.0 ], [ 25.0, 1348.0 ], [ 26.0, 1587.0 ], [ 27.0, 1955.0 ], [ 28.0, 2549.0 ], [ 29.0, 3591.0 ], [ 30.0, 5797.0 ], [ 31.0, 10584.0 ], [ 32.0, 31899.0 ], [ 33.0, 271805.0 ], [ 34.0, 9137.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVMS2_R1", "pairs": [ [ 14.0, 1.0 ], [ 15.0, 12.0 ], [ 16.0, 40.0 ], [ 17.0, 57.0 ], [ 18.0, 106.0 ], [ 19.0, 216.0 ], [ 20.0, 363.0 ], [ 21.0, 453.0 ], [ 22.0, 436.0 ], [ 23.0, 420.0 ], [ 24.0, 402.0 ], [ 25.0, 481.0 ], [ 26.0, 536.0 ], [ 27.0, 715.0 ], [ 28.0, 951.0 ], [ 29.0, 1251.0 ], [ 30.0, 2080.0 ], [ 31.0, 3706.0 ], [ 32.0, 11628.0 ], [ 33.0, 90954.0 ], [ 34.0, 2516.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null } ] } ], "pconfig": { "id": "fastqc_per_sequence_quality_scores_plot", "title": "FastQC: Per Sequence Quality Scores", "anchor": null, "table_title": null, "height": null, "width": null, "square": false, "logswitch": false, "logswitch_active": false, "logswitch_label": "Log10", "cpswitch": true, "cpswitch_c_active": true, "cpswitch_counts_label": "Counts", "cpswitch_percent_label": "Percentages", "xLog": null, "yLog": null, "xlog": false, "ylog": false, "data_labels": [], "xTitle": null, "yTitle": null, "xlab": "Mean Sequence Quality (Phred Score)", "ylab": "Count", "xsuffix": null, "ysuffix": null, "tt_suffix": null, "xLabFormat": null, "yLabFormat": null, "xLabelFormat": null, "yLabelFormat": null, "xlab_format": null, "ylab_format": null, "tt_label": "Phred {point.x}: {point.y} reads", "xDecimals": null, "yDecimals": null, "decimalPlaces": null, "x_decimals": 0, "y_decimals": null, "tt_decimals": null, "xmin": 0, "xmax": null, "ymin": 0, "ymax": null, "xFloor": null, "xCeiling": null, "yFloor": null, "yCeiling": null, "x_clipmin": null, "x_clipmax": null, "y_clipmin": null, "y_clipmax": null, "save_data_file": true, "showlegend": false, "xMinRange": null, "yMinRange": null, "x_minrange": null, "y_minrange": null, "xPlotBands": null, "yPlotBands": null, "xPlotLines": null, "yPlotLines": null, "x_bands": [ { "from_": 28, "to": 100, "color": "#c3e6c3" }, { "from_": 20, "to": 28, "color": "#e6dcc3" }, { "from_": 0, "to": 20, "color": "#e6c3c3" } ], "y_bands": null, "x_lines": null, "y_lines": null, "categories": false, "smooth_points": 500, "smooth_points_sumcounts": null, "extra_series": null, "style": null, "hide_zero_cats": false, "hide_empty": false, "colors": { "CAFS1_R1": "#5cb85c", "CAFS2_R1": "#5cb85c", "CAMS1_R1": "#5cb85c", "CAMS2_R1": "#5cb85c", "CCFS1_R1": "#5cb85c", "CCFS2_R1": "#5cb85c", "CCMS1_R1": "#5cb85c", "CCMS2_R1": "#5cb85c", "CPFS1_R1": "#5cb85c", "CPFS2_R1": "#5cb85c", "CPMS1_R1": "#5cb85c", "CPMS2_R1": "#5cb85c", "CVFS1_R1": "#5cb85c", "CVFS2_R1": "#5cb85c", "CVMS1_R1": "#5cb85c", "CVMS2_R1": "#5cb85c", "DAFS1_R1": "#5cb85c", "DAFS2_R1": "#5cb85c", "DAMS1_R1": "#5cb85c", "DAMS2_R1": "#5cb85c", "DCFS1_R1": "#5cb85c", "DCFS2_R1": "#5cb85c", "DCMS1_R1": "#5cb85c", "DCMS2_R1": "#5cb85c", "DPFS1_R1": "#5cb85c", "DPFS2_R1": "#5cb85c", "DPMS1_R1": "#5cb85c", "DPMS2_R1": "#5cb85c", "DVFS1_R1": "#5cb85c", "DVFS2_R1": "#5cb85c", "DVMS1_R1": "#5cb85c", "DVMS2_R1": "#5cb85c", "IAFS1_R1": "#5cb85c", "IAFS2_R1": "#5cb85c", "IAMS1_R1": "#5cb85c", "IAMS2_R1": "#5cb85c", "ICFS1_R1": "#5cb85c", "ICFS2_R1": "#5cb85c", "ICMS1_R1": "#5cb85c", "ICMS2_R1": "#5cb85c", "IPFS1_R1": "#5cb85c", "IPFS2_R1": "#5cb85c", "IPMS1_R1": "#5cb85c", "IPMS2_R1": "#5cb85c", "IVFS1_R1": "#5cb85c", "IVFS2_R1": "#5cb85c", "IVMS1_R1": "#5cb85c", "IVMS2_R1": "#5cb85c", "JAFS1_R1": "#5cb85c", "JAFS2_R1": "#5cb85c", "JAMS1_R1": "#5cb85c", "JAMS2_R1": "#5cb85c", "JCFS1_R1": "#5cb85c", "JCFS2_R1": "#5cb85c", "JCMS1_R1": "#5cb85c", "JCMS2_R1": "#5cb85c", "JPFS1_R1": "#5cb85c", "JPFS2_R1": "#5cb85c", "JPMS1_R1": "#5cb85c", "JPMS2_R1": "#5cb85c", "JVFS1_R1": "#5cb85c", "JVFS2_R1": "#5cb85c", "JVMS1_R1": "#5cb85c", "JVMS2_R1": "#5cb85c" } }, "add_log_tab": false, "add_pct_tab": false, "l_active": false, "p_active": false, "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "yaxis" ], "square": false, "flat": false, "defer_render": false }, "fastqc_per_sequence_gc_content_plot": { "id": "fastqc_per_sequence_gc_content_plot", "anchor": "fastqc_per_sequence_gc_content_plot", "plot_type": "xy_line", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 500, "hoverlabel": { "namelength": -1 }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "white", "plot_bgcolor": "white", "showlegend": false, "title": { "font": { "size": 20 }, "text": "FastQC: Per Sequence GC Content", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "hoverdistance": -1 }, "datasets": [ { "plot_id": "fastqc_per_sequence_gc_content_plot", "label": "Percentages", "uid": "fastqc_per_sequence_gc_content_plot_Percentages", "dconfig": { "name": "Percentages", "ylab": "Percentage", "tt_suffix": "%", "title": "FastQC: Per Sequence GC Content
Percentages, 64 samples" }, "layout": { "title": { "text": "FastQC: Per Sequence GC Content
Percentages, 64 samples" }, "xaxis": { "hoverformat": null, "ticksuffix": "%", "title": { "text": "% GC" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": 100 } }, "yaxis": { "hoverformat": null, "ticksuffix": "%", "title": { "text": "Percentage" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": null } } }, "trace_params": { "hovertemplate": "%{text}
%{x} GC: %{y}", "mode": "lines", "line": { "width": 2 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "n_samples": 64, "lines": [ { "name": "CAFS1_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0004563695498066513 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.0 ], [ 46.0, 0.0033467100319154426 ], [ 47.0, 0.038182919000489826 ], [ 48.0, 0.19213158046860018 ], [ 49.0, 1.3697171421530294 ], [ 50.0, 3.3491440028477446 ], [ 51.0, 4.1030664991283325 ], [ 52.0, 4.7255545650646065 ], [ 53.0, 11.75303713935396 ], [ 54.0, 27.054956021187714 ], [ 55.0, 28.519293783334014 ], [ 56.0, 13.2795932834572 ], [ 57.0, 4.043129964920393 ], [ 58.0, 1.3511581137942255 ], [ 59.0, 0.1414745604400619 ], [ 60.0, 0.014603825593812842 ], [ 61.0, 0.009127390996133026 ], [ 62.0, 0.005020065047873164 ], [ 63.0, 0.007758282346713071 ], [ 64.0, 0.036509563984532103 ], [ 65.0, 0.0027382172988399075 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAFS2_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.000493236089098167 ], [ 41.0, 0.000493236089098167 ], [ 42.0, 0.0 ], [ 43.0, 0.000986472178196334 ], [ 44.0, 0.000493236089098167 ], [ 45.0, 0.0 ], [ 46.0, 0.005425596980079836 ], [ 47.0, 0.032060345791380854 ], [ 48.0, 0.22639536489605863 ], [ 49.0, 1.64412029699389 ], [ 50.0, 3.7798325627889526 ], [ 51.0, 4.608962428562971 ], [ 52.0, 4.947980033803113 ], [ 53.0, 11.936313356175638 ], [ 54.0, 26.95469462109604 ], [ 55.0, 28.446404966558603 ], [ 56.0, 12.54184286155848 ], [ 57.0, 3.4783009003202725 ], [ 58.0, 1.1952754559145577 ], [ 59.0, 0.12791255910612462 ], [ 60.0, 0.015783554851141343 ], [ 61.0, 0.00986472178196334 ], [ 62.0, 0.008385013514668837 ], [ 63.0, 0.003945888712785336 ], [ 64.0, 0.030580637524086348 ], [ 65.0, 0.001972944356392668 ], [ 66.0, 0.0 ], [ 67.0, 0.000493236089098167 ], [ 68.0, 0.000493236089098167 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.000493236089098167 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAMS1_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0005109479105636777 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.0 ], [ 46.0, 0.0005109479105636777 ], [ 47.0, 0.08992683225920729 ], [ 48.0, 0.5618723856498576 ], [ 49.0, 2.997050127396346 ], [ 50.0, 4.238823866036269 ], [ 51.0, 4.415100895180739 ], [ 52.0, 6.047579469431692 ], [ 53.0, 11.174941751938194 ], [ 54.0, 24.74350414889704 ], [ 55.0, 26.506444756311925 ], [ 56.0, 15.927438584061147 ], [ 57.0, 2.4063943427847345 ], [ 58.0, 0.6931859986647229 ], [ 59.0, 0.09793168285803823 ], [ 60.0, 0.01192211791315248 ], [ 61.0, 0.004087583284509422 ], [ 62.0, 0.021970760154238145 ], [ 63.0, 0.009708010300709878 ], [ 64.0, 0.04394152030847629 ], [ 65.0, 0.006131374926764133 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0005109479105636777 ], [ 74.0, 0.0005109479105636777 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAMS2_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0004478480899278962 ], [ 44.0, 0.0 ], [ 45.0, 0.0 ], [ 46.0, 0.001791392359711585 ], [ 47.0, 0.08091122158030659 ], [ 48.0, 0.5090539955513754 ], [ 49.0, 2.937734187230356 ], [ 50.0, 3.998387746876257 ], [ 51.0, 4.32860107184976 ], [ 52.0, 5.947124068849178 ], [ 53.0, 10.387239315090977 ], [ 54.0, 25.13532476450655 ], [ 55.0, 28.190096585904733 ], [ 56.0, 15.450609819815769 ], [ 57.0, 2.2110260199740233 ], [ 58.0, 0.66699508859928 ], [ 59.0, 0.07583560989445712 ], [ 60.0, 0.013584725394479517 ], [ 61.0, 0.004627763595921594 ], [ 62.0, 0.008210548315344766 ], [ 63.0, 0.008956961798557926 ], [ 64.0, 0.03761923955394328 ], [ 65.0, 0.005822025169062651 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCFS1_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0003457041648133082 ], [ 25.0, 0.002074224988879849 ], [ 26.0, 0.0003457041648133082 ], [ 27.0, 0.0013828166592532328 ], [ 28.0, 0.0024199291536931575 ], [ 29.0, 0.002535163875297593 ], [ 30.0, 0.004724623585781879 ], [ 31.0, 0.002880868040110901 ], [ 32.0, 0.004148449977759698 ], [ 33.0, 0.0029961027617153376 ], [ 34.0, 0.0027656333185064655 ], [ 35.0, 0.0038027458129463905 ], [ 36.0, 0.0017285208240665412 ], [ 37.0, 0.002074224988879849 ], [ 38.0, 0.004839858307386315 ], [ 39.0, 0.0047246235857818794 ], [ 40.0, 0.0072597874610794725 ], [ 41.0, 0.008988308285146013 ], [ 42.0, 0.012099645768465788 ], [ 43.0, 0.015902391581412177 ], [ 44.0, 0.017746147127083157 ], [ 45.0, 0.025812577639393677 ], [ 46.0, 0.4312083282437998 ], [ 47.0, 0.41922391719693847 ], [ 48.0, 3.662389922032188 ], [ 49.0, 4.502451042528528 ], [ 50.0, 4.501529164755693 ], [ 51.0, 6.7692332512093865 ], [ 52.0, 8.742166919798928 ], [ 53.0, 12.727214062323537 ], [ 54.0, 24.098576390249313 ], [ 55.0, 21.62702208127737 ], [ 56.0, 8.518265855721515 ], [ 57.0, 2.211469542310732 ], [ 58.0, 0.8080258678903057 ], [ 59.0, 0.45483144617270926 ], [ 60.0, 0.32254198577081655 ], [ 61.0, 0.02085748461040293 ], [ 62.0, 0.008988308285146013 ], [ 63.0, 0.007605491625892779 ], [ 64.0, 0.02051178044558962 ], [ 65.0, 0.011177767995630297 ], [ 66.0, 0.0 ], [ 67.0, 0.0010371124944399245 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0006914083296266164 ], [ 76.0, 0.0006914083296266164 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0003457041648133082 ], [ 88.0, 0.0003457041648133082 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCFS2_R1", "pairs": [ [ 0.0, 0.0007393797343408612 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0007393797343408612 ], [ 24.0, 0.0007393797343408612 ], [ 25.0, 0.0014787594686817224 ], [ 26.0, 0.0018484493358521528 ], [ 27.0, 0.002957518937363445 ], [ 28.0, 0.0018484493358521528 ], [ 29.0, 0.0014787594686817224 ], [ 30.0, 0.0007393797343408612 ], [ 31.0, 0.0003696898671704306 ], [ 32.0, 0.0011090696015112918 ], [ 33.0, 0.0011090696015112918 ], [ 34.0, 0.0014787594686817224 ], [ 35.0, 0.002957518937363445 ], [ 36.0, 0.0014787594686817224 ], [ 37.0, 0.0011090696015112918 ], [ 38.0, 0.003327208804533875 ], [ 39.0, 0.0049291982289390735 ], [ 40.0, 0.002587829070193014 ], [ 41.0, 0.008133177077749472 ], [ 42.0, 0.012199765616624208 ], [ 43.0, 0.009242246679260763 ], [ 44.0, 0.01293914535096507 ], [ 45.0, 0.026124750613377094 ], [ 46.0, 0.48823708457641535 ], [ 47.0, 0.4331532943680212 ], [ 48.0, 2.9416222730751147 ], [ 49.0, 3.9351021761177862 ], [ 50.0, 4.224939031979407 ], [ 51.0, 7.342533681827643 ], [ 52.0, 9.57299588042256 ], [ 53.0, 12.59397824498358 ], [ 54.0, 24.20359560364818 ], [ 55.0, 21.636592395972382 ], [ 56.0, 8.770892098618463 ], [ 57.0, 2.182279285907051 ], [ 58.0, 0.7682155439801547 ], [ 59.0, 0.44744796923194446 ], [ 60.0, 0.28527734749984895 ], [ 61.0, 0.02600152065765362 ], [ 62.0, 0.009735166502154672 ], [ 63.0, 0.004805968273215598 ], [ 64.0, 0.017128963845563287 ], [ 65.0, 0.0101048563693251 ], [ 66.0, 0.0007393797343408612 ], [ 67.0, 0.0007393797343408612 ], [ 68.0, 0.0003696898671704306 ], [ 69.0, 0.0003696898671704306 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0003696898671704306 ], [ 75.0, 0.0003696898671704306 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0003696898671704306 ], [ 82.0, 0.0003696898671704306 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCMS1_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0003577343965199596 ], [ 9.0, 0.0003577343965199596 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0003577343965199596 ], [ 24.0, 0.0003577343965199596 ], [ 25.0, 0.0007154687930399192 ], [ 26.0, 0.0007154687930399192 ], [ 27.0, 0.0010732031895598789 ], [ 28.0, 0.0010732031895598789 ], [ 29.0, 0.0021464063791197577 ], [ 30.0, 0.0017886719825997983 ], [ 31.0, 0.0017886719825997983 ], [ 32.0, 0.0014309375860798385 ], [ 33.0, 0.0017886719825997983 ], [ 34.0, 0.0021464063791197577 ], [ 35.0, 0.0014309375860798385 ], [ 36.0, 0.0025041407756397176 ], [ 37.0, 0.0035773439651995967 ], [ 38.0, 0.003696588764039583 ], [ 39.0, 0.004173567959399529 ], [ 40.0, 0.01001656310255887 ], [ 41.0, 0.012282214280518613 ], [ 42.0, 0.012162969481678628 ], [ 43.0, 0.01693276143527809 ], [ 44.0, 0.021941042986557524 ], [ 45.0, 0.034104012468236154 ], [ 46.0, 0.8099106737211887 ], [ 47.0, 0.7300166584983977 ], [ 48.0, 3.4294804146380136 ], [ 49.0, 3.7281886357321805 ], [ 50.0, 2.402663451826888 ], [ 51.0, 4.89249485160581 ], [ 52.0, 8.817914384619321 ], [ 53.0, 18.975424839407072 ], [ 54.0, 24.033908450998158 ], [ 55.0, 17.193430565542307 ], [ 56.0, 10.710806321405263 ], [ 57.0, 2.7036373240990135 ], [ 58.0, 0.7804572084077118 ], [ 59.0, 0.3137330657480046 ], [ 60.0, 0.2691355109818496 ], [ 61.0, 0.027545548532036893 ], [ 62.0, 0.0079894015222791 ], [ 63.0, 0.00787015672343911 ], [ 64.0, 0.017767475027157996 ], [ 65.0, 0.00763166712575914 ], [ 66.0, 0.0003577343965199596 ], [ 67.0, 0.0 ], [ 68.0, 0.0003577343965199596 ], [ 69.0, 0.0003577343965199596 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCMS2_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.00038231122427523324 ], [ 27.0, 0.0011469336728256998 ], [ 28.0, 0.001529244897100933 ], [ 29.0, 0.0007646224485504665 ], [ 30.0, 0.0011469336728256998 ], [ 31.0, 0.001529244897100933 ], [ 32.0, 0.0019115561213761663 ], [ 33.0, 0.0019115561213761663 ], [ 34.0, 0.001529244897100933 ], [ 35.0, 0.001529244897100933 ], [ 36.0, 0.003058489794201866 ], [ 37.0, 0.003440801018477099 ], [ 38.0, 0.003058489794201866 ], [ 39.0, 0.004842608840819621 ], [ 40.0, 0.004587734691302799 ], [ 41.0, 0.006116979588403732 ], [ 42.0, 0.00955778060688083 ], [ 43.0, 0.012998581625357929 ], [ 44.0, 0.016821693868110263 ], [ 45.0, 0.03644700338090557 ], [ 46.0, 0.6589771135757436 ], [ 47.0, 0.5483617326854427 ], [ 48.0, 3.3763178586493434 ], [ 49.0, 3.575374569421981 ], [ 50.0, 2.261880639887038 ], [ 51.0, 4.908238934320205 ], [ 52.0, 8.882109236511731 ], [ 53.0, 18.776196283680036 ], [ 54.0, 24.852523445235853 ], [ 55.0, 17.647231238395246 ], [ 56.0, 10.542741757688585 ], [ 57.0, 2.4880814475832165 ], [ 58.0, 0.7295772529919031 ], [ 59.0, 0.31425982635424177 ], [ 60.0, 0.24671817673228386 ], [ 61.0, 0.025614852026440624 ], [ 62.0, 0.014527826522458865 ], [ 63.0, 0.010704714279706531 ], [ 64.0, 0.014910137746734097 ], [ 65.0, 0.008793158158330365 ], [ 66.0, 0.001656681971859344 ], [ 67.0, 0.0008920595233088775 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPFS1_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0004887776648158286 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0004887776648158286 ], [ 24.0, 0.0014663329944474856 ], [ 25.0, 0.0014663329944474856 ], [ 26.0, 0.002443888324079143 ], [ 27.0, 0.003910221318526629 ], [ 28.0, 0.002443888324079143 ], [ 29.0, 0.002932665988894971 ], [ 30.0, 0.005376554312974114 ], [ 31.0, 0.005865331977789942 ], [ 32.0, 0.005865331977789942 ], [ 33.0, 0.005702406089518 ], [ 34.0, 0.004236073095070514 ], [ 35.0, 0.0011404812179035997 ], [ 36.0, 0.002932665988894971 ], [ 37.0, 0.004398998983342457 ], [ 38.0, 0.002443888324079143 ], [ 39.0, 0.0079833685253252 ], [ 40.0, 0.006842887307421599 ], [ 41.0, 0.006842887307421599 ], [ 42.0, 0.006028257866061885 ], [ 43.0, 0.0148262558327468 ], [ 44.0, 0.02346132791115977 ], [ 45.0, 0.042197805062433195 ], [ 46.0, 0.04659680404577565 ], [ 47.0, 0.05425432079455696 ], [ 48.0, 0.056535283230364164 ], [ 49.0, 0.16520685070775007 ], [ 50.0, 4.5619248716144005 ], [ 51.0, 4.058646802742361 ], [ 52.0, 4.305968301139172 ], [ 53.0, 11.679505226662485 ], [ 54.0, 30.673894059070538 ], [ 55.0, 40.0207893433434 ], [ 56.0, 3.748435911472576 ], [ 57.0, 0.23542790855295737 ], [ 58.0, 0.09042386799092829 ], [ 59.0, 0.04708558171059148 ], [ 60.0, 0.036984176637731035 ], [ 61.0, 0.026231068011782797 ], [ 62.0, 0.011404812179036002 ], [ 63.0, 0.007820442637053258 ], [ 64.0, 0.005376554312974114 ], [ 65.0, 0.003095591877166914 ], [ 66.0, 0.0009775553296316572 ], [ 67.0, 0.0004887776648158286 ], [ 68.0, 0.0004887776648158286 ], [ 69.0, 0.0006517035530877713 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPFS2_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0004168762627876788 ], [ 22.0, 0.0004168762627876788 ], [ 23.0, 0.0004168762627876788 ], [ 24.0, 0.0 ], [ 25.0, 0.0004168762627876788 ], [ 26.0, 0.0008337525255753576 ], [ 27.0, 0.002501257576726073 ], [ 28.0, 0.0004168762627876788 ], [ 29.0, 0.0029181338395137518 ], [ 30.0, 0.0030570925937763115 ], [ 31.0, 0.004168762627876788 ], [ 32.0, 0.004168762627876788 ], [ 33.0, 0.005002515153452146 ], [ 34.0, 0.004168762627876788 ], [ 35.0, 0.004585638890664467 ], [ 36.0, 0.0029181338395137518 ], [ 37.0, 0.0016675050511507153 ], [ 38.0, 0.0029181338395137518 ], [ 39.0, 0.005975226433290063 ], [ 40.0, 0.007225855221653099 ], [ 41.0, 0.015841297985931795 ], [ 42.0, 0.015841297985931795 ], [ 43.0, 0.01792567929987019 ], [ 44.0, 0.019176308088233226 ], [ 45.0, 0.029181338395137518 ], [ 46.0, 0.04502263638106931 ], [ 47.0, 0.0780948198955585 ], [ 48.0, 1.3918108826937972 ], [ 49.0, 2.5475308418955045 ], [ 50.0, 2.927166158540818 ], [ 51.0, 4.113040167417501 ], [ 52.0, 8.9130924159091 ], [ 53.0, 20.108443411826507 ], [ 54.0, 25.627468254872625 ], [ 55.0, 20.930801319552323 ], [ 56.0, 9.803956989486366 ], [ 57.0, 2.2665562407766093 ], [ 58.0, 0.9033708614608997 ], [ 59.0, 0.12353433253941548 ], [ 60.0, 0.024317781995947932 ], [ 61.0, 0.012367329129367806 ], [ 62.0, 0.003196051348038871 ], [ 63.0, 0.0030570925937763115 ], [ 64.0, 0.014312751689043638 ], [ 65.0, 0.00694793771312798 ], [ 66.0, 0.002084381313938394 ], [ 67.0, 0.0012506287883630365 ], [ 68.0, 0.0004168762627876788 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPMS1_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.00033103959674963233 ], [ 19.0, 0.00033103959674963233 ], [ 20.0, 0.00033103959674963233 ], [ 21.0, 0.00033103959674963233 ], [ 22.0, 0.00033103959674963233 ], [ 23.0, 0.0013241583869985293 ], [ 24.0, 0.0006620791934992647 ], [ 25.0, 0.000993118790248897 ], [ 26.0, 0.0025379702417471814 ], [ 27.0, 0.000993118790248897 ], [ 28.0, 0.0006620791934992647 ], [ 29.0, 0.0013241583869985293 ], [ 30.0, 0.001986237580497794 ], [ 31.0, 0.000993118790248897 ], [ 32.0, 0.0023172771772474263 ], [ 33.0, 0.0013241583869985293 ], [ 34.0, 0.0016551979837481617 ], [ 35.0, 0.0013241583869985293 ], [ 36.0, 0.001986237580497794 ], [ 37.0, 0.002979356370746691 ], [ 38.0, 0.0036414355642459552 ], [ 39.0, 0.004965593951244485 ], [ 40.0, 0.006951831531742279 ], [ 41.0, 0.004634554354494853 ], [ 42.0, 0.0076139107252415445 ], [ 43.0, 0.01721405903098088 ], [ 44.0, 0.023834850965973528 ], [ 45.0, 0.036524702174709434 ], [ 46.0, 0.08540821596140515 ], [ 47.0, 0.13208479910310328 ], [ 48.0, 2.3405602955521494 ], [ 49.0, 3.144545129524757 ], [ 50.0, 2.709228059798989 ], [ 51.0, 5.066892067849876 ], [ 52.0, 10.042086167400086 ], [ 53.0, 19.60957189959352 ], [ 54.0, 24.733071738487546 ], [ 55.0, 19.731173778132856 ], [ 56.0, 9.482629248893215 ], [ 57.0, 1.9684717888055627 ], [ 58.0, 0.6361477584205433 ], [ 59.0, 0.1061533640243821 ], [ 60.0, 0.03056598943321605 ], [ 61.0, 0.014124356127984315 ], [ 62.0, 0.004634554354494853 ], [ 63.0, 0.004634554354494853 ], [ 64.0, 0.015669207579482595 ], [ 65.0, 0.00904841564448995 ], [ 66.0, 0.0025379702417471814 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.00033103959674963233 ], [ 83.0, 0.00033103959674963233 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPMS2_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0003654761484174273 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0003654761484174273 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0003654761484174273 ], [ 22.0, 0.0007309522968348546 ], [ 23.0, 0.0003654761484174273 ], [ 24.0, 0.0 ], [ 25.0, 0.0007309522968348546 ], [ 26.0, 0.0014619045936697093 ], [ 27.0, 0.0025583330389219914 ], [ 28.0, 0.004507539163814937 ], [ 29.0, 0.0026801584217278 ], [ 30.0, 0.0007309522968348546 ], [ 31.0, 0.0007309522968348546 ], [ 32.0, 0.0003654761484174273 ], [ 33.0, 0.0007309522968348546 ], [ 34.0, 0.0021928568905045637 ], [ 35.0, 0.0021928568905045637 ], [ 36.0, 0.0029238091873394186 ], [ 37.0, 0.0025583330389219914 ], [ 38.0, 0.0032892853357568462 ], [ 39.0, 0.003654761484174273 ], [ 40.0, 0.0032892853357568462 ], [ 41.0, 0.008405951413600829 ], [ 42.0, 0.008405951413600829 ], [ 43.0, 0.014984522085114521 ], [ 44.0, 0.020101188162958503 ], [ 45.0, 0.03727856713857759 ], [ 46.0, 0.061278167551321976 ], [ 47.0, 0.11707419287638254 ], [ 48.0, 2.4678167794972747 ], [ 49.0, 3.553768241828258 ], [ 50.0, 3.6529341034321865 ], [ 51.0, 6.068000492174551 ], [ 52.0, 9.03079380201182 ], [ 53.0, 18.75392125450908 ], [ 54.0, 23.879115109149478 ], [ 55.0, 20.06646792885886 ], [ 56.0, 9.25665806173379 ], [ 57.0, 1.9321505713001321 ], [ 58.0, 0.8286562538451135 ], [ 59.0, 0.13242419110991452 ], [ 60.0, 0.02095396584259917 ], [ 61.0, 0.008771427562018255 ], [ 62.0, 0.007674999116765974 ], [ 63.0, 0.004507539163814936 ], [ 64.0, 0.01912658510051203 ], [ 65.0, 0.009624205241658919 ], [ 66.0, 0.0015837299764755184 ], [ 67.0, 0.0003654761484174273 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0003654761484174273 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVFS1_R1", "pairs": [ [ 0.0, 0.002758490691817973 ], [ 1.0, 0.0010344340094317398 ], [ 2.0, 0.0003448113364772466 ], [ 3.0, 0.0003448113364772466 ], [ 4.0, 0.0003448113364772466 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0003448113364772466 ], [ 21.0, 0.0003448113364772466 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0008045597851135753 ], [ 25.0, 0.0011493711215908218 ], [ 26.0, 0.0003448113364772466 ], [ 27.0, 0.0013792453459089864 ], [ 28.0, 0.002413679355340726 ], [ 29.0, 0.0010344340094317398 ], [ 30.0, 0.002413679355340726 ], [ 31.0, 0.0034481133647724658 ], [ 32.0, 0.004137736037726959 ], [ 33.0, 0.003103302028295219 ], [ 34.0, 0.003103302028295219 ], [ 35.0, 0.003103302028295219 ], [ 36.0, 0.004137736037726959 ], [ 37.0, 0.0037929247012497124 ], [ 38.0, 0.0037929247012497124 ], [ 39.0, 0.004827358710681452 ], [ 40.0, 0.004137736037726959 ], [ 41.0, 0.005516981383635946 ], [ 42.0, 0.0116086483280673 ], [ 43.0, 0.020343868852157557 ], [ 44.0, 0.02528616467499809 ], [ 45.0, 0.03057327183431587 ], [ 46.0, 0.10505252051340114 ], [ 47.0, 0.124476892468286 ], [ 48.0, 2.3034546647801655 ], [ 49.0, 3.30605109414384 ], [ 50.0, 3.4409872638186028 ], [ 51.0, 6.037416627492273 ], [ 52.0, 8.276391572351184 ], [ 53.0, 15.323760604385328 ], [ 54.0, 29.973644920181897 ], [ 55.0, 18.703601324535306 ], [ 56.0, 7.727451924679412 ], [ 57.0, 2.704585186215362 ], [ 58.0, 1.5733741283456764 ], [ 59.0, 0.14010833972192122 ], [ 60.0, 0.04769890154601911 ], [ 61.0, 0.01563144725363518 ], [ 62.0, 0.015631447253635182 ], [ 63.0, 0.006206604056590438 ], [ 64.0, 0.018045126608975906 ], [ 65.0, 0.007585849402499425 ], [ 66.0, 0.0008045597851135753 ], [ 67.0, 0.0009194968972726575 ], [ 68.0, 0.0008045597851135753 ], [ 69.0, 0.0003448113364772466 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVFS2_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0004884816037828015 ], [ 22.0, 0.0004884816037828015 ], [ 23.0, 0.0010990836085113032 ], [ 24.0, 0.0007327224056742022 ], [ 25.0, 0.0014654448113484045 ], [ 26.0, 0.0014654448113484045 ], [ 27.0, 0.0014654448113484045 ], [ 28.0, 0.0010990836085113032 ], [ 29.0, 0.0014654448113484045 ], [ 30.0, 0.0014654448113484045 ], [ 31.0, 0.002930889622696809 ], [ 32.0, 0.005006936438773715 ], [ 33.0, 0.004274214033099513 ], [ 34.0, 0.00329725082553391 ], [ 35.0, 0.0025645284198597077 ], [ 36.0, 0.0014654448113484045 ], [ 37.0, 0.0007327224056742022 ], [ 38.0, 0.004029973231208112 ], [ 39.0, 0.004518454834990913 ], [ 40.0, 0.005861779245393618 ], [ 41.0, 0.005861779245393618 ], [ 42.0, 0.008792668868090426 ], [ 43.0, 0.008548428066199026 ], [ 44.0, 0.019050782547529257 ], [ 45.0, 0.031140702241153593 ], [ 46.0, 0.10954199964829324 ], [ 47.0, 0.15277262158307112 ], [ 48.0, 3.0262656558354 ], [ 49.0, 4.015929385099358 ], [ 50.0, 3.9455880341546337 ], [ 51.0, 6.267341096934291 ], [ 52.0, 8.126379960530683 ], [ 53.0, 15.107514800992593 ], [ 54.0, 28.51132788839172 ], [ 55.0, 18.033397487250642 ], [ 56.0, 8.298936087066961 ], [ 57.0, 2.638777623634692 ], [ 58.0, 1.4134215205455363 ], [ 59.0, 0.14422419351687213 ], [ 60.0, 0.04103245471775532 ], [ 61.0, 0.015020809316321148 ], [ 62.0, 0.008548428066199026 ], [ 63.0, 0.005861779245393618 ], [ 64.0, 0.010746595283221635 ], [ 65.0, 0.007693585259579124 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0003663612028371011 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVMS1_R1", "pairs": [ [ 0.0, 0.0008134556409081417 ], [ 1.0, 0.00040672782045407085 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.00040672782045407085 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0016269112818162834 ], [ 23.0, 0.00040672782045407085 ], [ 24.0, 0.0012201834613622129 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.00040672782045407085 ], [ 28.0, 0.0008134556409081417 ], [ 29.0, 0.0028470947431784963 ], [ 30.0, 0.0028470947431784963 ], [ 31.0, 0.00447400602499478 ], [ 32.0, 0.003253822563632567 ], [ 33.0, 0.0024403669227244257 ], [ 34.0, 0.0048807338454488515 ], [ 35.0, 0.0020336391022703544 ], [ 36.0, 0.0012201834613622129 ], [ 37.0, 0.0008134556409081417 ], [ 38.0, 0.005965341366659706 ], [ 39.0, 0.009354739870443631 ], [ 40.0, 0.006643221067416493 ], [ 41.0, 0.009354739870443631 ], [ 42.0, 0.01599796093786012 ], [ 43.0, 0.022776757945427974 ], [ 44.0, 0.03579204819995824 ], [ 45.0, 0.04582466777115865 ], [ 46.0, 0.3503282293511064 ], [ 47.0, 0.44075738143206167 ], [ 48.0, 12.163873350379738 ], [ 49.0, 10.760255641992748 ], [ 50.0, 3.098045808398657 ], [ 51.0, 4.46288879790237 ], [ 52.0, 6.883461633364697 ], [ 53.0, 14.574277990330723 ], [ 54.0, 19.286490942171447 ], [ 55.0, 13.933274945295102 ], [ 56.0, 8.753731727752664 ], [ 57.0, 3.035816451869185 ], [ 58.0, 1.595728815581472 ], [ 59.0, 0.2956911254701096 ], [ 60.0, 0.1329999972884812 ], [ 61.0, 0.021692150424217117 ], [ 62.0, 0.009354739870443631 ], [ 63.0, 0.00582976542650835 ], [ 64.0, 0.00840570828938413 ], [ 65.0, 0.002575942862875782 ], [ 66.0, 0.0005423037606054279 ], [ 67.0, 0.0005423037606054279 ], [ 68.0, 0.00040672782045407085 ], [ 69.0, 0.00040672782045407085 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVMS2_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.00032731474258332067 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.00032731474258332067 ], [ 23.0, 0.0 ], [ 24.0, 0.00032731474258332067 ], [ 25.0, 0.0013092589703332827 ], [ 26.0, 0.0016365737129166032 ], [ 27.0, 0.0013092589703332827 ], [ 28.0, 0.000981944227749962 ], [ 29.0, 0.000981944227749962 ], [ 30.0, 0.0006546294851666413 ], [ 31.0, 0.0029458326832498857 ], [ 32.0, 0.0026185179406665654 ], [ 33.0, 0.0016365737129166032 ], [ 34.0, 0.0022912031980832446 ], [ 35.0, 0.001963888455499924 ], [ 36.0, 0.004036881825194288 ], [ 37.0, 0.0032731474258332065 ], [ 38.0, 0.003927776910999848 ], [ 39.0, 0.008182868564583017 ], [ 40.0, 0.008510183307166337 ], [ 41.0, 0.007855553821999695 ], [ 42.0, 0.012110645475582864 ], [ 43.0, 0.017893205927888196 ], [ 44.0, 0.0290219071757211 ], [ 45.0, 0.03971418876677624 ], [ 46.0, 0.40925253314334525 ], [ 47.0, 0.4800616224555368 ], [ 48.0, 10.776947004470015 ], [ 49.0, 9.629054202230318 ], [ 50.0, 3.0236244870705207 ], [ 51.0, 4.378707521365472 ], [ 52.0, 7.78452652285911 ], [ 53.0, 15.017855019207929 ], [ 54.0, 19.490501871694836 ], [ 55.0, 14.763640569134875 ], [ 56.0, 9.075674077436114 ], [ 57.0, 2.933612932860107 ], [ 58.0, 1.630791152464298 ], [ 59.0, 0.28225441302101684 ], [ 60.0, 0.11117790756413456 ], [ 61.0, 0.016474842043360475 ], [ 62.0, 0.014183638845277229 ], [ 63.0, 0.009819442277499618 ], [ 64.0, 0.009710337363305179 ], [ 65.0, 0.005237035881333131 ], [ 66.0, 0.0016365737129166032 ], [ 67.0, 0.0007637343993610815 ], [ 68.0, 0.00032731474258332067 ], [ 69.0, 0.0 ], [ 70.0, 0.00032731474258332067 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAFS1_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0008046217473165856 ], [ 39.0, 0.001072828996422114 ], [ 40.0, 0.002145657992844228 ], [ 41.0, 0.001072828996422114 ], [ 42.0, 0.0008046217473165856 ], [ 43.0, 0.009387253718693497 ], [ 44.0, 0.012337533458854313 ], [ 45.0, 0.17111622492932752 ], [ 46.0, 0.4012380446618686 ], [ 47.0, 0.13383541730365878 ], [ 48.0, 0.19015893961581973 ], [ 49.0, 0.8569221608921636 ], [ 50.0, 3.7127929493678318 ], [ 51.0, 3.179865145395148 ], [ 52.0, 1.841510972358559 ], [ 53.0, 4.613432891864197 ], [ 54.0, 29.149836661785244 ], [ 55.0, 44.31695659870304 ], [ 56.0, 9.742896531007442 ], [ 57.0, 1.148463440669873 ], [ 58.0, 0.29046845078128736 ], [ 59.0, 0.10084592566367871 ], [ 60.0, 0.030575626398030253 ], [ 61.0, 0.011801118960643254 ], [ 62.0, 0.015287813199015125 ], [ 63.0, 0.010728289964221139 ], [ 64.0, 0.03272128439087448 ], [ 65.0, 0.004291315985688456 ], [ 66.0, 0.001072828996422114 ], [ 67.0, 0.0 ], [ 68.0, 0.0040231087365829275 ], [ 69.0, 0.0032184869892663425 ], [ 70.0, 0.0016092434946331712 ], [ 71.0, 0.004291315985688456 ], [ 72.0, 0.0016092434946331712 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0008046217473165856 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAFS2_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.005137492133215167 ], [ 41.0, 0.0 ], [ 42.0, 0.0019265595499556878 ], [ 43.0, 0.0019265595499556878 ], [ 44.0, 0.0025687460666075834 ], [ 45.0, 0.1329326089469425 ], [ 46.0, 0.4045775054906951 ], [ 47.0, 0.5959490874529595 ], [ 48.0, 0.468796157155884 ], [ 49.0, 1.04997495472585 ], [ 50.0, 3.9905470144748807 ], [ 51.0, 3.2655184371748907 ], [ 52.0, 2.623974107039647 ], [ 53.0, 9.596193118329275 ], [ 54.0, 28.406478377580015 ], [ 55.0, 37.25837732310971 ], [ 56.0, 9.654632091344606 ], [ 57.0, 1.7371145275433788 ], [ 58.0, 0.3898072156077008 ], [ 59.0, 0.1547669505131069 ], [ 60.0, 0.03596244493250618 ], [ 61.0, 0.034035885382550486 ], [ 62.0, 0.028898393249335318 ], [ 63.0, 0.0468796157155884 ], [ 64.0, 0.03339369886589859 ], [ 65.0, 0.02183434156616446 ], [ 66.0, 0.007706238199822751 ], [ 67.0, 0.007706238199822751 ], [ 68.0, 0.005779678649867064 ], [ 69.0, 0.007706238199822751 ], [ 70.0, 0.015412476399645502 ], [ 71.0, 0.011559357299734127 ], [ 72.0, 0.0019265595499556878 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAMS1_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.002212397538339006 ], [ 39.0, 0.001106198769169503 ], [ 40.0, 0.0 ], [ 41.0, 0.0014749316922260038 ], [ 42.0, 0.0 ], [ 43.0, 0.005530993845847515 ], [ 44.0, 0.004424795076678012 ], [ 45.0, 0.36541432674899205 ], [ 46.0, 0.8399735987227134 ], [ 47.0, 0.6021408633512655 ], [ 48.0, 0.28318688490739274 ], [ 49.0, 0.7389407778052279 ], [ 50.0, 45.74279403685123 ], [ 51.0, 35.678966367870004 ], [ 52.0, 1.960184218968357 ], [ 53.0, 3.2371063315130253 ], [ 54.0, 3.9878465628560607 ], [ 55.0, 4.0752362656204495 ], [ 56.0, 1.562321394990395 ], [ 57.0, 0.3167415809055344 ], [ 58.0, 0.09107703199495575 ], [ 59.0, 0.04941021168957114 ], [ 60.0, 0.024705105844785562 ], [ 61.0, 0.02286144122950306 ], [ 62.0, 0.029498633844520075 ], [ 63.0, 0.02544257169089857 ], [ 64.0, 0.027286236306181072 ], [ 65.0, 0.008849590153356023 ], [ 66.0, 0.005530993845847514 ], [ 67.0, 0.001106198769169503 ], [ 68.0, 0.10951367814778079 ], [ 69.0, 0.18031039937462898 ], [ 70.0, 0.004424795076678012 ], [ 71.0, 0.0 ], [ 72.0, 0.004424795076678012 ], [ 73.0, 0.004424795076678012 ], [ 74.0, 0.002212397538339006 ], [ 75.0, 0.002212397538339006 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.001106198769169503 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAMS2_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0008636448692297714 ], [ 34.0, 0.0008636448692297714 ], [ 35.0, 0.0 ], [ 36.0, 0.0011515264923063618 ], [ 37.0, 0.0060455140846084 ], [ 38.0, 0.00633339570768499 ], [ 39.0, 0.006909158953838171 ], [ 40.0, 0.012666791415369983 ], [ 41.0, 0.0023030529846127237 ], [ 42.0, 0.0 ], [ 43.0, 0.0025909346076893143 ], [ 44.0, 0.00633339570768499 ], [ 45.0, 0.34747311905344364 ], [ 46.0, 0.7536740892145201 ], [ 47.0, 0.12753155902292956 ], [ 48.0, 0.05786420623839468 ], [ 49.0, 0.5394901616455307 ], [ 50.0, 50.68271126912618 ], [ 51.0, 39.23941675183161 ], [ 52.0, 1.4247261526060448 ], [ 53.0, 1.1331020684294602 ], [ 54.0, 1.5557122911058945 ], [ 55.0, 2.4671455097663806 ], [ 56.0, 1.1509507290602088 ], [ 57.0, 0.3362457357534577 ], [ 58.0, 0.04606105969225448 ], [ 59.0, 0.021015358484591105 ], [ 60.0, 0.01640925251536566 ], [ 61.0, 0.006909158953838171 ], [ 62.0, 0.0017272897384595428 ], [ 63.0, 0.0025909346076893143 ], [ 64.0, 0.006909158953838171 ], [ 65.0, 0.0 ], [ 66.0, 0.0017272897384595428 ], [ 67.0, 0.0034545794769190855 ], [ 68.0, 0.0017272897384595428 ], [ 69.0, 0.011227383299987029 ], [ 70.0, 0.011227383299987029 ], [ 71.0, 0.0034545794769190855 ], [ 72.0, 0.0034545794769190855 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCFS1_R1", "pairs": [ [ 0.0, 0.007265065930473324 ], [ 1.0, 0.003632532965236662 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.000605422160872777 ], [ 24.0, 0.002421688643491108 ], [ 25.0, 0.001816266482618331 ], [ 26.0, 0.00423795512610944 ], [ 27.0, 0.003632532965236662 ], [ 28.0, 0.002421688643491108 ], [ 29.0, 0.001816266482618331 ], [ 30.0, 0.00605422160872777 ], [ 31.0, 0.004843377286982216 ], [ 32.0, 0.009283139800049247 ], [ 33.0, 0.007063258543515731 ], [ 34.0, 0.005448799447854993 ], [ 35.0, 0.004641569900024623 ], [ 36.0, 0.006256028995685363 ], [ 37.0, 0.016750013117480162 ], [ 38.0, 0.012713865378328318 ], [ 39.0, 0.01130121366962517 ], [ 40.0, 0.024822308595783854 ], [ 41.0, 0.028858456334935712 ], [ 42.0, 0.021997005178377563 ], [ 43.0, 0.04581027683937346 ], [ 44.0, 0.07507234794822432 ], [ 45.0, 0.49099737246782504 ], [ 46.0, 1.1725009182235904 ], [ 47.0, 0.3729400510976306 ], [ 48.0, 0.2377291018360437 ], [ 49.0, 0.5707112903160714 ], [ 50.0, 20.92439891669792 ], [ 51.0, 18.435710220736844 ], [ 52.0, 27.002030182312865 ], [ 53.0, 6.686282344678958 ], [ 54.0, 6.273182623576759 ], [ 55.0, 13.6770920362769 ], [ 56.0, 2.7764660297625565 ], [ 57.0, 0.4254099717066048 ], [ 58.0, 0.19938569831410113 ], [ 59.0, 0.12471696513979214 ], [ 60.0, 0.07204523714386045 ], [ 61.0, 0.04056328477847606 ], [ 62.0, 0.024418693821868676 ], [ 63.0, 0.016346398343564977 ], [ 64.0, 0.018566279600098493 ], [ 65.0, 0.012310250604413134 ], [ 66.0, 0.013319287539201094 ], [ 67.0, 0.015740976182692202 ], [ 68.0, 0.016548205730522573 ], [ 69.0, 0.022602427339250348 ], [ 70.0, 0.03107833759146922 ], [ 71.0, 0.021189775630547195 ], [ 72.0, 0.003632532965236662 ], [ 73.0, 0.002421688643491108 ], [ 74.0, 0.00605422160872777 ], [ 75.0, 0.00423795512610944 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.000605422160872777 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCFS2_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0013682791836846376 ], [ 23.0, 0.0023944885714481156 ], [ 24.0, 0.0 ], [ 25.0, 0.004104837551053913 ], [ 26.0, 0.004446907346975072 ], [ 27.0, 0.004788977142896231 ], [ 28.0, 0.0 ], [ 29.0, 0.0054731167347385505 ], [ 30.0, 0.0034206979592115937 ], [ 31.0, 0.00513104693881739 ], [ 32.0, 0.0010262093877634782 ], [ 33.0, 0.0010262093877634782 ], [ 34.0, 0.003078628163290435 ], [ 35.0, 0.004104837551053913 ], [ 36.0, 0.00513104693881739 ], [ 37.0, 0.022576606530796517 ], [ 38.0, 0.023944885714481157 ], [ 39.0, 0.01607728040829449 ], [ 40.0, 0.05986221428620292 ], [ 41.0, 0.04720563183712 ], [ 42.0, 0.021208327347111883 ], [ 43.0, 0.04857391102080463 ], [ 44.0, 0.13511756938885786 ], [ 45.0, 1.6231211816458817 ], [ 46.0, 3.7702932906431523 ], [ 47.0, 1.0556273902127056 ], [ 48.0, 0.43716519918724156 ], [ 49.0, 0.7419493873529948 ], [ 50.0, 16.24763116666326 ], [ 51.0, 15.54912464339228 ], [ 52.0, 31.685241056585074 ], [ 53.0, 7.561452838837217 ], [ 54.0, 5.4033344963706345 ], [ 55.0, 11.465153349889505 ], [ 56.0, 2.4519562971628694 ], [ 57.0, 0.4977115530652867 ], [ 58.0, 0.21276741306296118 ], [ 59.0, 0.1795866428586087 ], [ 60.0, 0.11322510244990375 ], [ 61.0, 0.07046637795975885 ], [ 62.0, 0.04139044530646028 ], [ 63.0, 0.04446907346975072 ], [ 64.0, 0.04960012040856812 ], [ 65.0, 0.045837352653435366 ], [ 66.0, 0.02565523469408695 ], [ 67.0, 0.04788977142896232 ], [ 68.0, 0.05986221428620289 ], [ 69.0, 0.04344286408198725 ], [ 70.0, 0.0615725632658087 ], [ 71.0, 0.05849393510251826 ], [ 72.0, 0.02052418775526956 ], [ 73.0, 0.009235884489871303 ], [ 74.0, 0.0010262093877634782 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0020524187755269563 ], [ 80.0, 0.0020524187755269563 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0010262093877634782 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCMS1_R1", "pairs": [ [ 0.0, 0.0006166368625516418 ], [ 1.0, 0.0003083184312758209 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0003083184312758209 ], [ 21.0, 0.0003083184312758209 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0003083184312758209 ], [ 25.0, 0.0015415921563791046 ], [ 26.0, 0.0024665474502065673 ], [ 27.0, 0.0028776386919076614 ], [ 28.0, 0.0018499105876549253 ], [ 29.0, 0.004008139606585671 ], [ 30.0, 0.002774865881482388 ], [ 31.0, 0.00339150274403403 ], [ 32.0, 0.004316458037861493 ], [ 33.0, 0.0036998211753098507 ], [ 34.0, 0.0024665474502065673 ], [ 35.0, 0.004624776469137314 ], [ 36.0, 0.0036998211753098507 ], [ 37.0, 0.005652504573390049 ], [ 38.0, 0.006680232677642786 ], [ 39.0, 0.009557871369550448 ], [ 40.0, 0.008016279213171343 ], [ 41.0, 0.008427370454872437 ], [ 42.0, 0.01469651189081413 ], [ 43.0, 0.026412612279295315 ], [ 44.0, 0.03514830116544356 ], [ 45.0, 0.21551458346179936 ], [ 46.0, 0.4879653038991939 ], [ 47.0, 0.18416887628209022 ], [ 48.0, 0.23576082711557786 ], [ 49.0, 0.6043041253006083 ], [ 50.0, 19.289634334340562 ], [ 51.0, 17.22482580008642 ], [ 52.0, 23.183079484491532 ], [ 53.0, 7.170356210560906 ], [ 54.0, 9.307414030544047 ], [ 55.0, 18.04084191486298 ], [ 56.0, 2.9027152576514266 ], [ 57.0, 0.4531253211650312 ], [ 58.0, 0.24254383260364576 ], [ 59.0, 0.12959651394627003 ], [ 60.0, 0.05405849828369393 ], [ 61.0, 0.024871020122916216 ], [ 62.0, 0.016238104047193235 ], [ 63.0, 0.01952683398080199 ], [ 64.0, 0.01243551006145811 ], [ 65.0, 0.014490966269963582 ], [ 66.0, 0.00678300548806806 ], [ 67.0, 0.0024665474502065673 ], [ 68.0, 0.0018499105876549253 ], [ 69.0, 0.005549731762964776 ], [ 70.0, 0.006166368625516418 ], [ 71.0, 0.0036998211753098507 ], [ 72.0, 0.0018499105876549253 ], [ 73.0, 0.0006166368625516418 ], [ 74.0, 0.0 ], [ 75.0, 0.0006166368625516418 ], [ 76.0, 0.0012332737251032836 ], [ 77.0, 0.0006166368625516418 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0003083184312758209 ], [ 83.0, 0.0006166368625516418 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCMS2_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0007675343215764142 ], [ 25.0, 0.0015350686431528284 ], [ 26.0, 0.0007675343215764142 ], [ 27.0, 0.0015350686431528284 ], [ 28.0, 0.0015350686431528284 ], [ 29.0, 0.003070137286305657 ], [ 30.0, 0.003070137286305657 ], [ 31.0, 0.002302602964729242 ], [ 32.0, 0.002302602964729242 ], [ 33.0, 0.00383767160788207 ], [ 34.0, 0.0015350686431528284 ], [ 35.0, 0.006907808894187726 ], [ 36.0, 0.006140274572611312 ], [ 37.0, 0.01432730733609306 ], [ 38.0, 0.01918835803941035 ], [ 39.0, 0.02149096100413959 ], [ 40.0, 0.05116895477176095 ], [ 41.0, 0.02993383854148015 ], [ 42.0, 0.02353771919501003 ], [ 43.0, 0.05782091889208986 ], [ 44.0, 0.09594179019705168 ], [ 45.0, 1.582911615864392 ], [ 46.0, 3.569290440104226 ], [ 47.0, 0.9806530182007962 ], [ 48.0, 0.6145391468088495 ], [ 49.0, 0.9251347022734381 ], [ 50.0, 15.411321642932812 ], [ 51.0, 14.194779743234207 ], [ 52.0, 24.28401840035608 ], [ 53.0, 7.007844200766519 ], [ 54.0, 9.052299788672233 ], [ 55.0, 17.227563692556462 ], [ 56.0, 2.881835532745579 ], [ 57.0, 0.5973975469603091 ], [ 58.0, 0.3893957458131007 ], [ 59.0, 0.2573798425019575 ], [ 60.0, 0.14455229723022464 ], [ 61.0, 0.07265991577590053 ], [ 62.0, 0.04630790406844365 ], [ 63.0, 0.05168064431947855 ], [ 64.0, 0.04656374884230247 ], [ 65.0, 0.03556242356637385 ], [ 66.0, 0.02353771919501003 ], [ 67.0, 0.02993383854148015 ], [ 68.0, 0.03709749220952668 ], [ 69.0, 0.04170269813898517 ], [ 70.0, 0.05475078160578422 ], [ 71.0, 0.04605205929458485 ], [ 72.0, 0.02839876989832732 ], [ 73.0, 0.011513014823646212 ], [ 74.0, 0.003070137286305657 ], [ 75.0, 0.0015350686431528284 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPFS1_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0005272537461378665 ], [ 11.0, 0.0005272537461378665 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0005272537461378665 ], [ 21.0, 0.001054507492275733 ], [ 22.0, 0.001054507492275733 ], [ 23.0, 0.0 ], [ 24.0, 0.0015817612384135997 ], [ 25.0, 0.0015817612384135997 ], [ 26.0, 0.001054507492275733 ], [ 27.0, 0.0031635224768271995 ], [ 28.0, 0.003690776222965066 ], [ 29.0, 0.003690776222965066 ], [ 30.0, 0.0031635224768271995 ], [ 31.0, 0.002109014984551466 ], [ 32.0, 0.005272537461378665 ], [ 33.0, 0.0026362687306893326 ], [ 34.0, 0.002109014984551466 ], [ 35.0, 0.005272537461378665 ], [ 36.0, 0.004745283715240799 ], [ 37.0, 0.006327044953654399 ], [ 38.0, 0.009490567430481598 ], [ 39.0, 0.010896577420182576 ], [ 40.0, 0.01054507492275733 ], [ 41.0, 0.012126836161170931 ], [ 42.0, 0.01529035863799813 ], [ 43.0, 0.01862963236353795 ], [ 44.0, 0.026714189804318576 ], [ 45.0, 0.18647207488409187 ], [ 46.0, 0.43463283806631714 ], [ 47.0, 0.17416948747420852 ], [ 48.0, 0.1585276263387852 ], [ 49.0, 0.45097770419658906 ], [ 50.0, 16.619741083260344 ], [ 51.0, 15.299673454179816 ], [ 52.0, 25.4689922071897 ], [ 53.0, 6.677844446084798 ], [ 54.0, 10.331361404322786 ], [ 55.0, 21.195776345990954 ], [ 56.0, 2.152952796729626 ], [ 57.0, 0.30299515278056055 ], [ 58.0, 0.15887912883621041 ], [ 59.0, 0.07082775323118672 ], [ 60.0, 0.03866527471677689 ], [ 61.0, 0.02548393106333022 ], [ 62.0, 0.011248079917607819 ], [ 63.0, 0.008963313684343732 ], [ 64.0, 0.015114607389285505 ], [ 65.0, 0.01054507492275733 ], [ 66.0, 0.007205801197217509 ], [ 67.0, 0.004218029969102932 ], [ 68.0, 0.004218029969102932 ], [ 69.0, 0.009490567430481598 ], [ 70.0, 0.012654089907308798 ], [ 71.0, 0.009139064933056355 ], [ 72.0, 0.0038665274716776876 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.001054507492275733 ], [ 77.0, 0.0005272537461378665 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPFS2_R1", "pairs": [ [ 0.0, 0.0022259527541527943 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0005564881885381986 ], [ 7.0, 0.0005564881885381986 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0005564881885381986 ], [ 23.0, 0.0 ], [ 24.0, 0.0005564881885381986 ], [ 25.0, 0.0005564881885381986 ], [ 26.0, 0.0022259527541527943 ], [ 27.0, 0.00389541731976739 ], [ 28.0, 0.0005564881885381986 ], [ 29.0, 0.0033389291312291916 ], [ 30.0, 0.005564881885381986 ], [ 31.0, 0.0016694645656145958 ], [ 32.0, 0.0022259527541527943 ], [ 33.0, 0.0033389291312291916 ], [ 34.0, 0.005750377948228052 ], [ 35.0, 0.007976330702380846 ], [ 36.0, 0.006121370073920185 ], [ 37.0, 0.018920598410298754 ], [ 38.0, 0.02411448816998861 ], [ 39.0, 0.02300151179291221 ], [ 40.0, 0.05138240940836031 ], [ 41.0, 0.03320379524944587 ], [ 42.0, 0.015396173216223493 ], [ 43.0, 0.03134883462098519 ], [ 44.0, 0.05342286609966706 ], [ 45.0, 0.77593003088509 ], [ 46.0, 1.8352980457990271 ], [ 47.0, 0.5767072593884236 ], [ 48.0, 0.37210510206920894 ], [ 49.0, 0.6416308813845428 ], [ 50.0, 17.0465316873649 ], [ 51.0, 15.129429877850784 ], [ 52.0, 24.4977230358286 ], [ 53.0, 6.23266771162783 ], [ 54.0, 10.058338511765093 ], [ 55.0, 19.15784787467886 ], [ 56.0, 1.9506765968892337 ], [ 57.0, 0.31794025171815743 ], [ 58.0, 0.23539450375165794 ], [ 59.0, 0.18141514946345277 ], [ 60.0, 0.11574954321594531 ], [ 61.0, 0.08217475584080734 ], [ 62.0, 0.043220582643133436 ], [ 63.0, 0.02448548029568074 ], [ 64.0, 0.02986486611821667 ], [ 65.0, 0.03116333855813913 ], [ 66.0, 0.028009905489755998 ], [ 67.0, 0.04433355902020982 ], [ 68.0, 0.0395106613862121 ], [ 69.0, 0.05435034641389739 ], [ 70.0, 0.08662666134911293 ], [ 71.0, 0.06399614168189284 ], [ 72.0, 0.02893738580398633 ], [ 73.0, 0.011129763770763973 ], [ 74.0, 0.0022259527541527943 ], [ 75.0, 0.0033389291312291916 ], [ 76.0, 0.0011129763770763971 ], [ 77.0, 0.0 ], [ 78.0, 0.0011129763770763971 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0005564881885381986 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPMS1_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0009107938175315664 ], [ 14.0, 0.0009107938175315664 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0009107938175315664 ], [ 26.0, 0.0018215876350631329 ], [ 27.0, 0.0018215876350631329 ], [ 28.0, 0.007589948479429719 ], [ 29.0, 0.016697886654745385 ], [ 30.0, 0.030359793917718876 ], [ 31.0, 0.0382533403363258 ], [ 32.0, 0.04068212384974331 ], [ 33.0, 0.07984625800360065 ], [ 34.0, 0.11718880452239486 ], [ 35.0, 0.08440022709125847 ], [ 36.0, 0.06041598989626059 ], [ 37.0, 0.07195271158499376 ], [ 38.0, 0.06679154661898155 ], [ 39.0, 0.09320456732739693 ], [ 40.0, 0.07832826830771471 ], [ 41.0, 0.08652541266549882 ], [ 42.0, 0.045843288815755515 ], [ 43.0, 0.020341061924871652 ], [ 44.0, 0.025805824830061053 ], [ 45.0, 0.12811833033277364 ], [ 46.0, 0.32758217637218634 ], [ 47.0, 0.17426521708770643 ], [ 48.0, 1.2417155712347023 ], [ 49.0, 1.7900134493887048 ], [ 50.0, 13.967023191846584 ], [ 51.0, 12.659123269871259 ], [ 52.0, 20.75395512215262 ], [ 53.0, 13.946985727860886 ], [ 54.0, 14.194418048290295 ], [ 55.0, 13.417814519875042 ], [ 56.0, 4.236102045339315 ], [ 57.0, 1.0868806222543361 ], [ 58.0, 0.5862476205511515 ], [ 59.0, 0.23984237194997915 ], [ 60.0, 0.04948646408588179 ], [ 61.0, 0.01578709283721382 ], [ 62.0, 0.01851947428980852 ], [ 63.0, 0.02125185574240322 ], [ 64.0, 0.03643175270126266 ], [ 65.0, 0.016394288715568195 ], [ 66.0, 0.004250371148480643 ], [ 67.0, 0.004857567026835021 ], [ 68.0, 0.011840319627910365 ], [ 69.0, 0.016394288715568195 ], [ 70.0, 0.02368063925582073 ], [ 71.0, 0.030966989796073263 ], [ 72.0, 0.016394288715568195 ], [ 73.0, 0.0018215876350631329 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0009107938175315664 ], [ 78.0, 0.0018215876350631329 ], [ 79.0, 0.0027323814525946994 ], [ 80.0, 0.0027323814525946994 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0009107938175315664 ], [ 87.0, 0.0009107938175315664 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0012143917567087553 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPMS2_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0008507380152282105 ], [ 24.0, 0.0008507380152282105 ], [ 25.0, 0.001701476030456421 ], [ 26.0, 0.003402952060912842 ], [ 27.0, 0.001701476030456421 ], [ 28.0, 0.001701476030456421 ], [ 29.0, 0.001701476030456421 ], [ 30.0, 0.001701476030456421 ], [ 31.0, 0.0025522140456846316 ], [ 32.0, 0.003402952060912842 ], [ 33.0, 0.001701476030456421 ], [ 34.0, 0.001701476030456421 ], [ 35.0, 0.001701476030456421 ], [ 36.0, 0.005104428091369263 ], [ 37.0, 0.005955166106597474 ], [ 38.0, 0.003402952060912842 ], [ 39.0, 0.01701476030456421 ], [ 40.0, 0.02041771236547705 ], [ 41.0, 0.013328228905241967 ], [ 42.0, 0.02240276773434288 ], [ 43.0, 0.026656457810483928 ], [ 44.0, 0.05076070157528324 ], [ 45.0, 0.27734059296439656 ], [ 46.0, 0.6876798956428064 ], [ 47.0, 0.3731904093467747 ], [ 48.0, 3.714038595147958 ], [ 49.0, 3.80393324542374 ], [ 50.0, 19.656018262509374 ], [ 51.0, 16.418960114566055 ], [ 52.0, 15.715116196633923 ], [ 53.0, 8.350560778141704 ], [ 54.0, 11.32389014136431 ], [ 55.0, 13.390616359692043 ], [ 56.0, 3.829455385880584 ], [ 57.0, 1.1587051767408227 ], [ 58.0, 0.6491131056191247 ], [ 59.0, 0.16702823032313868 ], [ 60.0, 0.07741715938576717 ], [ 61.0, 0.033462361932309614 ], [ 62.0, 0.023820664426389897 ], [ 63.0, 0.016164022289336003 ], [ 64.0, 0.017865498319792422 ], [ 65.0, 0.013328228905241967 ], [ 66.0, 0.008507380152282105 ], [ 67.0, 0.007940221475463298 ], [ 68.0, 0.008507380152282105 ], [ 69.0, 0.01701476030456421 ], [ 70.0, 0.03147730656344379 ], [ 71.0, 0.022119188395933475 ], [ 72.0, 0.008507380152282105 ], [ 73.0, 0.004253690076141053 ], [ 74.0, 0.0 ], [ 75.0, 0.001701476030456421 ], [ 76.0, 0.0025522140456846316 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVFS1_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0010109008811686026 ], [ 23.0, 0.0020218017623372052 ], [ 24.0, 0.0030327026435058076 ], [ 25.0, 0.0030327026435058076 ], [ 26.0, 0.0030327026435058076 ], [ 27.0, 0.007076306168180217 ], [ 28.0, 0.0040436035246744105 ], [ 29.0, 0.0010109008811686026 ], [ 30.0, 0.0050545044058430124 ], [ 31.0, 0.0030327026435058076 ], [ 32.0, 0.007750240088959286 ], [ 33.0, 0.010782942732465094 ], [ 34.0, 0.0040436035246744105 ], [ 35.0, 0.0013478678415581368 ], [ 36.0, 0.005391471366232547 ], [ 37.0, 0.0030327026435058076 ], [ 38.0, 0.0030327026435058076 ], [ 39.0, 0.009098107930517423 ], [ 40.0, 0.01684834801947671 ], [ 41.0, 0.018533182821424382 ], [ 42.0, 0.02257678634609879 ], [ 43.0, 0.03167489427661621 ], [ 44.0, 0.03774029956362783 ], [ 45.0, 0.22239819385709292 ], [ 46.0, 0.597105453810254 ], [ 47.0, 0.28372618064798794 ], [ 48.0, 0.5162333833167663 ], [ 49.0, 1.2427341499166018 ], [ 50.0, 28.854143851195353 ], [ 51.0, 24.141323943187352 ], [ 52.0, 11.432278065135733 ], [ 53.0, 7.0837194413087845 ], [ 54.0, 9.81551058918674 ], [ 55.0, 10.086768992300316 ], [ 56.0, 3.6631678263946275 ], [ 57.0, 0.7767088436978766 ], [ 58.0, 0.509157077148586 ], [ 59.0, 0.2682257004700692 ], [ 60.0, 0.10580762556231373 ], [ 61.0, 0.05930618502855802 ], [ 62.0, 0.03167489427661621 ], [ 63.0, 0.011119909692854627 ], [ 64.0, 0.029316125553889474 ], [ 65.0, 0.019544083702592988 ], [ 66.0, 0.011793843613633696 ], [ 67.0, 0.005391471366232547 ], [ 68.0, 0.004380570485063944 ], [ 69.0, 0.0050545044058430124 ], [ 70.0, 0.009098107930517423 ], [ 71.0, 0.008087207049348821 ], [ 72.0, 0.0020218017623372052 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVFS2_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0007228985339617748 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0007228985339617748 ], [ 22.0, 0.0007228985339617748 ], [ 23.0, 0.0014457970679235496 ], [ 24.0, 0.0014457970679235496 ], [ 25.0, 0.0014457970679235496 ], [ 26.0, 0.0 ], [ 27.0, 0.0007228985339617748 ], [ 28.0, 0.0007228985339617748 ], [ 29.0, 0.002168695601885324 ], [ 30.0, 0.002168695601885324 ], [ 31.0, 0.002891594135847099 ], [ 32.0, 0.0014457970679235496 ], [ 33.0, 0.003855458847796132 ], [ 34.0, 0.002891594135847099 ], [ 35.0, 0.004578357381757907 ], [ 36.0, 0.004578357381757907 ], [ 37.0, 0.008192850051566782 ], [ 38.0, 0.03156656931633083 ], [ 39.0, 0.036385892876076006 ], [ 40.0, 0.05373545769115861 ], [ 41.0, 0.024096617798725826 ], [ 42.0, 0.018795361883006144 ], [ 43.0, 0.02987980607042002 ], [ 44.0, 0.04457874292764278 ], [ 45.0, 0.5549451079046588 ], [ 46.0, 1.3973628661480855 ], [ 47.0, 0.4510886851921476 ], [ 48.0, 0.46530568969339586 ], [ 49.0, 0.9872384312137968 ], [ 50.0, 24.429392090526175 ], [ 51.0, 21.17297516120632 ], [ 52.0, 21.10116724016616 ], [ 53.0, 7.267298961917723 ], [ 54.0, 6.1043961869512104 ], [ 55.0, 9.915276291819712 ], [ 56.0, 4.151365314364478 ], [ 57.0, 0.6641027865328848 ], [ 58.0, 0.34795516101360074 ], [ 59.0, 0.258556708980328 ], [ 60.0, 0.1498809627080747 ], [ 61.0, 0.062169273920712635 ], [ 62.0, 0.029397873714445508 ], [ 63.0, 0.01951826041696792 ], [ 64.0, 0.03494009580815245 ], [ 65.0, 0.033976231096203416 ], [ 66.0, 0.01277120743332469 ], [ 67.0, 0.011807342721375656 ], [ 68.0, 0.011807342721375654 ], [ 69.0, 0.022650820730802275 ], [ 70.0, 0.025301448688662118 ], [ 71.0, 0.015903767747159046 ], [ 72.0, 0.007951883873579523 ], [ 73.0, 0.0014457970679235496 ], [ 74.0, 0.002168695601885324 ], [ 75.0, 0.002891594135847099 ], [ 76.0, 0.004337391203770648 ], [ 77.0, 0.002891594135847099 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVMS1_R1", "pairs": [ [ 0.0, 0.0008874243101015513 ], [ 1.0, 0.00044371215505077563 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.00044371215505077563 ], [ 16.0, 0.0 ], [ 17.0, 0.00044371215505077563 ], [ 18.0, 0.00044371215505077563 ], [ 19.0, 0.00044371215505077563 ], [ 20.0, 0.00044371215505077563 ], [ 21.0, 0.00044371215505077563 ], [ 22.0, 0.00044371215505077563 ], [ 23.0, 0.00044371215505077563 ], [ 24.0, 0.0008874243101015513 ], [ 25.0, 0.0022185607752538785 ], [ 26.0, 0.001331136465152327 ], [ 27.0, 0.002662272930304654 ], [ 28.0, 0.002662272930304654 ], [ 29.0, 0.006655682325761635 ], [ 30.0, 0.004880833705558532 ], [ 31.0, 0.004880833705558532 ], [ 32.0, 0.006211970170710859 ], [ 33.0, 0.004141313447140573 ], [ 34.0, 0.003253889137039021 ], [ 35.0, 0.005324545860609308 ], [ 36.0, 0.005620353963976492 ], [ 37.0, 0.004141313447140573 ], [ 38.0, 0.009761667411117064 ], [ 39.0, 0.012276036289738125 ], [ 40.0, 0.013015556548156084 ], [ 41.0, 0.018931718615499762 ], [ 42.0, 0.01804429430539821 ], [ 43.0, 0.013902980858257637 ], [ 44.0, 0.031207754905237892 ], [ 45.0, 0.5473928952809735 ], [ 46.0, 1.733435485731748 ], [ 47.0, 0.7199969235957218 ], [ 48.0, 1.9208299192148086 ], [ 49.0, 2.6184933310063103 ], [ 50.0, 13.603327249546659 ], [ 51.0, 12.245568055091285 ], [ 52.0, 10.113679054124011 ], [ 53.0, 14.728581274755422 ], [ 54.0, 17.576473789923007 ], [ 55.0, 13.685266094179378 ], [ 56.0, 7.1115226130504725 ], [ 57.0, 1.7828354389940175 ], [ 58.0, 0.7276879342832719 ], [ 59.0, 0.33722123783858954 ], [ 60.0, 0.15544715831945505 ], [ 61.0, 0.03978618990288622 ], [ 62.0, 0.03387002783554254 ], [ 63.0, 0.02115027939075364 ], [ 64.0, 0.029580810336718374 ], [ 65.0, 0.034165835938909726 ], [ 66.0, 0.005324545860609308 ], [ 67.0, 0.002662272930304654 ], [ 68.0, 0.0057682580156600835 ], [ 69.0, 0.011240707927952984 ], [ 70.0, 0.013015556548156084 ], [ 71.0, 0.007986818790913962 ], [ 72.0, 0.002662272930304654 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.001331136465152327 ], [ 77.0, 0.0022185607752538785 ], [ 78.0, 0.0017748486202031025 ], [ 79.0, 0.0008874243101015513 ], [ 80.0, 0.0 ], [ 81.0, 0.0008874243101015513 ], [ 82.0, 0.00044371215505077563 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0005916162067343675 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVMS2_R1", "pairs": [ [ 0.0, 0.0009105864783978541 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.00045529323919892706 ], [ 21.0, 0.00045529323919892706 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0009105864783978541 ], [ 25.0, 0.0 ], [ 26.0, 0.0009105864783978541 ], [ 27.0, 0.002276466195994635 ], [ 28.0, 0.001365879717596781 ], [ 29.0, 0.001365879717596781 ], [ 30.0, 0.002276466195994635 ], [ 31.0, 0.001365879717596781 ], [ 32.0, 0.002276466195994635 ], [ 33.0, 0.002731759435193562 ], [ 34.0, 0.0033388170874587985 ], [ 35.0, 0.002731759435193562 ], [ 36.0, 0.0036423459135914165 ], [ 37.0, 0.00455293239198927 ], [ 38.0, 0.003187052674392489 ], [ 39.0, 0.006981163001050216 ], [ 40.0, 0.008498807131713304 ], [ 41.0, 0.02246113313381374 ], [ 42.0, 0.035209343831383695 ], [ 43.0, 0.031111704678593356 ], [ 44.0, 0.02762112317806824 ], [ 45.0, 0.4296450533907244 ], [ 46.0, 1.0711532274220055 ], [ 47.0, 0.3133935129819286 ], [ 48.0, 0.6313399583558454 ], [ 49.0, 1.454965428066705 ], [ 50.0, 20.80234809899901 ], [ 51.0, 17.64064008158855 ], [ 52.0, 13.176945164482234 ], [ 53.0, 12.110344869452238 ], [ 54.0, 12.80436353040448 ], [ 55.0, 11.11006562293221 ], [ 56.0, 5.484158830564149 ], [ 57.0, 1.3578362037042682 ], [ 58.0, 0.699937473061817 ], [ 59.0, 0.3701534034687278 ], [ 60.0, 0.09060335460058647 ], [ 61.0, 0.032022291156991206 ], [ 62.0, 0.03945874739724034 ], [ 63.0, 0.03171876233085859 ], [ 64.0, 0.052206958094810296 ], [ 65.0, 0.026710536699670388 ], [ 66.0, 0.006070576522652361 ], [ 67.0, 0.007132927414116523 ], [ 68.0, 0.008195278305580688 ], [ 69.0, 0.01730114308955923 ], [ 70.0, 0.02777288759113455 ], [ 71.0, 0.02003290252475279 ], [ 72.0, 0.008195278305580688 ], [ 73.0, 0.0018211729567957082 ], [ 74.0, 0.00045529323919892706 ], [ 75.0, 0.002276466195994635 ], [ 76.0, 0.002731759435193562 ], [ 77.0, 0.0009105864783978541 ], [ 78.0, 0.0 ], [ 79.0, 0.00045529323919892706 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAFS1_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.0016848451244411298 ], [ 46.0, 0.0021443483401978017 ], [ 47.0, 0.0015316773858555727 ], [ 48.0, 0.002757019294540031 ], [ 49.0, 0.02588534782095918 ], [ 50.0, 1.5136035927024771 ], [ 51.0, 1.1002038662600577 ], [ 52.0, 0.14872587416657607 ], [ 53.0, 0.6575491017477969 ], [ 54.0, 25.441927217754017 ], [ 55.0, 62.983799448289744 ], [ 56.0, 7.6447550005437614 ], [ 57.0, 0.34003237965993727 ], [ 58.0, 0.08669294003942542 ], [ 59.0, 0.03002087676276923 ], [ 60.0, 0.00964956753089011 ], [ 61.0, 0.005207703111908947 ], [ 62.0, 0.0024506838173689164 ], [ 63.0, 0.0 ], [ 64.0, 0.0004595032157566718 ], [ 65.0, 0.0 ], [ 66.0, 0.0 ], [ 67.0, 0.0004595032157566718 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0004595032157566718 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAFS2_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0005624739855781679 ], [ 44.0, 0.0005624739855781679 ], [ 45.0, 0.0005624739855781679 ], [ 46.0, 0.0013124392996823914 ], [ 47.0, 0.0013124392996823914 ], [ 48.0, 0.004499791884625343 ], [ 49.0, 0.031123560535325286 ], [ 50.0, 1.541366211812706 ], [ 51.0, 1.1568214970057649 ], [ 52.0, 0.07855886665241743 ], [ 53.0, 0.49910191653636093 ], [ 54.0, 36.43556485512554 ], [ 55.0, 57.19497973218728 ], [ 56.0, 2.7096246798585626 ], [ 57.0, 0.24130133981303392 ], [ 58.0, 0.06730938694085407 ], [ 59.0, 0.020999028794918266 ], [ 60.0, 0.008624601112198572 ], [ 61.0, 0.0016874219567345036 ], [ 62.0, 0.0 ], [ 63.0, 0.0013124392996823914 ], [ 64.0, 0.0022498959423126715 ], [ 65.0, 0.0 ], [ 66.0, 0.0 ], [ 67.0, 0.0005624739855781679 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAMS1_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0004873611020859066 ], [ 42.0, 0.0004873611020859066 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.004386249918773159 ], [ 46.0, 0.009584768341022827 ], [ 47.0, 0.0009747222041718132 ], [ 48.0, 0.004386249918773159 ], [ 49.0, 0.020956527389693985 ], [ 50.0, 0.6590746637208408 ], [ 51.0, 0.5060432776658663 ], [ 52.0, 0.11420495158879747 ], [ 53.0, 0.6762947559945429 ], [ 54.0, 31.272824744947798 ], [ 55.0, 60.845896419520294 ], [ 56.0, 5.4620183247774525 ], [ 57.0, 0.29647800376892647 ], [ 58.0, 0.081714211449737 ], [ 59.0, 0.030703749431412113 ], [ 60.0, 0.009422314640327528 ], [ 61.0, 0.0021118981090389286 ], [ 62.0, 0.0 ], [ 63.0, 0.0006498148027812088 ], [ 64.0, 0.0006498148027812088 ], [ 65.0, 0.0006498148027812088 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAMS2_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0009777050654899448 ], [ 45.0, 0.0032590168849664825 ], [ 46.0, 0.007006886302677939 ], [ 47.0, 0.0009777050654899448 ], [ 48.0, 0.008799345589409504 ], [ 49.0, 0.2462187256592178 ], [ 50.0, 1.9528029174719173 ], [ 51.0, 1.0435372065662678 ], [ 52.0, 0.5669059871399197 ], [ 53.0, 2.9948735664399493 ], [ 54.0, 31.079940425171387 ], [ 55.0, 49.17400217050519 ], [ 56.0, 9.040349888052779 ], [ 57.0, 2.707591228030153 ], [ 58.0, 1.049077535270711 ], [ 59.0, 0.05719574633116178 ], [ 60.0, 0.019391150465550577 ], [ 61.0, 0.00586623039293967 ], [ 62.0, 0.0019554101309798896 ], [ 63.0, 0.0026072135079731862 ], [ 64.0, 0.031775414628423204 ], [ 65.0, 0.004399672794704752 ], [ 66.0, 0.0004888525327449724 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICFS1_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0010937448730709049 ], [ 22.0, 0.0016406173096063577 ], [ 23.0, 0.0010937448730709049 ], [ 24.0, 0.0010937448730709049 ], [ 25.0, 0.0029166529948557464 ], [ 26.0, 0.0034635254313911995 ], [ 27.0, 0.003828107055748168 ], [ 28.0, 0.007109341674960882 ], [ 29.0, 0.005468724365354525 ], [ 30.0, 0.0021874897461418097 ], [ 31.0, 0.005468724365354525 ], [ 32.0, 0.003828107055748168 ], [ 33.0, 0.0043749794922836194 ], [ 34.0, 0.008385377360210272 ], [ 35.0, 0.006744760050603915 ], [ 36.0, 0.0049218519288190725 ], [ 37.0, 0.005104142740997557 ], [ 38.0, 0.0049218519288190725 ], [ 39.0, 0.007109341674960882 ], [ 40.0, 0.007656214111496336 ], [ 41.0, 0.0032812346192127155 ], [ 42.0, 0.013124938476850862 ], [ 43.0, 0.018958244466562357 ], [ 44.0, 0.02552071370498778 ], [ 45.0, 0.05341120796829585 ], [ 46.0, 0.06635385563296822 ], [ 47.0, 0.08020795735853302 ], [ 48.0, 0.1261452420275111 ], [ 49.0, 0.5171590341503598 ], [ 50.0, 8.239180128843136 ], [ 51.0, 9.564798915005085 ], [ 52.0, 31.282197114701127 ], [ 53.0, 9.967843900731694 ], [ 54.0, 10.722163281526251 ], [ 55.0, 21.16250496742459 ], [ 56.0, 6.079216295340275 ], [ 57.0, 1.300462654081306 ], [ 58.0, 0.29239446273428854 ], [ 59.0, 0.15622322603696095 ], [ 60.0, 0.1062755435000563 ], [ 61.0, 0.056510151775330086 ], [ 62.0, 0.035728999186982906 ], [ 63.0, 0.018229081217848414 ], [ 64.0, 0.012031193603779954 ], [ 65.0, 0.007656214111496336 ], [ 66.0, 0.0023697805583202942 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0005468724365354524 ], [ 70.0, 0.0005468724365354524 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0005468724365354524 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICFS2_R1", "pairs": [ [ 0.0, 0.0008752824609441675 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.00043764123047208375 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0008752824609441675 ], [ 26.0, 0.0008752824609441675 ], [ 27.0, 0.001750564921888335 ], [ 28.0, 0.0032093690234619473 ], [ 29.0, 0.002188206152360419 ], [ 30.0, 0.0030634886133045864 ], [ 31.0, 0.0039387710742487545 ], [ 32.0, 0.001750564921888335 ], [ 33.0, 0.002625847382832503 ], [ 34.0, 0.004376412304720838 ], [ 35.0, 0.004959933945350283 ], [ 36.0, 0.004084651484406115 ], [ 37.0, 0.006272857636766533 ], [ 38.0, 0.002188206152360419 ], [ 39.0, 0.0030634886133045864 ], [ 40.0, 0.0030634886133045864 ], [ 41.0, 0.00350112984377667 ], [ 42.0, 0.007877542148497509 ], [ 43.0, 0.014150399785264042 ], [ 44.0, 0.01633860593762446 ], [ 45.0, 0.03165604900414739 ], [ 46.0, 0.14179575867295513 ], [ 47.0, 0.14967330082145267 ], [ 48.0, 0.5591596121331657 ], [ 49.0, 1.841302537006214 ], [ 50.0, 4.357301970990224 ], [ 51.0, 5.369566137072155 ], [ 52.0, 12.091006035072542 ], [ 53.0, 12.574891355564516 ], [ 54.0, 19.34301298481533 ], [ 55.0, 25.26254826818074 ], [ 56.0, 12.400856026246796 ], [ 57.0, 4.8567964953690295 ], [ 58.0, 0.623930514243034 ], [ 59.0, 0.16528250470829026 ], [ 60.0, 0.058060403242629795 ], [ 61.0, 0.02567495218769558 ], [ 62.0, 0.014879801836050848 ], [ 63.0, 0.007148140097710701 ], [ 64.0, 0.01706800798841127 ], [ 65.0, 0.01152455240243154 ], [ 66.0, 0.0010211628711015287 ], [ 67.0, 0.0008752824609441675 ], [ 68.0, 0.0008752824609441675 ], [ 69.0, 0.0008752824609441675 ], [ 70.0, 0.0008752824609441675 ], [ 71.0, 0.00043764123047208375 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.00043764123047208375 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICMS1_R1", "pairs": [ [ 0.0, 0.0015698381758480426 ], [ 1.0, 0.0007849190879240213 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.00039245954396201064 ], [ 23.0, 0.0007849190879240213 ], [ 24.0, 0.00039245954396201064 ], [ 25.0, 0.0013081984798733687 ], [ 26.0, 0.0015698381758480426 ], [ 27.0, 0.0007849190879240213 ], [ 28.0, 0.0015698381758480426 ], [ 29.0, 0.003139676351696085 ], [ 30.0, 0.002354757263772064 ], [ 31.0, 0.0019622977198100536 ], [ 32.0, 0.0007849190879240213 ], [ 33.0, 0.003924595439620107 ], [ 34.0, 0.003532135895658096 ], [ 35.0, 0.0027472168077340747 ], [ 36.0, 0.0015698381758480426 ], [ 37.0, 0.0015698381758480426 ], [ 38.0, 0.003532135895658096 ], [ 39.0, 0.003924595439620107 ], [ 40.0, 0.0043170549835821175 ], [ 41.0, 0.0066718122473541815 ], [ 42.0, 0.010334767990999616 ], [ 43.0, 0.015175102366531081 ], [ 44.0, 0.015175102366531077 ], [ 45.0, 0.024070852029669985 ], [ 46.0, 0.03963841394016308 ], [ 47.0, 0.04055415287607443 ], [ 48.0, 0.07011943852121257 ], [ 49.0, 0.12833427087557747 ], [ 50.0, 2.947632814850673 ], [ 51.0, 3.7956070695045927 ], [ 52.0, 16.529741892439965 ], [ 53.0, 4.293245771248424 ], [ 54.0, 17.921534255177246 ], [ 55.0, 48.06543608796311 ], [ 56.0, 5.6847764942897445 ], [ 57.0, 0.22265538127444734 ], [ 58.0, 0.05860729189832693 ], [ 59.0, 0.0347980795646316 ], [ 60.0, 0.01988461689407521 ], [ 61.0, 0.013736084038670372 ], [ 62.0, 0.008241650423202225 ], [ 63.0, 0.0045786946795567905 ], [ 64.0, 0.002354757263772064 ], [ 65.0, 0.0015698381758480426 ], [ 66.0, 0.0 ], [ 67.0, 0.00039245954396201064 ], [ 68.0, 0.000915738935911358 ], [ 69.0, 0.0007849190879240213 ], [ 70.0, 0.00039245954396201064 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0005232793919493475 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICMS2_R1", "pairs": [ [ 0.0, 0.001222309594722883 ], [ 1.0, 0.0006111547973614415 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0006111547973614415 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0006111547973614415 ], [ 11.0, 0.0006111547973614415 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0006111547973614415 ], [ 18.0, 0.0006111547973614415 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0006111547973614415 ], [ 23.0, 0.0 ], [ 24.0, 0.0006111547973614415 ], [ 25.0, 0.0006111547973614415 ], [ 26.0, 0.0006111547973614415 ], [ 27.0, 0.001222309594722883 ], [ 28.0, 0.0018334643920843246 ], [ 29.0, 0.0018334643920843246 ], [ 30.0, 0.0018334643920843246 ], [ 31.0, 0.003666928784168649 ], [ 32.0, 0.0006111547973614415 ], [ 33.0, 0.0018334643920843246 ], [ 34.0, 0.002648337455232913 ], [ 35.0, 0.0030557739868072075 ], [ 36.0, 0.004889238378891532 ], [ 37.0, 0.00427808358153009 ], [ 38.0, 0.0030557739868072075 ], [ 39.0, 0.00427808358153009 ], [ 40.0, 0.008759885428847328 ], [ 41.0, 0.011815659415654538 ], [ 42.0, 0.01364912380773886 ], [ 43.0, 0.021594136173437598 ], [ 44.0, 0.01874208045241754 ], [ 45.0, 0.030150303336497784 ], [ 46.0, 0.03707672437326079 ], [ 47.0, 0.048077510725766735 ], [ 48.0, 0.08230217937800745 ], [ 49.0, 0.19292119770042837 ], [ 50.0, 5.320509947562923 ], [ 51.0, 4.625423224697172 ], [ 52.0, 1.8379461939316433 ], [ 53.0, 1.2954444521404684 ], [ 54.0, 15.64882230470549 ], [ 55.0, 59.9783243765202 ], [ 56.0, 10.20404421501243 ], [ 57.0, 0.33593142028300566 ], [ 58.0, 0.1173417210933968 ], [ 59.0, 0.04909610205470246 ], [ 60.0, 0.02750196588126487 ], [ 61.0, 0.016704897794546064 ], [ 62.0, 0.011204504618293094 ], [ 63.0, 0.010389631555144505 ], [ 64.0, 0.009574758491995917 ], [ 65.0, 0.002444619189445766 ], [ 66.0, 0.0018334643920843246 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPFS1_R1", "pairs": [ [ 0.0, 0.000985606854567142 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.000492803427283571 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.000492803427283571 ], [ 20.0, 0.000492803427283571 ], [ 21.0, 0.000985606854567142 ], [ 22.0, 0.000985606854567142 ], [ 23.0, 0.0014784102818507132 ], [ 24.0, 0.003449623990984998 ], [ 25.0, 0.0029568205637014264 ], [ 26.0, 0.0024640171364178555 ], [ 27.0, 0.0029568205637014264 ], [ 28.0, 0.003449623990984998 ], [ 29.0, 0.005092302081930234 ], [ 30.0, 0.004599498654646663 ], [ 31.0, 0.004928034272835711 ], [ 32.0, 0.007392051409253567 ], [ 33.0, 0.0054208377001192815 ], [ 34.0, 0.006899247981969996 ], [ 35.0, 0.0054208377001192815 ], [ 36.0, 0.003942427418268568 ], [ 37.0, 0.00443523084555214 ], [ 38.0, 0.0054208377001192815 ], [ 39.0, 0.006406444554686424 ], [ 40.0, 0.008377658263820708 ], [ 41.0, 0.00936326511838785 ], [ 42.0, 0.010841675400238563 ], [ 43.0, 0.014784102818507134 ], [ 44.0, 0.02808979535516355 ], [ 45.0, 0.033839168673471885 ], [ 46.0, 0.06012201812859566 ], [ 47.0, 0.061928964028635416 ], [ 48.0, 0.09149716966564972 ], [ 49.0, 0.15704002549436466 ], [ 50.0, 1.5975044434442447 ], [ 51.0, 6.840932909741476 ], [ 52.0, 61.26105111685665 ], [ 53.0, 17.111284869949188 ], [ 54.0, 6.074623580315491 ], [ 55.0, 5.563914961840615 ], [ 56.0, 0.6853252995423527 ], [ 57.0, 0.10168177382951019 ], [ 58.0, 0.07457758532891376 ], [ 59.0, 0.04648778997375021 ], [ 60.0, 0.02250468984594975 ], [ 61.0, 0.01724811995492499 ], [ 62.0, 0.016262513100357846 ], [ 63.0, 0.007063515791064519 ], [ 64.0, 0.00443523084555214 ], [ 65.0, 0.004599498654646663 ], [ 66.0, 0.0036138918000795206 ], [ 67.0, 0.0 ], [ 68.0, 0.001971213709134284 ], [ 69.0, 0.001971213709134284 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0029568205637014264 ], [ 76.0, 0.0024640171364178555 ], [ 77.0, 0.000492803427283571 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPFS2_R1", "pairs": [ [ 0.0, 0.0006680822587415777 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0006680822587415777 ], [ 24.0, 0.00033404112937078886 ], [ 25.0, 0.0010021233881123666 ], [ 26.0, 0.0013361645174831554 ], [ 27.0, 0.0011134704312359626 ], [ 28.0, 0.0014475115606067514 ], [ 29.0, 0.004342534681820254 ], [ 30.0, 0.0030063701643370994 ], [ 31.0, 0.0040084935524494665 ], [ 32.0, 0.002338287905595522 ], [ 33.0, 0.003340411293707888 ], [ 34.0, 0.001670205646853944 ], [ 35.0, 0.002338287905595522 ], [ 36.0, 0.0030063701643370994 ], [ 37.0, 0.004676575811191044 ], [ 38.0, 0.002672329034966311 ], [ 39.0, 0.003451758336831484 ], [ 40.0, 0.006458128501168584 ], [ 41.0, 0.007348904846157354 ], [ 42.0, 0.012136827700471992 ], [ 43.0, 0.0119141336142248 ], [ 44.0, 0.015477238994179882 ], [ 45.0, 0.02839349599651705 ], [ 46.0, 0.044538817249438506 ], [ 47.0, 0.08050391217836012 ], [ 48.0, 1.3624424196603242 ], [ 49.0, 2.479253262189993 ], [ 50.0, 2.766751327535118 ], [ 51.0, 3.940571856144074 ], [ 52.0, 8.748091790048454 ], [ 53.0, 18.517570006669715 ], [ 54.0, 26.147960177843487 ], [ 55.0, 22.423624279445466 ], [ 56.0, 10.203620337760109 ], [ 57.0, 2.1493319734147778 ], [ 58.0, 0.8457921395668372 ], [ 59.0, 0.09509037482755123 ], [ 60.0, 0.026945984435910297 ], [ 61.0, 0.014475115606067516 ], [ 62.0, 0.00623543441492139 ], [ 63.0, 0.004453881724943851 ], [ 64.0, 0.013807033347325939 ], [ 65.0, 0.00478792285431464 ], [ 66.0, 0.00033404112937078886 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.00033404112937078886 ], [ 70.0, 0.00033404112937078886 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPMS1_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0004512397812991187 ], [ 20.0, 0.00022561989064955935 ], [ 21.0, 0.00022561989064955935 ], [ 22.0, 0.0 ], [ 23.0, 0.0004512397812991187 ], [ 24.0, 0.0009024795625982374 ], [ 25.0, 0.0007520663021651977 ], [ 26.0, 0.0014289259741138759 ], [ 27.0, 0.003083471838877311 ], [ 28.0, 0.0021057856460625535 ], [ 29.0, 0.0029330585784442713 ], [ 30.0, 0.004061158031692069 ], [ 31.0, 0.0034595049899599105 ], [ 32.0, 0.0028578519482277518 ], [ 33.0, 0.0029330585784442713 ], [ 34.0, 0.0022561989064955935 ], [ 35.0, 0.0029330585784442713 ], [ 36.0, 0.0036099182503929496 ], [ 37.0, 0.0038355381410425087 ], [ 38.0, 0.0029330585784442713 ], [ 39.0, 0.003008265208660791 ], [ 40.0, 0.004061158031692069 ], [ 41.0, 0.009325622146848454 ], [ 42.0, 0.008272729323817176 ], [ 43.0, 0.014063639850489201 ], [ 44.0, 0.015793392345469153 ], [ 45.0, 0.017823971361315184 ], [ 46.0, 0.0627223296005775 ], [ 47.0, 0.06663307437183653 ], [ 48.0, 0.505990208096745 ], [ 49.0, 0.7061902577331209 ], [ 50.0, 2.7184188558063256 ], [ 51.0, 2.655019666533806 ], [ 52.0, 2.100370768686961 ], [ 53.0, 4.8776764159528225 ], [ 54.0, 13.719870343769514 ], [ 55.0, 57.65520768310937 ], [ 56.0, 13.770785232426094 ], [ 57.0, 0.6418885888979964 ], [ 58.0, 0.24306782885979203 ], [ 59.0, 0.07806448216474753 ], [ 60.0, 0.02338926199733765 ], [ 61.0, 0.012033060834643165 ], [ 62.0, 0.011055374641828408 ], [ 63.0, 0.007746282912301538 ], [ 64.0, 0.01654545864763435 ], [ 65.0, 0.012333887355509245 ], [ 66.0, 0.0012033060834643165 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPMS2_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0003129694541812714 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0003129694541812714 ], [ 12.0, 0.0003129694541812714 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0003129694541812714 ], [ 23.0, 0.0006259389083625428 ], [ 24.0, 0.0003129694541812714 ], [ 25.0, 0.0012518778167250855 ], [ 26.0, 0.0006259389083625428 ], [ 27.0, 0.0018778167250876284 ], [ 28.0, 0.002503755633450171 ], [ 29.0, 0.002503755633450171 ], [ 30.0, 0.001564847270906357 ], [ 31.0, 0.002503755633450171 ], [ 32.0, 0.0028167250876314424 ], [ 33.0, 0.002503755633450171 ], [ 34.0, 0.002295109330662657 ], [ 35.0, 0.003651310298781499 ], [ 36.0, 0.002295109330662657 ], [ 37.0, 0.0028167250876314424 ], [ 38.0, 0.005007511266900342 ], [ 39.0, 0.004485895509931557 ], [ 40.0, 0.0080328826573193 ], [ 41.0, 0.007511266900350514 ], [ 42.0, 0.014396594892338485 ], [ 43.0, 0.0197170756134201 ], [ 44.0, 0.019612752462026338 ], [ 45.0, 0.029940744450008296 ], [ 46.0, 0.03390502420297106 ], [ 47.0, 0.061237689868135436 ], [ 48.0, 0.21208896678350828 ], [ 49.0, 1.0344683692204957 ], [ 50.0, 3.530086796861954 ], [ 51.0, 5.2030128526122725 ], [ 52.0, 19.001314471707616 ], [ 53.0, 21.368198130529127 ], [ 54.0, 21.480241195126002 ], [ 55.0, 19.745347187447813 ], [ 56.0, 6.888666332832571 ], [ 57.0, 0.8116341178434304 ], [ 58.0, 0.3875605074278077 ], [ 59.0, 0.0593598731430478 ], [ 60.0, 0.017108996828576167 ], [ 61.0, 0.008450175262894327 ], [ 62.0, 0.005737773326656642 ], [ 63.0, 0.002608078784843928 ], [ 64.0, 0.004172926055750285 ], [ 65.0, 0.0021907861792688998 ], [ 66.0, 0.0007302620597562998 ], [ 67.0, 0.0011475546653313283 ], [ 68.0, 0.0003129694541812714 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0003129694541812714 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVFS1_R1", "pairs": [ [ 0.0, 0.0006791840283083899 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.000792381366359788 ], [ 22.0, 0.0 ], [ 23.0, 0.00033959201415419496 ], [ 24.0, 0.00033959201415419496 ], [ 25.0, 0.0013583680566167798 ], [ 26.0, 0.0030563281273877545 ], [ 27.0, 0.004075104169850339 ], [ 28.0, 0.0030563281273877545 ], [ 29.0, 0.00339592014154195 ], [ 30.0, 0.00475428819815873 ], [ 31.0, 0.003848709493747542 ], [ 32.0, 0.005207077550364323 ], [ 33.0, 0.0050938802123129245 ], [ 34.0, 0.0050938802123129245 ], [ 35.0, 0.004867485536210128 ], [ 36.0, 0.004075104169850339 ], [ 37.0, 0.0027167361132335597 ], [ 38.0, 0.0067918402830839 ], [ 39.0, 0.007471024311392289 ], [ 40.0, 0.008489800353854875 ], [ 41.0, 0.005773064240621314 ], [ 42.0, 0.008150208339700678 ], [ 43.0, 0.019017152792634922 ], [ 44.0, 0.025582598399616015 ], [ 45.0, 0.028638926527003776 ], [ 46.0, 0.034072398753470894 ], [ 47.0, 0.04165662040291458 ], [ 48.0, 0.08421881951024034 ], [ 49.0, 0.15372198507379892 ], [ 50.0, 0.8224918582814602 ], [ 51.0, 0.8990132588042057 ], [ 52.0, 7.631424939411106 ], [ 53.0, 16.42300939651109 ], [ 54.0, 9.388360823306867 ], [ 55.0, 52.82512256441775 ], [ 56.0, 11.168049372150957 ], [ 57.0, 0.2146221529454513 ], [ 58.0, 0.06361690398488586 ], [ 59.0, 0.034411990767625085 ], [ 60.0, 0.02184708624391988 ], [ 61.0, 0.011432931143191228 ], [ 62.0, 0.00803701100164928 ], [ 63.0, 0.005659866902569916 ], [ 64.0, 0.003169525465439153 ], [ 65.0, 0.0013583680566167798 ], [ 66.0, 0.00033959201415419496 ], [ 67.0, 0.0006791840283083899 ], [ 68.0, 0.0 ], [ 69.0, 0.0006791840283083899 ], [ 70.0, 0.00033959201415419496 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVFS2_R1", "pairs": [ [ 0.0, 0.002517802965132637 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0012589014825663185 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0006294507412831592 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0006294507412831592 ], [ 26.0, 0.0018883522238494778 ], [ 27.0, 0.0012589014825663185 ], [ 28.0, 0.0012589014825663185 ], [ 29.0, 0.0018883522238494778 ], [ 30.0, 0.0031472537064157965 ], [ 31.0, 0.004406155188982115 ], [ 32.0, 0.004406155188982115 ], [ 33.0, 0.0037767044476989557 ], [ 34.0, 0.005035605930265274 ], [ 35.0, 0.002517802965132637 ], [ 36.0, 0.002517802965132637 ], [ 37.0, 0.0031472537064157965 ], [ 38.0, 0.005035605930265274 ], [ 39.0, 0.005665056671548433 ], [ 40.0, 0.004406155188982115 ], [ 41.0, 0.008392676550442122 ], [ 42.0, 0.010281028774291602 ], [ 43.0, 0.02958418484030849 ], [ 44.0, 0.03881612904579484 ], [ 45.0, 0.05895855276685589 ], [ 46.0, 0.07742244117782854 ], [ 47.0, 0.0799402441429612 ], [ 48.0, 0.12463124677406558 ], [ 49.0, 0.19030394078127513 ], [ 50.0, 1.7922560773469172 ], [ 51.0, 7.717275905045323 ], [ 52.0, 70.4164446104328 ], [ 53.0, 15.764593815436683 ], [ 54.0, 0.9523589715614196 ], [ 55.0, 1.750712328422227 ], [ 56.0, 0.5136318048870581 ], [ 57.0, 0.09882376638145601 ], [ 58.0, 0.09420779427871283 ], [ 59.0, 0.08791328686588123 ], [ 60.0, 0.06819049697234224 ], [ 61.0, 0.03734741064946745 ], [ 62.0, 0.017204986928406354 ], [ 63.0, 0.006294507412831593 ], [ 64.0, 0.0012589014825663185 ], [ 65.0, 0.002937436792654743 ], [ 66.0, 0.002307986051371584 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0006294507412831592 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0006294507412831592 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0006294507412831592 ], [ 91.0, 0.0006294507412831592 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVMS1_R1", "pairs": [ [ 0.0, 0.0009692583558147441 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.00048462917790737203 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.00048462917790737203 ], [ 21.0, 0.00048462917790737203 ], [ 22.0, 0.00048462917790737203 ], [ 23.0, 0.00048462917790737203 ], [ 24.0, 0.0019385167116294881 ], [ 25.0, 0.001453887533722116 ], [ 26.0, 0.0019385167116294881 ], [ 27.0, 0.00048462917790737203 ], [ 28.0, 0.001453887533722116 ], [ 29.0, 0.0048462917790737196 ], [ 30.0, 0.006300179312795836 ], [ 31.0, 0.0019385167116294881 ], [ 32.0, 0.0048462917790737196 ], [ 33.0, 0.002907775067444232 ], [ 34.0, 0.003392404245351604 ], [ 35.0, 0.002907775067444232 ], [ 36.0, 0.0024231458895368598 ], [ 37.0, 0.003392404245351604 ], [ 38.0, 0.003392404245351604 ], [ 39.0, 0.009854126617449896 ], [ 40.0, 0.011146471091869557 ], [ 41.0, 0.011146471091869557 ], [ 42.0, 0.020839054650016998 ], [ 43.0, 0.030047009030257064 ], [ 44.0, 0.034408671631423415 ], [ 45.0, 0.05282458039190354 ], [ 46.0, 0.10015669676752363 ], [ 47.0, 0.11744180411288657 ], [ 48.0, 0.2224447926594837 ], [ 49.0, 0.526630373326011 ], [ 50.0, 13.19677560053634 ], [ 51.0, 11.668416716475766 ], [ 52.0, 16.99352212332196 ], [ 53.0, 15.67468458717666 ], [ 54.0, 6.945382291649861 ], [ 55.0, 26.848617999127722 ], [ 56.0, 6.522139476277418 ], [ 57.0, 0.38624945479217576 ], [ 58.0, 0.2736539424583627 ], [ 59.0, 0.1360192559326691 ], [ 60.0, 0.07188666138959354 ], [ 61.0, 0.03715490363956519 ], [ 62.0, 0.017769736523270307 ], [ 63.0, 0.01146955721047447 ], [ 64.0, 0.014861961455826076 ], [ 65.0, 0.011954186388381841 ], [ 66.0, 0.004361662601166348 ], [ 67.0, 0.0011308014151172013 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVMS2_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0007244784358993556 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0007244784358993556 ], [ 22.0, 0.0014489568717987113 ], [ 23.0, 0.0 ], [ 24.0, 0.0014489568717987113 ], [ 25.0, 0.0021734353076980667 ], [ 26.0, 0.0007244784358993556 ], [ 27.0, 0.0007244784358993556 ], [ 28.0, 0.0016904496837651627 ], [ 29.0, 0.0009659712478658075 ], [ 30.0, 0.0021734353076980667 ], [ 31.0, 0.0028979137435974226 ], [ 32.0, 0.005071349051295489 ], [ 33.0, 0.0021734353076980667 ], [ 34.0, 0.0021734353076980667 ], [ 35.0, 0.003622392179496778 ], [ 36.0, 0.005071349051295489 ], [ 37.0, 0.004346870615396133 ], [ 38.0, 0.005795827487194845 ], [ 39.0, 0.007244784358993556 ], [ 40.0, 0.007244784358993556 ], [ 41.0, 0.010625683726523883 ], [ 42.0, 0.011350162162423237 ], [ 43.0, 0.029462123059907128 ], [ 44.0, 0.04032929959839747 ], [ 45.0, 0.038638849914632296 ], [ 46.0, 0.06592753766684134 ], [ 47.0, 0.0731723220258349 ], [ 48.0, 0.130406118461884 ], [ 49.0, 0.2279692144963305 ], [ 50.0, 4.051041920737228 ], [ 51.0, 8.221622783397871 ], [ 52.0, 60.35484953790349 ], [ 53.0, 16.06216990951263 ], [ 54.0, 2.0384408258088205 ], [ 55.0, 6.376859192786126 ], [ 56.0, 1.8365528350048663 ], [ 57.0, 0.16807899712865051 ], [ 58.0, 0.08838636917972137 ], [ 59.0, 0.04878154801722328 ], [ 60.0, 0.020285396205181952 ], [ 61.0, 0.01738748246158453 ], [ 62.0, 0.013282104658154853 ], [ 63.0, 0.003622392179496778 ], [ 64.0, 0.004346870615396133 ], [ 65.0, 0.005795827487194845 ], [ 66.0, 0.0014489568717987113 ], [ 67.0, 0.0007244784358993556 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAFS1_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0005441752389382773 ], [ 41.0, 0.0005441752389382773 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.0012697422241893135 ], [ 46.0, 0.004534793657818977 ], [ 47.0, 0.007981236837761401 ], [ 48.0, 0.023399535274345924 ], [ 49.0, 0.369676378985403 ], [ 50.0, 16.060425218531662 ], [ 51.0, 11.26007404411083 ], [ 52.0, 0.6067553914161796 ], [ 53.0, 0.8547179086257208 ], [ 54.0, 25.389584123143223 ], [ 55.0, 40.619416535308886 ], [ 56.0, 4.278487120279034 ], [ 57.0, 0.368950812000152 ], [ 58.0, 0.0905144814100668 ], [ 59.0, 0.03791087497936666 ], [ 60.0, 0.009795154300888991 ], [ 61.0, 0.002358092702065868 ], [ 62.0, 0.003809226672567941 ], [ 63.0, 0.0016325257168148318 ], [ 64.0, 0.004897577150444496 ], [ 65.0, 0.0010883504778765546 ], [ 66.0, 0.0 ], [ 67.0, 0.0010883504778765546 ], [ 68.0, 0.0005441752389382773 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAFS2_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0008624531041124629 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.0011499374721499506 ], [ 46.0, 0.008049562305049652 ], [ 47.0, 0.008049562305049652 ], [ 48.0, 0.0255861087553364 ], [ 49.0, 0.3619428193591969 ], [ 50.0, 9.902111572683227 ], [ 51.0, 5.3273728241026825 ], [ 52.0, 0.3490060227975099 ], [ 53.0, 0.7701706219724295 ], [ 54.0, 28.885854331670664 ], [ 55.0, 47.84918570052764 ], [ 56.0, 5.737325532924129 ], [ 57.0, 0.5718064080265629 ], [ 58.0, 0.1017694662852706 ], [ 59.0, 0.04542253014992305 ], [ 60.0, 0.024148686915148963 ], [ 61.0, 0.01236182782561197 ], [ 62.0, 0.003737296784487339 ], [ 63.0, 0.0028748436803748764 ], [ 64.0, 0.006899624832899703 ], [ 65.0, 0.0017249062082249258 ], [ 66.0, 0.0017249062082249258 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0008624531041124629 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAMS1_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0004258732175431395 ], [ 45.0, 0.0004258732175431395 ], [ 46.0, 0.002271323826896744 ], [ 47.0, 0.000851746435086279 ], [ 48.0, 0.018454506093536046 ], [ 49.0, 0.46590529999219477 ], [ 50.0, 54.7498349741281 ], [ 51.0, 41.35654815561415 ], [ 52.0, 1.2402847672248045 ], [ 53.0, 0.3607146152590393 ], [ 54.0, 0.6606713181485904 ], [ 55.0, 0.9577888662545208 ], [ 56.0, 0.15473393570734068 ], [ 57.0, 0.017886675136811858 ], [ 58.0, 0.006388098263147092 ], [ 59.0, 0.002555239305258837 ], [ 60.0, 0.0004258732175431395 ], [ 61.0, 0.000851746435086279 ], [ 62.0, 0.000851746435086279 ], [ 63.0, 0.0004258732175431395 ], [ 64.0, 0.0004258732175431395 ], [ 65.0, 0.0004258732175431395 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0004258732175431395 ], [ 81.0, 0.0004258732175431395 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAMS2_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0031450447461241387 ], [ 32.0, 0.003774053695348966 ], [ 33.0, 0.0012580178984496555 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0009435134238372417 ], [ 42.0, 0.002830540271511725 ], [ 43.0, 0.002516035796899311 ], [ 44.0, 0.00518932383110483 ], [ 45.0, 0.02280157440940001 ], [ 46.0, 0.00833436857722897 ], [ 47.0, 0.010850404374128278 ], [ 48.0, 0.029563420613566906 ], [ 49.0, 0.4448665793392599 ], [ 50.0, 53.65053206294479 ], [ 51.0, 39.98845768578184 ], [ 52.0, 1.421245720773502 ], [ 53.0, 0.5695676035230813 ], [ 54.0, 0.8839148258981889 ], [ 55.0, 1.2911981205212655 ], [ 56.0, 0.40476725882617703 ], [ 57.0, 0.29940825983101815 ], [ 58.0, 0.23918065294274063 ], [ 59.0, 0.23131804107743015 ], [ 60.0, 0.18115457737675023 ], [ 61.0, 0.12391476299729116 ], [ 62.0, 0.08947652302723177 ], [ 63.0, 0.03947031156385794 ], [ 64.0, 0.028777159427035875 ], [ 65.0, 0.011636665560659315 ], [ 66.0, 0.00566108054302345 ], [ 67.0, 0.0037740536953489666 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.00047175671191862083 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCFS1_R1", "pairs": [ [ 0.0, 0.0008544513354362309 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0008544513354362309 ], [ 24.0, 0.00042722566771811544 ], [ 25.0, 0.0008544513354362309 ], [ 26.0, 0.0017089026708724617 ], [ 27.0, 0.002136128338590577 ], [ 28.0, 0.0025633540063086926 ], [ 29.0, 0.002990579674026808 ], [ 30.0, 0.00469948234489927 ], [ 31.0, 0.002990579674026808 ], [ 32.0, 0.0038450310094630385 ], [ 33.0, 0.005126708012617385 ], [ 34.0, 0.005126708012617385 ], [ 35.0, 0.0017089026708724617 ], [ 36.0, 0.004841890900805308 ], [ 37.0, 0.006408385015771731 ], [ 38.0, 0.006408385015771731 ], [ 39.0, 0.0038450310094630385 ], [ 40.0, 0.008117287686644192 ], [ 41.0, 0.007690062018926077 ], [ 42.0, 0.012531952919731384 ], [ 43.0, 0.019794789270939347 ], [ 44.0, 0.02335500316859031 ], [ 45.0, 0.03474768764107339 ], [ 46.0, 0.03845031009463039 ], [ 47.0, 0.050127811678925535 ], [ 48.0, 0.07761266296879098 ], [ 49.0, 0.11677501584295154 ], [ 50.0, 1.0908495382402552 ], [ 51.0, 7.506070164695513 ], [ 52.0, 71.88228508768812 ], [ 53.0, 15.73714228750856 ], [ 54.0, 0.9403236946475715 ], [ 55.0, 1.7473529809670925 ], [ 56.0, 0.4413241147528134 ], [ 57.0, 0.08444827365228082 ], [ 58.0, 0.04542832933402627 ], [ 59.0, 0.034320461973355275 ], [ 60.0, 0.017943478044160847 ], [ 61.0, 0.008829330466174385 ], [ 62.0, 0.0048418909008053086 ], [ 63.0, 0.002990579674026808 ], [ 64.0, 0.002136128338590577 ], [ 65.0, 0.002705762562214731 ], [ 66.0, 0.0017089026708724617 ], [ 67.0, 0.0009968598913422692 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0008544513354362309 ], [ 71.0, 0.0008544513354362309 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCFS2_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0007011676193781736 ], [ 21.0, 0.0007011676193781736 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0005258757145336302 ], [ 25.0, 0.0010517514290672603 ], [ 26.0, 0.0015776271436008906 ], [ 27.0, 0.0010517514290672603 ], [ 28.0, 0.002629378572668151 ], [ 29.0, 0.002629378572668151 ], [ 30.0, 0.003155254287201781 ], [ 31.0, 0.0010517514290672603 ], [ 32.0, 0.003155254287201781 ], [ 33.0, 0.002629378572668151 ], [ 34.0, 0.004207005716269041 ], [ 35.0, 0.003155254287201781 ], [ 36.0, 0.002629378572668151 ], [ 37.0, 0.002629378572668151 ], [ 38.0, 0.005784632859869932 ], [ 39.0, 0.007011676193781735 ], [ 40.0, 0.006485800479248105 ], [ 41.0, 0.005784632859869932 ], [ 42.0, 0.011919849529428948 ], [ 43.0, 0.014373936197252558 ], [ 44.0, 0.0226126557249461 ], [ 45.0, 0.034707797159219594 ], [ 46.0, 0.04294651668691313 ], [ 47.0, 0.06713679955546012 ], [ 48.0, 0.08659420099320443 ], [ 49.0, 0.13024188529949576 ], [ 50.0, 0.8943392985168596 ], [ 51.0, 8.065706417612024 ], [ 52.0, 71.70297838475508 ], [ 53.0, 16.211345943832942 ], [ 54.0, 0.754631650355759 ], [ 55.0, 1.2947060091817977 ], [ 56.0, 0.35391435588113324 ], [ 57.0, 0.0743237676540864 ], [ 58.0, 0.05434049050180845 ], [ 59.0, 0.04978290097585032 ], [ 60.0, 0.031026667157484183 ], [ 61.0, 0.018580941913521602 ], [ 62.0, 0.009465762861605342 ], [ 63.0, 0.007537551908315365 ], [ 64.0, 0.003155254287201781 ], [ 65.0, 0.0015776271436008906 ], [ 66.0, 0.0007011676193781736 ], [ 67.0, 0.0007011676193781736 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0010517514290672603 ], [ 71.0, 0.0010517514290672603 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCMS1_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0004933683076644792 ], [ 23.0, 0.0004933683076644792 ], [ 24.0, 0.0009867366153289584 ], [ 25.0, 0.0014801049229934374 ], [ 26.0, 0.0014801049229934374 ], [ 27.0, 0.0009867366153289584 ], [ 28.0, 0.0019734732306579167 ], [ 29.0, 0.0014801049229934374 ], [ 30.0, 0.002466841538322396 ], [ 31.0, 0.002960209845986875 ], [ 32.0, 0.0014801049229934374 ], [ 33.0, 0.0019734732306579167 ], [ 34.0, 0.0009867366153289584 ], [ 35.0, 0.0004933683076644792 ], [ 36.0, 0.00641378799963823 ], [ 37.0, 0.00592041969197375 ], [ 38.0, 0.0044403147689803125 ], [ 39.0, 0.005427051384309271 ], [ 40.0, 0.01052519056350889 ], [ 41.0, 0.01282757599927646 ], [ 42.0, 0.0149655053324892 ], [ 43.0, 0.020721468921908126 ], [ 44.0, 0.025326239793443266 ], [ 45.0, 0.04390977938213865 ], [ 46.0, 0.04522542820257726 ], [ 47.0, 0.0647957044066016 ], [ 48.0, 0.19356483270703065 ], [ 49.0, 0.3956813827469123 ], [ 50.0, 1.3227204328484683 ], [ 51.0, 6.703230740134766 ], [ 52.0, 62.328369499971046 ], [ 53.0, 16.85214574099812 ], [ 54.0, 5.0152533035119875 ], [ 55.0, 4.574346492562495 ], [ 56.0, 1.5166141777606097 ], [ 57.0, 0.3575275669541925 ], [ 58.0, 0.2129706528085002 ], [ 59.0, 0.1077187471734113 ], [ 60.0, 0.039798376818267985 ], [ 61.0, 0.022694942152566042 ], [ 62.0, 0.024668415383223966 ], [ 63.0, 0.01726789076825677 ], [ 64.0, 0.02105038112701778 ], [ 65.0, 0.01315648820438611 ], [ 66.0, 0.0009867366153289584 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCMS2_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.001231380500679313 ], [ 27.0, 0.0006156902503396565 ], [ 28.0, 0.0018470707510189692 ], [ 29.0, 0.0038993715854844903 ], [ 30.0, 0.004515061835824147 ], [ 31.0, 0.008414433421308638 ], [ 32.0, 0.011492884673006918 ], [ 33.0, 0.017649787176403482 ], [ 34.0, 0.006567362670289669 ], [ 35.0, 0.002052300834465521 ], [ 36.0, 0.0032836813351448343 ], [ 37.0, 0.008414433421308638 ], [ 38.0, 0.008824893588201741 ], [ 39.0, 0.006977822837182773 ], [ 40.0, 0.008209203337862084 ], [ 41.0, 0.007593513087522428 ], [ 42.0, 0.013339955424025888 ], [ 43.0, 0.013750415590918993 ], [ 44.0, 0.016828866842617276 ], [ 45.0, 0.0385832556879518 ], [ 46.0, 0.06752069745391565 ], [ 47.0, 0.11082424506113815 ], [ 48.0, 0.36161540703282485 ], [ 49.0, 0.6497584441917842 ], [ 50.0, 3.007031182658883 ], [ 51.0, 6.989726182022703 ], [ 52.0, 52.96105964396679 ], [ 53.0, 16.428873409979914 ], [ 54.0, 6.69891515377891 ], [ 55.0, 7.966005688977923 ], [ 56.0, 3.149460860570789 ], [ 57.0, 0.6604304085310048 ], [ 58.0, 0.3577160354473404 ], [ 59.0, 0.19476334919077792 ], [ 60.0, 0.07696128129245704 ], [ 61.0, 0.052538901362317335 ], [ 62.0, 0.032426353184555244 ], [ 63.0, 0.016007946508831066 ], [ 64.0, 0.018470707510189692 ], [ 65.0, 0.010466734255774159 ], [ 66.0, 0.001231380500679313 ], [ 67.0, 0.0 ], [ 68.0, 0.0008209203337862086 ], [ 69.0, 0.002052300834465521 ], [ 70.0, 0.001231380500679313 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPFS1_R1", "pairs": [ [ 0.0, 0.0013890528742976486 ], [ 1.0, 0.00034726321857441215 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.00034726321857441215 ], [ 11.0, 0.00034726321857441215 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.00034726321857441215 ], [ 22.0, 0.0006945264371488243 ], [ 23.0, 0.0006945264371488243 ], [ 24.0, 0.0010417896557232363 ], [ 25.0, 0.0006945264371488243 ], [ 26.0, 0.0015048072804891193 ], [ 27.0, 0.002893860154786768 ], [ 28.0, 0.0020835793114464727 ], [ 29.0, 0.0031253689671697092 ], [ 30.0, 0.0034726321857441217 ], [ 31.0, 0.005208948278616183 ], [ 32.0, 0.0031253689671697092 ], [ 33.0, 0.0049774394662332406 ], [ 34.0, 0.0031253689671697092 ], [ 35.0, 0.004167158622892945 ], [ 36.0, 0.002778105748595297 ], [ 37.0, 0.00486168506004177 ], [ 38.0, 0.002662351342403826 ], [ 39.0, 0.009260352495317656 ], [ 40.0, 0.010417896557232366 ], [ 41.0, 0.009376106901509128 ], [ 42.0, 0.010533650963423836 ], [ 43.0, 0.013543265524402074 ], [ 44.0, 0.01967824905255002 ], [ 45.0, 0.031832461702654434 ], [ 46.0, 0.04433393757133327 ], [ 47.0, 0.05683541344001212 ], [ 48.0, 0.07639790808637067 ], [ 49.0, 0.13311756712019132 ], [ 50.0, 2.095038997659426 ], [ 51.0, 7.342996511162098 ], [ 52.0, 72.3849343325256 ], [ 53.0, 15.307825692384894 ], [ 54.0, 0.8554250617549686 ], [ 55.0, 1.2962178405320897 ], [ 56.0, 0.12675107477966044 ], [ 57.0, 0.024887197331166205 ], [ 58.0, 0.027433794267378558 ], [ 59.0, 0.024771442924974737 ], [ 60.0, 0.018289196178252372 ], [ 61.0, 0.01308024789963619 ], [ 62.0, 0.005440457090999123 ], [ 63.0, 0.0038198954043185337 ], [ 64.0, 0.0024308425300208847 ], [ 65.0, 0.0013890528742976486 ], [ 66.0, 0.0006945264371488243 ], [ 67.0, 0.00034726321857441215 ], [ 68.0, 0.0 ], [ 69.0, 0.00046301762476588283 ], [ 70.0, 0.0006945264371488243 ], [ 71.0, 0.0006945264371488243 ], [ 72.0, 0.00046301762476588283 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.00034726321857441215 ], [ 87.0, 0.00034726321857441215 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPFS2_R1", "pairs": [ [ 0.0, 0.0007939280383626023 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.00039696401918130116 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0007939280383626023 ], [ 20.0, 0.0007939280383626023 ], [ 21.0, 0.00039696401918130116 ], [ 22.0, 0.0007939280383626023 ], [ 23.0, 0.00039696401918130116 ], [ 24.0, 0.0007939280383626023 ], [ 25.0, 0.0015878560767252047 ], [ 26.0, 0.0031757121534504093 ], [ 27.0, 0.0027787481342691077 ], [ 28.0, 0.001984820095906506 ], [ 29.0, 0.0035726761726317105 ], [ 30.0, 0.002381784115087807 ], [ 31.0, 0.00039696401918130116 ], [ 32.0, 0.0035726761726317105 ], [ 33.0, 0.001984820095906506 ], [ 34.0, 0.0015878560767252047 ], [ 35.0, 0.003969640191813012 ], [ 36.0, 0.004366604210994312 ], [ 37.0, 0.004366604210994312 ], [ 38.0, 0.004366604210994312 ], [ 39.0, 0.0060867816274466175 ], [ 40.0, 0.003969640191813012 ], [ 41.0, 0.0059544602877195174 ], [ 42.0, 0.009130172441169926 ], [ 43.0, 0.017466416843977248 ], [ 44.0, 0.019583558279610856 ], [ 45.0, 0.024876411868694874 ], [ 46.0, 0.040622651296219815 ], [ 47.0, 0.05742746144156156 ], [ 48.0, 0.07687869838144533 ], [ 49.0, 0.1524341833656196 ], [ 50.0, 3.8273947516063744 ], [ 51.0, 8.574819778335243 ], [ 52.0, 67.80066054812801 ], [ 53.0, 15.637074322250081 ], [ 54.0, 1.2665798638678052 ], [ 55.0, 2.0180327521780073 ], [ 56.0, 0.2508812601225824 ], [ 57.0, 0.04869425301957293 ], [ 58.0, 0.0359914044057713 ], [ 59.0, 0.026993553304328476 ], [ 60.0, 0.02328855579196967 ], [ 61.0, 0.013496776652164238 ], [ 62.0, 0.00727767368499052 ], [ 63.0, 0.004101961531540112 ], [ 64.0, 0.0027787481342691077 ], [ 65.0, 0.001852498756179405 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.00039696401918130116 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPMS1_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0003539012898522326 ], [ 3.0, 0.0003539012898522326 ], [ 4.0, 0.0 ], [ 5.0, 0.0003539012898522326 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0003539012898522326 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0003539012898522326 ], [ 22.0, 0.0003539012898522326 ], [ 23.0, 0.0003539012898522326 ], [ 24.0, 0.0007078025797044652 ], [ 25.0, 0.0014156051594089304 ], [ 26.0, 0.0010617038695566977 ], [ 27.0, 0.001769506449261163 ], [ 28.0, 0.0021234077391133954 ], [ 29.0, 0.001769506449261163 ], [ 30.0, 0.0021234077391133954 ], [ 31.0, 0.002831210318817861 ], [ 32.0, 0.003185111608670093 ], [ 33.0, 0.004010881284991968 ], [ 34.0, 0.003656979995139736 ], [ 35.0, 0.002831210318817861 ], [ 36.0, 0.0021234077391133954 ], [ 37.0, 0.0046007167680790235 ], [ 38.0, 0.005780387734253132 ], [ 39.0, 0.010735005792184386 ], [ 40.0, 0.00955533482601028 ], [ 41.0, 0.010263137405714743 ], [ 42.0, 0.015571656753498234 ], [ 43.0, 0.01769506449261163 ], [ 44.0, 0.023829353516716997 ], [ 45.0, 0.030789412217144235 ], [ 46.0, 0.11501791920197559 ], [ 47.0, 0.13578012820663987 ], [ 48.0, 1.1999613067923032 ], [ 49.0, 1.7086354274065791 ], [ 50.0, 24.28576821352998 ], [ 51.0, 22.374937182521272 ], [ 52.0, 28.26774755985045 ], [ 53.0, 9.71978095869494 ], [ 54.0, 4.572994500373932 ], [ 55.0, 4.666660375088159 ], [ 56.0, 1.887945414265043 ], [ 57.0, 0.4995906541747348 ], [ 58.0, 0.25174178418155485 ], [ 59.0, 0.08328477021189205 ], [ 60.0, 0.030553478023909415 ], [ 61.0, 0.013684183207619658 ], [ 62.0, 0.006960058700427239 ], [ 63.0, 0.007903795473366526 ], [ 64.0, 0.0038929141883745585 ], [ 65.0, 0.004246815478226791 ], [ 66.0, 0.0008257696763218759 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0003539012898522326 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0003539012898522326 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0004718683864696434 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPMS2_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0005705092365445402 ], [ 12.0, 0.0005705092365445402 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0005705092365445402 ], [ 25.0, 0.0017115277096336208 ], [ 26.0, 0.0011410184730890804 ], [ 27.0, 0.0011410184730890804 ], [ 28.0, 0.0011410184730890804 ], [ 29.0, 0.002852546182722701 ], [ 30.0, 0.002282036946178161 ], [ 31.0, 0.002852546182722701 ], [ 32.0, 0.005134583128900862 ], [ 33.0, 0.0017115277096336208 ], [ 34.0, 0.0005705092365445402 ], [ 35.0, 0.0017115277096336208 ], [ 36.0, 0.0017115277096336208 ], [ 37.0, 0.002852546182722701 ], [ 38.0, 0.004564073892356322 ], [ 39.0, 0.005705092365445402 ], [ 40.0, 0.008177299057138411 ], [ 41.0, 0.010459336003316572 ], [ 42.0, 0.012551203203979885 ], [ 43.0, 0.017115277096336208 ], [ 44.0, 0.02282036946178161 ], [ 45.0, 0.04012581630363267 ], [ 46.0, 0.09812758868566092 ], [ 47.0, 0.11885609094677922 ], [ 48.0, 0.5649943139246096 ], [ 49.0, 0.9985813336984599 ], [ 50.0, 18.43144190504439 ], [ 51.0, 18.321143452645728 ], [ 52.0, 41.01752224035186 ], [ 53.0, 10.715684820270589 ], [ 54.0, 3.4177306663928255 ], [ 55.0, 4.1525465630621925 ], [ 56.0, 1.3106498860883236 ], [ 57.0, 0.327662471522081 ], [ 58.0, 0.1732446381640254 ], [ 59.0, 0.08234349980792863 ], [ 60.0, 0.046401417905622605 ], [ 61.0, 0.03080749877340517 ], [ 62.0, 0.01635459811427682 ], [ 63.0, 0.009698657021257185 ], [ 64.0, 0.00874780829368295 ], [ 65.0, 0.005705092365445402 ], [ 66.0, 0.0 ], [ 67.0, 0.0005705092365445402 ], [ 68.0, 0.0 ], [ 69.0, 0.0005705092365445402 ], [ 70.0, 0.0005705092365445402 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVFS1_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0007249686451061004 ], [ 22.0, 0.0007249686451061004 ], [ 23.0, 0.0 ], [ 24.0, 0.0007249686451061004 ], [ 25.0, 0.0007249686451061004 ], [ 26.0, 0.0028998745804244015 ], [ 27.0, 0.0028998745804244015 ], [ 28.0, 0.0028998745804244015 ], [ 29.0, 0.005799749160848803 ], [ 30.0, 0.005799749160848803 ], [ 31.0, 0.005799749160848803 ], [ 32.0, 0.00821631131120247 ], [ 33.0, 0.005074780515742703 ], [ 34.0, 0.004349811870636602 ], [ 35.0, 0.0028998745804244015 ], [ 36.0, 0.003624843225530502 ], [ 37.0, 0.006524717805954903 ], [ 38.0, 0.006041405375884169 ], [ 39.0, 0.011599498321697606 ], [ 40.0, 0.012324466966803706 ], [ 41.0, 0.01594931019233421 ], [ 42.0, 0.013049435611909806 ], [ 43.0, 0.021024090708076912 ], [ 44.0, 0.03769836954551722 ], [ 45.0, 0.050989461372462394 ], [ 46.0, 0.05848080403855876 ], [ 47.0, 0.07612170773614052 ], [ 48.0, 0.09255433035854546 ], [ 49.0, 0.20444115791992032 ], [ 50.0, 3.8138183856881587 ], [ 51.0, 9.041083973118207 ], [ 52.0, 66.85105035873856 ], [ 53.0, 15.172385460995471 ], [ 54.0, 1.1937817022747115 ], [ 55.0, 2.1396241279231383 ], [ 56.0, 0.6495719060150661 ], [ 57.0, 0.15151844682717502 ], [ 58.0, 0.10004567302464185 ], [ 59.0, 0.07805495745642346 ], [ 60.0, 0.0604140537588417 ], [ 61.0, 0.03649008847034039 ], [ 62.0, 0.020540778278006176 ], [ 63.0, 0.013774404257015907 ], [ 64.0, 0.010391217246520772 ], [ 65.0, 0.003624843225530502 ], [ 66.0, 0.0007249686451061004 ], [ 67.0, 0.0 ], [ 68.0, 0.0009666248601414672 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0007249686451061004 ], [ 82.0, 0.0014499372902122007 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVFS2_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0005189198165099527 ], [ 19.0, 0.0 ], [ 20.0, 0.0005189198165099527 ], [ 21.0, 0.0005189198165099527 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0010378396330199054 ], [ 26.0, 0.002594599082549764 ], [ 27.0, 0.004151358532079622 ], [ 28.0, 0.0050162248929295425 ], [ 29.0, 0.003978385259909637 ], [ 30.0, 0.002594599082549764 ], [ 31.0, 0.004843251620759558 ], [ 32.0, 0.003632438715569669 ], [ 33.0, 0.002075679266039811 ], [ 34.0, 0.005189198165099528 ], [ 35.0, 0.0015567594495298582 ], [ 36.0, 0.003632438715569669 ], [ 37.0, 0.005189198165099528 ], [ 38.0, 0.003632438715569669 ], [ 39.0, 0.008129743791989259 ], [ 40.0, 0.007091904158969354 ], [ 41.0, 0.008302717064159243 ], [ 42.0, 0.00934055669717915 ], [ 43.0, 0.01141623596321896 ], [ 44.0, 0.02248652538209795 ], [ 45.0, 0.02629193736983761 ], [ 46.0, 0.0482595429354256 ], [ 47.0, 0.06936228214016368 ], [ 48.0, 0.11502722599303952 ], [ 49.0, 0.2968221350436929 ], [ 50.0, 3.1526108585701325 ], [ 51.0, 3.1545135645639997 ], [ 52.0, 8.110543758778418 ], [ 53.0, 10.884689097840587 ], [ 54.0, 9.99456863925386 ], [ 55.0, 52.49721513031804 ], [ 56.0, 11.104192180224306 ], [ 57.0, 0.2416436612214679 ], [ 58.0, 0.09409746006047143 ], [ 59.0, 0.04255142495381612 ], [ 60.0, 0.017643273761338393 ], [ 61.0, 0.009513529969349132 ], [ 62.0, 0.009859476513689102 ], [ 63.0, 0.006227037798119433 ], [ 64.0, 0.0032864921712297004 ], [ 65.0, 0.0012108129051898895 ], [ 66.0, 0.0012108129051898895 ], [ 67.0, 0.0 ], [ 68.0, 0.0006918930886799369 ], [ 69.0, 0.0 ], [ 70.0, 0.0005189198165099527 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVMS1_R1", "pairs": [ [ 0.0, 0.00045968346196808603 ], [ 1.0, 0.00045968346196808603 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.00022984173098404301 ], [ 10.0, 0.00022984173098404301 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.00022984173098404301 ], [ 14.0, 0.00022984173098404301 ], [ 15.0, 0.0 ], [ 16.0, 0.00022984173098404301 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.00022984173098404301 ], [ 24.0, 0.00022984173098404301 ], [ 25.0, 0.00045968346196808603 ], [ 26.0, 0.0012258225652482294 ], [ 27.0, 0.0014556642962322724 ], [ 28.0, 0.0029879425027925593 ], [ 29.0, 0.002604872951152488 ], [ 30.0, 0.002604872951152488 ], [ 31.0, 0.0018387338478723441 ], [ 32.0, 0.0020685755788563873 ], [ 33.0, 0.0022984173098404303 ], [ 34.0, 0.0034476259647606457 ], [ 35.0, 0.0027581007718085163 ], [ 36.0, 0.0036774676957446882 ], [ 37.0, 0.005746043274601076 ], [ 38.0, 0.005746043274601076 ], [ 39.0, 0.0073549353914893765 ], [ 40.0, 0.005746043274601076 ], [ 41.0, 0.007125093660505334 ], [ 42.0, 0.014250187321010669 ], [ 43.0, 0.013637276038386551 ], [ 44.0, 0.021375280981516004 ], [ 45.0, 0.028960058103989425 ], [ 46.0, 0.058379799669946955 ], [ 47.0, 0.07063802532242922 ], [ 48.0, 0.1756756963821369 ], [ 49.0, 0.3125847541382985 ], [ 50.0, 1.5025520093530131 ], [ 51.0, 6.899772150230543 ], [ 52.0, 64.05512830531586 ], [ 53.0, 16.175035204091774 ], [ 54.0, 3.0871575166673453 ], [ 55.0, 3.822957511457593 ], [ 56.0, 2.755266057126383 ], [ 57.0, 0.5212044319614815 ], [ 58.0, 0.20065183114906965 ], [ 59.0, 0.1087151387554523 ], [ 60.0, 0.04359331497664017 ], [ 61.0, 0.023597084381028414 ], [ 62.0, 0.013407434307402509 ], [ 63.0, 0.010342877894281937 ], [ 64.0, 0.013330820397074495 ], [ 65.0, 0.008121074494769521 ], [ 66.0, 0.0006129112826241147 ], [ 67.0, 0.00022984173098404301 ], [ 68.0, 0.00045968346196808603 ], [ 69.0, 0.00045968346196808603 ], [ 70.0, 0.00022984173098404301 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVMS2_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0013376524645131948 ], [ 26.0, 0.0026753049290263895 ], [ 27.0, 0.002006478696769792 ], [ 28.0, 0.0033441311612829867 ], [ 29.0, 0.004012957393539584 ], [ 30.0, 0.0006688262322565974 ], [ 31.0, 0.002006478696769792 ], [ 32.0, 0.0026753049290263895 ], [ 33.0, 0.009363567251592363 ], [ 34.0, 0.007357088554822571 ], [ 35.0, 0.0033441311612829867 ], [ 36.0, 0.0015605945419320604 ], [ 37.0, 0.004012957393539584 ], [ 38.0, 0.004012957393539584 ], [ 39.0, 0.009363567251592363 ], [ 40.0, 0.009363567251592363 ], [ 41.0, 0.013376524645131947 ], [ 42.0, 0.014045350877388542 ], [ 43.0, 0.013376524645131947 ], [ 44.0, 0.018058308270928126 ], [ 45.0, 0.03143483291606007 ], [ 46.0, 0.05885670843858057 ], [ 47.0, 0.08048208994821054 ], [ 48.0, 0.21402439432211115 ], [ 49.0, 0.46215892648930873 ], [ 50.0, 4.336892232029189 ], [ 51.0, 8.374819138239733 ], [ 52.0, 54.39652923773875 ], [ 53.0, 17.05061008099482 ], [ 54.0, 4.882208553395738 ], [ 55.0, 4.940842319756901 ], [ 56.0, 3.194982911489767 ], [ 57.0, 1.1472599303974829 ], [ 58.0, 0.4253734837151959 ], [ 59.0, 0.1466958869416137 ], [ 60.0, 0.045926067948286346 ], [ 61.0, 0.020510671122535653 ], [ 62.0, 0.0084717989419169 ], [ 63.0, 0.012707698412875348 ], [ 64.0, 0.018058308270928126 ], [ 65.0, 0.015383003341901737 ], [ 66.0, 0.005350609858052779 ], [ 67.0, 0.002898247006445255 ], [ 68.0, 0.0015605945419320604 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null } ] }, { "plot_id": "fastqc_per_sequence_gc_content_plot", "label": "Counts", "uid": "fastqc_per_sequence_gc_content_plot_Counts", "dconfig": { "name": "Counts", "ylab": "Count", "tt_suffix": "", "title": "FastQC: Per Sequence GC Content
Counts, 64 samples" }, "layout": { "title": { "text": "FastQC: Per Sequence GC Content
Counts, 64 samples" }, "xaxis": { "hoverformat": null, "ticksuffix": "%", "title": { "text": "% GC" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": 100 } }, "yaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "Count" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": null } } }, "trace_params": { "hovertemplate": "%{text}
%{x} GC: %{y}", "mode": "lines", "line": { "width": 2 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "n_samples": 64, "lines": [ { "name": "CAFS1_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.25 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.0 ], [ 46.0, 1.8333333333333333 ], [ 47.0, 20.916666666666668 ], [ 48.0, 105.25 ], [ 49.0, 750.3333333333334 ], [ 50.0, 1834.6666666666665 ], [ 51.0, 2247.6666666666665 ], [ 52.0, 2588.6666666666674 ], [ 53.0, 6438.333333333334 ], [ 54.0, 14820.750000000005 ], [ 55.0, 15622.916666666686 ], [ 56.0, 7274.583333333329 ], [ 57.0, 2214.8333333333335 ], [ 58.0, 740.1666666666666 ], [ 59.0, 77.5 ], [ 60.0, 8.0 ], [ 61.0, 5.0 ], [ 62.0, 2.75 ], [ 63.0, 4.25 ], [ 64.0, 20.0 ], [ 65.0, 1.5 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAFS2_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.25 ], [ 41.0, 0.25 ], [ 42.0, 0.0 ], [ 43.0, 0.5 ], [ 44.0, 0.25 ], [ 45.0, 0.0 ], [ 46.0, 2.75 ], [ 47.0, 16.25 ], [ 48.0, 114.75 ], [ 49.0, 833.3333333333334 ], [ 50.0, 1915.8333333333333 ], [ 51.0, 2336.083333333333 ], [ 52.0, 2507.916666666667 ], [ 53.0, 6049.999999999999 ], [ 54.0, 13662.166666666673 ], [ 55.0, 14418.250000000011 ], [ 56.0, 6356.916666666662 ], [ 57.0, 1762.9999999999998 ], [ 58.0, 605.8333333333333 ], [ 59.0, 64.83333333333333 ], [ 60.0, 8.0 ], [ 61.0, 5.0 ], [ 62.0, 4.25 ], [ 63.0, 2.0 ], [ 64.0, 15.5 ], [ 65.0, 1.0 ], [ 66.0, 0.0 ], [ 67.0, 0.25 ], [ 68.0, 0.25 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.25 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAMS1_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.25 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.0 ], [ 46.0, 0.25 ], [ 47.0, 44.0 ], [ 48.0, 274.9166666666667 ], [ 49.0, 1466.416666666667 ], [ 50.0, 2073.9999999999995 ], [ 51.0, 2160.25 ], [ 52.0, 2959.000000000001 ], [ 53.0, 5467.749999999999 ], [ 54.0, 12106.666666666668 ], [ 55.0, 12969.250000000007 ], [ 56.0, 7793.08333333333 ], [ 57.0, 1177.4166666666667 ], [ 58.0, 339.1666666666667 ], [ 59.0, 47.916666666666664 ], [ 60.0, 5.833333333333333 ], [ 61.0, 2.0 ], [ 62.0, 10.75 ], [ 63.0, 4.75 ], [ 64.0, 21.5 ], [ 65.0, 3.0 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.25 ], [ 74.0, 0.25 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAMS2_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.25 ], [ 44.0, 0.0 ], [ 45.0, 0.0 ], [ 46.0, 1.0 ], [ 47.0, 45.166666666666664 ], [ 48.0, 284.1666666666667 ], [ 49.0, 1639.9166666666663 ], [ 50.0, 2232.0 ], [ 51.0, 2416.3333333333335 ], [ 52.0, 3319.8333333333344 ], [ 53.0, 5798.416666666663 ], [ 54.0, 14031.166666666677 ], [ 55.0, 15736.416666666677 ], [ 56.0, 8624.916666666662 ], [ 57.0, 1234.2499999999998 ], [ 58.0, 372.33333333333326 ], [ 59.0, 42.33333333333334 ], [ 60.0, 7.583333333333333 ], [ 61.0, 2.5833333333333335 ], [ 62.0, 4.583333333333334 ], [ 63.0, 5.0 ], [ 64.0, 21.0 ], [ 65.0, 3.25 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCFS1_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.25 ], [ 25.0, 1.5 ], [ 26.0, 0.25 ], [ 27.0, 1.0 ], [ 28.0, 1.75 ], [ 29.0, 1.8333333333333333 ], [ 30.0, 3.4166666666666665 ], [ 31.0, 2.083333333333333 ], [ 32.0, 3.0 ], [ 33.0, 2.1666666666666665 ], [ 34.0, 2.0 ], [ 35.0, 2.75 ], [ 36.0, 1.25 ], [ 37.0, 1.5 ], [ 38.0, 3.5 ], [ 39.0, 3.416666666666667 ], [ 40.0, 5.25 ], [ 41.0, 6.5 ], [ 42.0, 8.75 ], [ 43.0, 11.5 ], [ 44.0, 12.833333333333334 ], [ 45.0, 18.666666666666664 ], [ 46.0, 311.83333333333337 ], [ 47.0, 303.1666666666667 ], [ 48.0, 2648.5000000000005 ], [ 49.0, 3256.000000000001 ], [ 50.0, 3255.3333333333353 ], [ 51.0, 4895.249999999999 ], [ 52.0, 6321.999999999994 ], [ 53.0, 9203.833333333327 ], [ 54.0, 17427.16666666668 ], [ 55.0, 15639.833333333348 ], [ 56.0, 6160.08333333333 ], [ 57.0, 1599.2499999999995 ], [ 58.0, 584.3333333333334 ], [ 59.0, 328.91666666666674 ], [ 60.0, 233.25 ], [ 61.0, 15.083333333333334 ], [ 62.0, 6.5 ], [ 63.0, 5.499999999999999 ], [ 64.0, 14.833333333333334 ], [ 65.0, 8.083333333333332 ], [ 66.0, 0.0 ], [ 67.0, 0.75 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.5 ], [ 76.0, 0.5 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.25 ], [ 88.0, 0.25 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCFS2_R1", "pairs": [ [ 0.0, 0.5 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.5 ], [ 24.0, 0.5 ], [ 25.0, 1.0 ], [ 26.0, 1.25 ], [ 27.0, 2.0 ], [ 28.0, 1.25 ], [ 29.0, 1.0 ], [ 30.0, 0.5 ], [ 31.0, 0.25 ], [ 32.0, 0.75 ], [ 33.0, 0.75 ], [ 34.0, 1.0 ], [ 35.0, 2.0 ], [ 36.0, 1.0 ], [ 37.0, 0.75 ], [ 38.0, 2.25 ], [ 39.0, 3.333333333333333 ], [ 40.0, 1.75 ], [ 41.0, 5.5 ], [ 42.0, 8.25 ], [ 43.0, 6.25 ], [ 44.0, 8.75 ], [ 45.0, 17.666666666666668 ], [ 46.0, 330.1666666666667 ], [ 47.0, 292.9166666666667 ], [ 48.0, 1989.249999999999 ], [ 49.0, 2661.0833333333335 ], [ 50.0, 2857.083333333335 ], [ 51.0, 4965.333333333332 ], [ 52.0, 6473.666666666656 ], [ 53.0, 8516.583333333312 ], [ 54.0, 16367.50000000006 ], [ 55.0, 14631.58333333336 ], [ 56.0, 5931.249999999998 ], [ 57.0, 1475.7499999999993 ], [ 58.0, 519.5 ], [ 59.0, 302.58333333333337 ], [ 60.0, 192.91666666666669 ], [ 61.0, 17.583333333333336 ], [ 62.0, 6.583333333333333 ], [ 63.0, 3.25 ], [ 64.0, 11.583333333333334 ], [ 65.0, 6.833333333333333 ], [ 66.0, 0.5 ], [ 67.0, 0.5 ], [ 68.0, 0.25 ], [ 69.0, 0.25 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.25 ], [ 75.0, 0.25 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.25 ], [ 82.0, 0.25 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCMS1_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.25 ], [ 9.0, 0.25 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.25 ], [ 24.0, 0.25 ], [ 25.0, 0.5 ], [ 26.0, 0.5 ], [ 27.0, 0.75 ], [ 28.0, 0.75 ], [ 29.0, 1.5 ], [ 30.0, 1.25 ], [ 31.0, 1.25 ], [ 32.0, 1.0 ], [ 33.0, 1.25 ], [ 34.0, 1.5 ], [ 35.0, 1.0 ], [ 36.0, 1.75 ], [ 37.0, 2.5 ], [ 38.0, 2.5833333333333335 ], [ 39.0, 2.9166666666666665 ], [ 40.0, 7.0 ], [ 41.0, 8.583333333333332 ], [ 42.0, 8.5 ], [ 43.0, 11.833333333333334 ], [ 44.0, 15.333333333333334 ], [ 45.0, 23.833333333333332 ], [ 46.0, 566.0 ], [ 47.0, 510.1666666666667 ], [ 48.0, 2396.666666666667 ], [ 49.0, 2605.4166666666674 ], [ 50.0, 1679.0833333333326 ], [ 51.0, 3419.083333333335 ], [ 52.0, 6162.33333333333 ], [ 53.0, 13260.833333333343 ], [ 54.0, 16795.916666666686 ], [ 55.0, 12015.500000000005 ], [ 56.0, 7485.166666666661 ], [ 57.0, 1889.4166666666656 ], [ 58.0, 545.4166666666665 ], [ 59.0, 219.25 ], [ 60.0, 188.08333333333331 ], [ 61.0, 19.25 ], [ 62.0, 5.583333333333334 ], [ 63.0, 5.499999999999999 ], [ 64.0, 12.416666666666666 ], [ 65.0, 5.333333333333334 ], [ 66.0, 0.25 ], [ 67.0, 0.0 ], [ 68.0, 0.25 ], [ 69.0, 0.25 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCMS2_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.25 ], [ 27.0, 0.75 ], [ 28.0, 1.0 ], [ 29.0, 0.5 ], [ 30.0, 0.75 ], [ 31.0, 1.0 ], [ 32.0, 1.25 ], [ 33.0, 1.25 ], [ 34.0, 1.0 ], [ 35.0, 1.0 ], [ 36.0, 2.0 ], [ 37.0, 2.25 ], [ 38.0, 2.0 ], [ 39.0, 3.1666666666666665 ], [ 40.0, 3.0 ], [ 41.0, 4.0 ], [ 42.0, 6.25 ], [ 43.0, 8.5 ], [ 44.0, 11.0 ], [ 45.0, 23.833333333333332 ], [ 46.0, 430.91666666666663 ], [ 47.0, 358.58333333333326 ], [ 48.0, 2207.8333333333335 ], [ 49.0, 2338.0 ], [ 50.0, 1479.083333333333 ], [ 51.0, 3209.583333333335 ], [ 52.0, 5808.166666666663 ], [ 53.0, 12278.083333333348 ], [ 54.0, 16251.500000000025 ], [ 55.0, 11539.833333333332 ], [ 56.0, 6894.08333333333 ], [ 57.0, 1626.999999999999 ], [ 58.0, 477.08333333333314 ], [ 59.0, 205.50000000000003 ], [ 60.0, 161.33333333333334 ], [ 61.0, 16.75 ], [ 62.0, 9.5 ], [ 63.0, 7.0 ], [ 64.0, 9.75 ], [ 65.0, 5.75 ], [ 66.0, 1.0833333333333333 ], [ 67.0, 0.5833333333333333 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPFS1_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.25 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.25 ], [ 24.0, 0.75 ], [ 25.0, 0.75 ], [ 26.0, 1.25 ], [ 27.0, 2.0 ], [ 28.0, 1.25 ], [ 29.0, 1.5 ], [ 30.0, 2.75 ], [ 31.0, 3.0 ], [ 32.0, 3.0 ], [ 33.0, 2.9166666666666665 ], [ 34.0, 2.1666666666666665 ], [ 35.0, 0.5833333333333333 ], [ 36.0, 1.5 ], [ 37.0, 2.25 ], [ 38.0, 1.25 ], [ 39.0, 4.083333333333333 ], [ 40.0, 3.5 ], [ 41.0, 3.5 ], [ 42.0, 3.083333333333333 ], [ 43.0, 7.583333333333333 ], [ 44.0, 12.0 ], [ 45.0, 21.583333333333332 ], [ 46.0, 23.833333333333332 ], [ 47.0, 27.749999999999993 ], [ 48.0, 28.916666666666664 ], [ 49.0, 84.5 ], [ 50.0, 2333.3333333333335 ], [ 51.0, 2075.9166666666624 ], [ 52.0, 2202.416666666664 ], [ 53.0, 5973.833333333328 ], [ 54.0, 15689.0833333334 ], [ 55.0, 20469.83333333328 ], [ 56.0, 1917.2499999999932 ], [ 57.0, 120.41666666666664 ], [ 58.0, 46.25 ], [ 59.0, 24.083333333333332 ], [ 60.0, 18.916666666666668 ], [ 61.0, 13.416666666666666 ], [ 62.0, 5.833333333333334 ], [ 63.0, 4.0 ], [ 64.0, 2.75 ], [ 65.0, 1.5833333333333333 ], [ 66.0, 0.5 ], [ 67.0, 0.25 ], [ 68.0, 0.25 ], [ 69.0, 0.3333333333333333 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPFS2_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.25 ], [ 22.0, 0.25 ], [ 23.0, 0.25 ], [ 24.0, 0.0 ], [ 25.0, 0.25 ], [ 26.0, 0.5 ], [ 27.0, 1.5 ], [ 28.0, 0.25 ], [ 29.0, 1.75 ], [ 30.0, 1.8333333333333333 ], [ 31.0, 2.5 ], [ 32.0, 2.5 ], [ 33.0, 3.0 ], [ 34.0, 2.5 ], [ 35.0, 2.75 ], [ 36.0, 1.75 ], [ 37.0, 1.0 ], [ 38.0, 1.75 ], [ 39.0, 3.583333333333333 ], [ 40.0, 4.333333333333333 ], [ 41.0, 9.5 ], [ 42.0, 9.5 ], [ 43.0, 10.75 ], [ 44.0, 11.5 ], [ 45.0, 17.5 ], [ 46.0, 27.0 ], [ 47.0, 46.833333333333336 ], [ 48.0, 834.6666666666667 ], [ 49.0, 1527.7499999999993 ], [ 50.0, 1755.4166666666663 ], [ 51.0, 2466.583333333333 ], [ 52.0, 5345.166666666668 ], [ 53.0, 12059.000000000018 ], [ 54.0, 15368.750000000042 ], [ 55.0, 12552.166666666677 ], [ 56.0, 5879.416666666665 ], [ 57.0, 1359.2499999999998 ], [ 58.0, 541.7499999999998 ], [ 59.0, 74.08333333333333 ], [ 60.0, 14.583333333333334 ], [ 61.0, 7.416666666666667 ], [ 62.0, 1.9166666666666665 ], [ 63.0, 1.8333333333333333 ], [ 64.0, 8.583333333333332 ], [ 65.0, 4.166666666666666 ], [ 66.0, 1.25 ], [ 67.0, 0.75 ], [ 68.0, 0.25 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPMS1_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.25 ], [ 19.0, 0.25 ], [ 20.0, 0.25 ], [ 21.0, 0.25 ], [ 22.0, 0.25 ], [ 23.0, 1.0 ], [ 24.0, 0.5 ], [ 25.0, 0.75 ], [ 26.0, 1.9166666666666665 ], [ 27.0, 0.75 ], [ 28.0, 0.5 ], [ 29.0, 1.0 ], [ 30.0, 1.5 ], [ 31.0, 0.75 ], [ 32.0, 1.75 ], [ 33.0, 1.0 ], [ 34.0, 1.25 ], [ 35.0, 1.0 ], [ 36.0, 1.5 ], [ 37.0, 2.25 ], [ 38.0, 2.75 ], [ 39.0, 3.75 ], [ 40.0, 5.25 ], [ 41.0, 3.5 ], [ 42.0, 5.75 ], [ 43.0, 13.0 ], [ 44.0, 18.0 ], [ 45.0, 27.583333333333332 ], [ 46.0, 64.5 ], [ 47.0, 99.74999999999999 ], [ 48.0, 1767.5833333333323 ], [ 49.0, 2374.7499999999995 ], [ 50.0, 2045.9999999999984 ], [ 51.0, 3826.5000000000027 ], [ 52.0, 7583.749999999992 ], [ 53.0, 14809.08333333337 ], [ 54.0, 18678.333333333343 ], [ 55.0, 14900.91666666668 ], [ 56.0, 7161.249999999997 ], [ 57.0, 1486.5833333333326 ], [ 58.0, 480.4166666666665 ], [ 59.0, 80.16666666666666 ], [ 60.0, 23.083333333333332 ], [ 61.0, 10.666666666666668 ], [ 62.0, 3.5 ], [ 63.0, 3.5 ], [ 64.0, 11.833333333333332 ], [ 65.0, 6.833333333333333 ], [ 66.0, 1.9166666666666665 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.25 ], [ 83.0, 0.25 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPMS2_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.25 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.25 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.25 ], [ 22.0, 0.5 ], [ 23.0, 0.25 ], [ 24.0, 0.0 ], [ 25.0, 0.5 ], [ 26.0, 1.0 ], [ 27.0, 1.75 ], [ 28.0, 3.0833333333333335 ], [ 29.0, 1.8333333333333333 ], [ 30.0, 0.5 ], [ 31.0, 0.5 ], [ 32.0, 0.25 ], [ 33.0, 0.5 ], [ 34.0, 1.5 ], [ 35.0, 1.5 ], [ 36.0, 2.0 ], [ 37.0, 1.75 ], [ 38.0, 2.25 ], [ 39.0, 2.5 ], [ 40.0, 2.25 ], [ 41.0, 5.75 ], [ 42.0, 5.75 ], [ 43.0, 10.25 ], [ 44.0, 13.75 ], [ 45.0, 25.5 ], [ 46.0, 41.916666666666664 ], [ 47.0, 80.08333333333333 ], [ 48.0, 1688.083333333333 ], [ 49.0, 2430.916666666667 ], [ 50.0, 2498.75 ], [ 51.0, 4150.750000000004 ], [ 52.0, 6177.416666666663 ], [ 53.0, 12828.41666666668 ], [ 54.0, 16334.250000000018 ], [ 55.0, 13726.250000000007 ], [ 56.0, 6331.916666666664 ], [ 57.0, 1321.6666666666663 ], [ 58.0, 566.8333333333333 ], [ 59.0, 90.58333333333334 ], [ 60.0, 14.333333333333334 ], [ 61.0, 6.0 ], [ 62.0, 5.25 ], [ 63.0, 3.083333333333333 ], [ 64.0, 13.083333333333332 ], [ 65.0, 6.583333333333333 ], [ 66.0, 1.0833333333333333 ], [ 67.0, 0.25 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.25 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVFS1_R1", "pairs": [ [ 0.0, 2.0 ], [ 1.0, 0.75 ], [ 2.0, 0.25 ], [ 3.0, 0.25 ], [ 4.0, 0.25 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.25 ], [ 21.0, 0.25 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.5833333333333333 ], [ 25.0, 0.8333333333333333 ], [ 26.0, 0.25 ], [ 27.0, 1.0 ], [ 28.0, 1.75 ], [ 29.0, 0.75 ], [ 30.0, 1.75 ], [ 31.0, 2.5 ], [ 32.0, 3.0 ], [ 33.0, 2.25 ], [ 34.0, 2.25 ], [ 35.0, 2.25 ], [ 36.0, 3.0 ], [ 37.0, 2.75 ], [ 38.0, 2.75 ], [ 39.0, 3.5 ], [ 40.0, 3.0 ], [ 41.0, 4.0 ], [ 42.0, 8.416666666666666 ], [ 43.0, 14.750000000000005 ], [ 44.0, 18.333333333333336 ], [ 45.0, 22.166666666666668 ], [ 46.0, 76.16666666666667 ], [ 47.0, 90.24999999999999 ], [ 48.0, 1670.0833333333328 ], [ 49.0, 2397.0 ], [ 50.0, 2494.833333333333 ], [ 51.0, 4377.333333333336 ], [ 52.0, 6000.666666666661 ], [ 53.0, 11110.25000000001 ], [ 54.0, 21731.91666666664 ], [ 55.0, 13560.750000000013 ], [ 56.0, 5602.666666666665 ], [ 57.0, 1960.9166666666658 ], [ 58.0, 1140.7500000000002 ], [ 59.0, 101.58333333333334 ], [ 60.0, 34.58333333333333 ], [ 61.0, 11.333333333333334 ], [ 62.0, 11.333333333333336 ], [ 63.0, 4.5 ], [ 64.0, 13.083333333333332 ], [ 65.0, 5.5 ], [ 66.0, 0.5833333333333333 ], [ 67.0, 0.6666666666666666 ], [ 68.0, 0.5833333333333333 ], [ 69.0, 0.25 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVFS2_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.3333333333333333 ], [ 22.0, 0.3333333333333333 ], [ 23.0, 0.75 ], [ 24.0, 0.5 ], [ 25.0, 1.0 ], [ 26.0, 1.0 ], [ 27.0, 1.0 ], [ 28.0, 0.75 ], [ 29.0, 1.0 ], [ 30.0, 1.0 ], [ 31.0, 2.0 ], [ 32.0, 3.4166666666666665 ], [ 33.0, 2.9166666666666665 ], [ 34.0, 2.25 ], [ 35.0, 1.75 ], [ 36.0, 1.0 ], [ 37.0, 0.5 ], [ 38.0, 2.75 ], [ 39.0, 3.083333333333333 ], [ 40.0, 4.0 ], [ 41.0, 4.0 ], [ 42.0, 6.0 ], [ 43.0, 5.833333333333333 ], [ 44.0, 13.0 ], [ 45.0, 21.25 ], [ 46.0, 74.75 ], [ 47.0, 104.24999999999997 ], [ 48.0, 2065.0833333333326 ], [ 49.0, 2740.416666666667 ], [ 50.0, 2692.416666666667 ], [ 51.0, 4276.750000000001 ], [ 52.0, 5545.333333333331 ], [ 53.0, 10309.166666666668 ], [ 54.0, 19455.75 ], [ 55.0, 12305.750000000007 ], [ 56.0, 5663.083333333333 ], [ 57.0, 1800.6666666666654 ], [ 58.0, 964.5000000000001 ], [ 59.0, 98.41666666666666 ], [ 60.0, 27.999999999999996 ], [ 61.0, 10.25 ], [ 62.0, 5.833333333333333 ], [ 63.0, 4.0 ], [ 64.0, 7.333333333333334 ], [ 65.0, 5.25 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.25 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVMS1_R1", "pairs": [ [ 0.0, 0.5 ], [ 1.0, 0.25 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.25 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 1.0 ], [ 23.0, 0.25 ], [ 24.0, 0.75 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.25 ], [ 28.0, 0.5 ], [ 29.0, 1.75 ], [ 30.0, 1.75 ], [ 31.0, 2.75 ], [ 32.0, 2.0 ], [ 33.0, 1.5 ], [ 34.0, 3.0 ], [ 35.0, 1.25 ], [ 36.0, 0.75 ], [ 37.0, 0.5 ], [ 38.0, 3.6666666666666665 ], [ 39.0, 5.75 ], [ 40.0, 4.083333333333334 ], [ 41.0, 5.75 ], [ 42.0, 9.833333333333332 ], [ 43.0, 14.000000000000002 ], [ 44.0, 21.999999999999996 ], [ 45.0, 28.166666666666664 ], [ 46.0, 215.33333333333331 ], [ 47.0, 270.91666666666674 ], [ 48.0, 7476.666666666661 ], [ 49.0, 6613.916666666666 ], [ 50.0, 1904.2499999999993 ], [ 51.0, 2743.1666666666674 ], [ 52.0, 4231.000000000001 ], [ 53.0, 8958.25 ], [ 54.0, 11854.666666666673 ], [ 55.0, 8564.249999999996 ], [ 56.0, 5380.583333333333 ], [ 57.0, 1865.9999999999995 ], [ 58.0, 980.8333333333335 ], [ 59.0, 181.75000000000003 ], [ 60.0, 81.75 ], [ 61.0, 13.333333333333336 ], [ 62.0, 5.75 ], [ 63.0, 3.5833333333333335 ], [ 64.0, 5.166666666666666 ], [ 65.0, 1.5833333333333333 ], [ 66.0, 0.3333333333333333 ], [ 67.0, 0.3333333333333333 ], [ 68.0, 0.25 ], [ 69.0, 0.25 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVMS2_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.25 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.25 ], [ 23.0, 0.0 ], [ 24.0, 0.25 ], [ 25.0, 1.0 ], [ 26.0, 1.25 ], [ 27.0, 1.0 ], [ 28.0, 0.75 ], [ 29.0, 0.75 ], [ 30.0, 0.5 ], [ 31.0, 2.25 ], [ 32.0, 2.0 ], [ 33.0, 1.25 ], [ 34.0, 1.75 ], [ 35.0, 1.5 ], [ 36.0, 3.083333333333333 ], [ 37.0, 2.5 ], [ 38.0, 3.0 ], [ 39.0, 6.25 ], [ 40.0, 6.5 ], [ 41.0, 6.0 ], [ 42.0, 9.25 ], [ 43.0, 13.666666666666666 ], [ 44.0, 22.166666666666668 ], [ 45.0, 30.333333333333332 ], [ 46.0, 312.5833333333333 ], [ 47.0, 366.6666666666665 ], [ 48.0, 8231.333333333325 ], [ 49.0, 7354.583333333331 ], [ 50.0, 2309.416666666666 ], [ 51.0, 3344.416666666669 ], [ 52.0, 5945.749999999996 ], [ 53.0, 11470.50000000001 ], [ 54.0, 14886.666666666693 ], [ 55.0, 11276.333333333336 ], [ 56.0, 6931.9166666666615 ], [ 57.0, 2240.6666666666656 ], [ 58.0, 1245.5833333333333 ], [ 59.0, 215.58333333333334 ], [ 60.0, 84.91666666666666 ], [ 61.0, 12.583333333333334 ], [ 62.0, 10.833333333333334 ], [ 63.0, 7.499999999999999 ], [ 64.0, 7.416666666666666 ], [ 65.0, 4.0 ], [ 66.0, 1.25 ], [ 67.0, 0.5833333333333333 ], [ 68.0, 0.25 ], [ 69.0, 0.0 ], [ 70.0, 0.25 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAFS1_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.25 ], [ 39.0, 0.3333333333333333 ], [ 40.0, 0.6666666666666666 ], [ 41.0, 0.3333333333333333 ], [ 42.0, 0.25 ], [ 43.0, 2.9166666666666665 ], [ 44.0, 3.8333333333333335 ], [ 45.0, 53.166666666666764 ], [ 46.0, 124.66666666666603 ], [ 47.0, 41.58333333333335 ], [ 48.0, 59.08333333333334 ], [ 49.0, 266.25 ], [ 50.0, 1153.5833333333335 ], [ 51.0, 988.0000000000005 ], [ 52.0, 572.1666666666667 ], [ 53.0, 1433.416666666667 ], [ 54.0, 9056.999999999995 ], [ 55.0, 13769.500000000042 ], [ 56.0, 3027.166666666671 ], [ 57.0, 356.8333333333333 ], [ 58.0, 90.25 ], [ 59.0, 31.333333333333332 ], [ 60.0, 9.500000000000002 ], [ 61.0, 3.6666666666666665 ], [ 62.0, 4.75 ], [ 63.0, 3.333333333333333 ], [ 64.0, 10.166666666666668 ], [ 65.0, 1.3333333333333333 ], [ 66.0, 0.3333333333333333 ], [ 67.0, 0.0 ], [ 68.0, 1.25 ], [ 69.0, 1.0 ], [ 70.0, 0.5 ], [ 71.0, 1.3333333333333333 ], [ 72.0, 0.5 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.25 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAFS2_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.6666666666666666 ], [ 41.0, 0.0 ], [ 42.0, 0.25 ], [ 43.0, 0.25 ], [ 44.0, 0.3333333333333333 ], [ 45.0, 17.250000000000007 ], [ 46.0, 52.50000000000009 ], [ 47.0, 77.33333333333334 ], [ 48.0, 60.833333333333336 ], [ 49.0, 136.25 ], [ 50.0, 517.8333333333333 ], [ 51.0, 423.75 ], [ 52.0, 340.50000000000006 ], [ 53.0, 1245.2499999999993 ], [ 54.0, 3686.166666666673 ], [ 55.0, 4834.833333333335 ], [ 56.0, 1252.8333333333337 ], [ 57.0, 225.4166666666667 ], [ 58.0, 50.583333333333336 ], [ 59.0, 20.083333333333332 ], [ 60.0, 4.666666666666667 ], [ 61.0, 4.416666666666667 ], [ 62.0, 3.75 ], [ 63.0, 6.083333333333333 ], [ 64.0, 4.333333333333334 ], [ 65.0, 2.833333333333333 ], [ 66.0, 1.0 ], [ 67.0, 1.0 ], [ 68.0, 0.75 ], [ 69.0, 1.0 ], [ 70.0, 2.0 ], [ 71.0, 1.5 ], [ 72.0, 0.25 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAMS1_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.5 ], [ 39.0, 0.25 ], [ 40.0, 0.0 ], [ 41.0, 0.3333333333333333 ], [ 42.0, 0.0 ], [ 43.0, 1.25 ], [ 44.0, 1.0 ], [ 45.0, 82.58333333333324 ], [ 46.0, 189.83333333333428 ], [ 47.0, 136.0833333333332 ], [ 48.0, 64.0 ], [ 49.0, 167.0 ], [ 50.0, 10337.833333333347 ], [ 51.0, 8063.416666666646 ], [ 52.0, 442.99999999999943 ], [ 53.0, 731.583333333334 ], [ 54.0, 901.2500000000006 ], [ 55.0, 921.0000000000001 ], [ 56.0, 353.08333333333337 ], [ 57.0, 71.58333333333334 ], [ 58.0, 20.583333333333332 ], [ 59.0, 11.166666666666668 ], [ 60.0, 5.583333333333333 ], [ 61.0, 5.166666666666666 ], [ 62.0, 6.666666666666666 ], [ 63.0, 5.75 ], [ 64.0, 6.166666666666666 ], [ 65.0, 1.9999999999999998 ], [ 66.0, 1.2499999999999998 ], [ 67.0, 0.25 ], [ 68.0, 24.75 ], [ 69.0, 40.75 ], [ 70.0, 1.0 ], [ 71.0, 0.0 ], [ 72.0, 1.0 ], [ 73.0, 1.0 ], [ 74.0, 0.5 ], [ 75.0, 0.5 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.25 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAMS2_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.25 ], [ 34.0, 0.25 ], [ 35.0, 0.0 ], [ 36.0, 0.3333333333333333 ], [ 37.0, 1.75 ], [ 38.0, 1.833333333333333 ], [ 39.0, 1.9999999999999998 ], [ 40.0, 3.666666666666667 ], [ 41.0, 0.6666666666666666 ], [ 42.0, 0.0 ], [ 43.0, 0.75 ], [ 44.0, 1.8333333333333333 ], [ 45.0, 100.58333333333302 ], [ 46.0, 218.16666666666845 ], [ 47.0, 36.91666666666666 ], [ 48.0, 16.75 ], [ 49.0, 156.16666666666669 ], [ 50.0, 14671.166666666702 ], [ 51.0, 11358.666666666673 ], [ 52.0, 412.4166666666663 ], [ 53.0, 328.0 ], [ 54.0, 450.3333333333332 ], [ 55.0, 714.1666666666667 ], [ 56.0, 333.1666666666667 ], [ 57.0, 97.33333333333333 ], [ 58.0, 13.333333333333334 ], [ 59.0, 6.083333333333333 ], [ 60.0, 4.75 ], [ 61.0, 2.0 ], [ 62.0, 0.5 ], [ 63.0, 0.75 ], [ 64.0, 2.0 ], [ 65.0, 0.0 ], [ 66.0, 0.5 ], [ 67.0, 1.0 ], [ 68.0, 0.5 ], [ 69.0, 3.25 ], [ 70.0, 3.25 ], [ 71.0, 1.0 ], [ 72.0, 1.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCFS1_R1", "pairs": [ [ 0.0, 3.0 ], [ 1.0, 1.5 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.25 ], [ 24.0, 1.0 ], [ 25.0, 0.75 ], [ 26.0, 1.75 ], [ 27.0, 1.5 ], [ 28.0, 1.0 ], [ 29.0, 0.75 ], [ 30.0, 2.5 ], [ 31.0, 2.0 ], [ 32.0, 3.833333333333333 ], [ 33.0, 2.9166666666666665 ], [ 34.0, 2.25 ], [ 35.0, 1.9166666666666665 ], [ 36.0, 2.5833333333333335 ], [ 37.0, 6.916666666666666 ], [ 38.0, 5.25 ], [ 39.0, 4.666666666666666 ], [ 40.0, 10.25 ], [ 41.0, 11.91666666666667 ], [ 42.0, 9.083333333333332 ], [ 43.0, 18.916666666666664 ], [ 44.0, 30.999999999999982 ], [ 45.0, 202.7500000000012 ], [ 46.0, 484.16666666665793 ], [ 47.0, 154.0 ], [ 48.0, 98.16666666666663 ], [ 49.0, 235.66666666666677 ], [ 50.0, 8640.41666666665 ], [ 51.0, 7612.749999999964 ], [ 52.0, 11150.083333333354 ], [ 53.0, 2761.0000000000036 ], [ 54.0, 2590.4166666666674 ], [ 55.0, 5647.749999999997 ], [ 56.0, 1146.5000000000005 ], [ 57.0, 175.66666666666674 ], [ 58.0, 82.3333333333333 ], [ 59.0, 51.50000000000003 ], [ 60.0, 29.749999999999993 ], [ 61.0, 16.75 ], [ 62.0, 10.083333333333334 ], [ 63.0, 6.749999999999999 ], [ 64.0, 7.666666666666665 ], [ 65.0, 5.083333333333334 ], [ 66.0, 5.5 ], [ 67.0, 6.5 ], [ 68.0, 6.833333333333333 ], [ 69.0, 9.333333333333336 ], [ 70.0, 12.833333333333332 ], [ 71.0, 8.75 ], [ 72.0, 1.5 ], [ 73.0, 1.0 ], [ 74.0, 2.5 ], [ 75.0, 1.75 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.25 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCFS2_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.3333333333333333 ], [ 23.0, 0.5833333333333333 ], [ 24.0, 0.0 ], [ 25.0, 1.0 ], [ 26.0, 1.0833333333333333 ], [ 27.0, 1.1666666666666665 ], [ 28.0, 0.0 ], [ 29.0, 1.3333333333333333 ], [ 30.0, 0.8333333333333333 ], [ 31.0, 1.25 ], [ 32.0, 0.25 ], [ 33.0, 0.25 ], [ 34.0, 0.75 ], [ 35.0, 1.0 ], [ 36.0, 1.2499999999999998 ], [ 37.0, 5.499999999999999 ], [ 38.0, 5.833333333333333 ], [ 39.0, 3.9166666666666665 ], [ 40.0, 14.583333333333341 ], [ 41.0, 11.500000000000002 ], [ 42.0, 5.166666666666667 ], [ 43.0, 11.833333333333334 ], [ 44.0, 32.91666666666664 ], [ 45.0, 395.41666666666185 ], [ 46.0, 918.5000000000324 ], [ 47.0, 257.1666666666685 ], [ 48.0, 106.49999999999996 ], [ 49.0, 180.75 ], [ 50.0, 3958.1666666666742 ], [ 51.0, 3788.0000000000146 ], [ 52.0, 7718.99999999998 ], [ 53.0, 1842.0833333333305 ], [ 54.0, 1316.3333333333335 ], [ 55.0, 2793.083333333335 ], [ 56.0, 597.333333333333 ], [ 57.0, 121.24999999999994 ], [ 58.0, 51.83333333333334 ], [ 59.0, 43.75000000000001 ], [ 60.0, 27.58333333333333 ], [ 61.0, 17.16666666666667 ], [ 62.0, 10.083333333333332 ], [ 63.0, 10.833333333333334 ], [ 64.0, 12.083333333333336 ], [ 65.0, 11.166666666666668 ], [ 66.0, 6.249999999999998 ], [ 67.0, 11.666666666666668 ], [ 68.0, 14.583333333333332 ], [ 69.0, 10.583333333333334 ], [ 70.0, 15.0 ], [ 71.0, 14.25 ], [ 72.0, 5.0 ], [ 73.0, 2.25 ], [ 74.0, 0.25 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.5 ], [ 80.0, 0.5 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.25 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCMS1_R1", "pairs": [ [ 0.0, 0.5 ], [ 1.0, 0.25 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.25 ], [ 21.0, 0.25 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.25 ], [ 25.0, 1.25 ], [ 26.0, 2.0 ], [ 27.0, 2.333333333333333 ], [ 28.0, 1.5 ], [ 29.0, 3.25 ], [ 30.0, 2.25 ], [ 31.0, 2.75 ], [ 32.0, 3.5 ], [ 33.0, 3.0 ], [ 34.0, 2.0 ], [ 35.0, 3.75 ], [ 36.0, 3.0 ], [ 37.0, 4.583333333333333 ], [ 38.0, 5.416666666666666 ], [ 39.0, 7.75 ], [ 40.0, 6.5 ], [ 41.0, 6.833333333333333 ], [ 42.0, 11.916666666666666 ], [ 43.0, 21.41666666666666 ], [ 44.0, 28.499999999999986 ], [ 45.0, 174.75000000000045 ], [ 46.0, 395.6666666666624 ], [ 47.0, 149.33333333333323 ], [ 48.0, 191.1666666666668 ], [ 49.0, 489.9999999999995 ], [ 50.0, 15641.000000000085 ], [ 51.0, 13966.75000000011 ], [ 52.0, 18798.000000000007 ], [ 53.0, 5814.083333333325 ], [ 54.0, 7546.916666666659 ], [ 55.0, 14628.416666666682 ], [ 56.0, 2353.666666666665 ], [ 57.0, 367.41666666666646 ], [ 58.0, 196.66666666666666 ], [ 59.0, 105.08333333333333 ], [ 60.0, 43.833333333333336 ], [ 61.0, 20.166666666666664 ], [ 62.0, 13.166666666666668 ], [ 63.0, 15.833333333333332 ], [ 64.0, 10.083333333333334 ], [ 65.0, 11.75 ], [ 66.0, 5.5 ], [ 67.0, 2.0 ], [ 68.0, 1.5 ], [ 69.0, 4.5 ], [ 70.0, 5.0 ], [ 71.0, 3.0 ], [ 72.0, 1.5 ], [ 73.0, 0.5 ], [ 74.0, 0.0 ], [ 75.0, 0.5 ], [ 76.0, 1.0 ], [ 77.0, 0.5 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.25 ], [ 83.0, 0.5 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCMS2_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.25 ], [ 25.0, 0.5 ], [ 26.0, 0.25 ], [ 27.0, 0.5 ], [ 28.0, 0.5 ], [ 29.0, 1.0 ], [ 30.0, 1.0 ], [ 31.0, 0.75 ], [ 32.0, 0.75 ], [ 33.0, 1.25 ], [ 34.0, 0.5 ], [ 35.0, 2.25 ], [ 36.0, 1.9999999999999998 ], [ 37.0, 4.666666666666666 ], [ 38.0, 6.249999999999999 ], [ 39.0, 6.999999999999999 ], [ 40.0, 16.666666666666668 ], [ 41.0, 9.75 ], [ 42.0, 7.666666666666666 ], [ 43.0, 18.833333333333332 ], [ 44.0, 31.24999999999997 ], [ 45.0, 515.5833333333227 ], [ 46.0, 1162.583333333347 ], [ 47.0, 319.41666666666595 ], [ 48.0, 200.16666666666686 ], [ 49.0, 301.3333333333334 ], [ 50.0, 5019.749999999998 ], [ 51.0, 4623.500000000001 ], [ 52.0, 7909.749999999971 ], [ 53.0, 2282.583333333333 ], [ 54.0, 2948.5000000000014 ], [ 55.0, 5611.33333333333 ], [ 56.0, 938.6666666666675 ], [ 57.0, 194.58333333333337 ], [ 58.0, 126.83333333333331 ], [ 59.0, 83.83333333333333 ], [ 60.0, 47.08333333333333 ], [ 61.0, 23.666666666666664 ], [ 62.0, 15.083333333333334 ], [ 63.0, 16.833333333333332 ], [ 64.0, 15.166666666666671 ], [ 65.0, 11.583333333333334 ], [ 66.0, 7.666666666666666 ], [ 67.0, 9.75 ], [ 68.0, 12.083333333333332 ], [ 69.0, 13.583333333333334 ], [ 70.0, 17.833333333333336 ], [ 71.0, 15.0 ], [ 72.0, 9.25 ], [ 73.0, 3.75 ], [ 74.0, 1.0 ], [ 75.0, 0.5 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPFS1_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.25 ], [ 11.0, 0.25 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.25 ], [ 21.0, 0.5 ], [ 22.0, 0.5 ], [ 23.0, 0.0 ], [ 24.0, 0.75 ], [ 25.0, 0.75 ], [ 26.0, 0.5 ], [ 27.0, 1.5 ], [ 28.0, 1.75 ], [ 29.0, 1.75 ], [ 30.0, 1.5 ], [ 31.0, 1.0 ], [ 32.0, 2.5 ], [ 33.0, 1.25 ], [ 34.0, 1.0 ], [ 35.0, 2.5 ], [ 36.0, 2.25 ], [ 37.0, 3.0 ], [ 38.0, 4.5 ], [ 39.0, 5.166666666666667 ], [ 40.0, 5.0 ], [ 41.0, 5.75 ], [ 42.0, 7.25 ], [ 43.0, 8.833333333333332 ], [ 44.0, 12.666666666666668 ], [ 45.0, 88.41666666666654 ], [ 46.0, 206.0833333333345 ], [ 47.0, 82.5833333333333 ], [ 48.0, 75.16666666666666 ], [ 49.0, 213.83333333333357 ], [ 50.0, 7880.333333333305 ], [ 51.0, 7254.416666666627 ], [ 52.0, 12076.250000000025 ], [ 53.0, 3166.3333333333358 ], [ 54.0, 4898.666666666669 ], [ 55.0, 10050.083333333336 ], [ 56.0, 1020.8333333333353 ], [ 57.0, 143.66666666666663 ], [ 58.0, 75.33333333333331 ], [ 59.0, 33.58333333333332 ], [ 60.0, 18.333333333333336 ], [ 61.0, 12.083333333333336 ], [ 62.0, 5.333333333333333 ], [ 63.0, 4.25 ], [ 64.0, 7.166666666666666 ], [ 65.0, 5.0 ], [ 66.0, 3.4166666666666665 ], [ 67.0, 2.0 ], [ 68.0, 2.0 ], [ 69.0, 4.5 ], [ 70.0, 6.0 ], [ 71.0, 4.333333333333334 ], [ 72.0, 1.8333333333333333 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.5 ], [ 77.0, 0.25 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPFS2_R1", "pairs": [ [ 0.0, 1.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.25 ], [ 7.0, 0.25 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.25 ], [ 23.0, 0.0 ], [ 24.0, 0.25 ], [ 25.0, 0.25 ], [ 26.0, 1.0 ], [ 27.0, 1.75 ], [ 28.0, 0.25 ], [ 29.0, 1.5 ], [ 30.0, 2.5 ], [ 31.0, 0.75 ], [ 32.0, 1.0 ], [ 33.0, 1.5 ], [ 34.0, 2.583333333333333 ], [ 35.0, 3.583333333333333 ], [ 36.0, 2.75 ], [ 37.0, 8.5 ], [ 38.0, 10.833333333333336 ], [ 39.0, 10.333333333333334 ], [ 40.0, 23.08333333333332 ], [ 41.0, 14.916666666666673 ], [ 42.0, 6.916666666666666 ], [ 43.0, 14.083333333333334 ], [ 44.0, 23.999999999999996 ], [ 45.0, 348.58333333333115 ], [ 46.0, 824.5000000000217 ], [ 47.0, 259.083333333335 ], [ 48.0, 167.16666666666674 ], [ 49.0, 288.24999999999994 ], [ 50.0, 7658.083333333312 ], [ 51.0, 6796.833333333303 ], [ 52.0, 11005.50000000001 ], [ 53.0, 2800.0000000000023 ], [ 54.0, 4518.666666666667 ], [ 55.0, 8606.583333333328 ], [ 56.0, 876.333333333334 ], [ 57.0, 142.83333333333331 ], [ 58.0, 105.74999999999997 ], [ 59.0, 81.50000000000001 ], [ 60.0, 52.0 ], [ 61.0, 36.91666666666667 ], [ 62.0, 19.41666666666667 ], [ 63.0, 11.0 ], [ 64.0, 13.416666666666671 ], [ 65.0, 14.000000000000004 ], [ 66.0, 12.583333333333334 ], [ 67.0, 19.916666666666668 ], [ 68.0, 17.75 ], [ 69.0, 24.416666666666664 ], [ 70.0, 38.91666666666667 ], [ 71.0, 28.75 ], [ 72.0, 13.0 ], [ 73.0, 5.0 ], [ 74.0, 1.0 ], [ 75.0, 1.5 ], [ 76.0, 0.5 ], [ 77.0, 0.0 ], [ 78.0, 0.5 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.25 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPMS1_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.25 ], [ 14.0, 0.25 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.25 ], [ 26.0, 0.5 ], [ 27.0, 0.5 ], [ 28.0, 2.083333333333333 ], [ 29.0, 4.583333333333333 ], [ 30.0, 8.333333333333332 ], [ 31.0, 10.5 ], [ 32.0, 11.166666666666668 ], [ 33.0, 21.916666666666664 ], [ 34.0, 32.16666666666666 ], [ 35.0, 23.166666666666657 ], [ 36.0, 16.583333333333336 ], [ 37.0, 19.75 ], [ 38.0, 18.333333333333336 ], [ 39.0, 25.58333333333332 ], [ 40.0, 21.499999999999996 ], [ 41.0, 23.75 ], [ 42.0, 12.583333333333334 ], [ 43.0, 5.583333333333333 ], [ 44.0, 7.083333333333334 ], [ 45.0, 35.16666666666665 ], [ 46.0, 89.91666666666656 ], [ 47.0, 47.83333333333334 ], [ 48.0, 340.8333333333333 ], [ 49.0, 491.3333333333332 ], [ 50.0, 3833.750000000003 ], [ 51.0, 3474.750000000004 ], [ 52.0, 5696.666666666664 ], [ 53.0, 3828.2500000000023 ], [ 54.0, 3896.1666666666683 ], [ 55.0, 3683.0000000000014 ], [ 56.0, 1162.75 ], [ 57.0, 298.33333333333337 ], [ 58.0, 160.91666666666666 ], [ 59.0, 65.83333333333333 ], [ 60.0, 13.583333333333334 ], [ 61.0, 4.333333333333334 ], [ 62.0, 5.083333333333333 ], [ 63.0, 5.833333333333334 ], [ 64.0, 10.0 ], [ 65.0, 4.5 ], [ 66.0, 1.1666666666666665 ], [ 67.0, 1.3333333333333333 ], [ 68.0, 3.25 ], [ 69.0, 4.5 ], [ 70.0, 6.5 ], [ 71.0, 8.5 ], [ 72.0, 4.5 ], [ 73.0, 0.5 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.25 ], [ 78.0, 0.5 ], [ 79.0, 0.75 ], [ 80.0, 0.75 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.25 ], [ 87.0, 0.25 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.3333333333333333 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPMS2_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.25 ], [ 24.0, 0.25 ], [ 25.0, 0.5 ], [ 26.0, 1.0 ], [ 27.0, 0.5 ], [ 28.0, 0.5 ], [ 29.0, 0.5 ], [ 30.0, 0.5 ], [ 31.0, 0.75 ], [ 32.0, 1.0 ], [ 33.0, 0.5 ], [ 34.0, 0.5 ], [ 35.0, 0.5 ], [ 36.0, 1.5 ], [ 37.0, 1.75 ], [ 38.0, 1.0 ], [ 39.0, 5.0 ], [ 40.0, 5.999999999999999 ], [ 41.0, 3.916666666666667 ], [ 42.0, 6.583333333333333 ], [ 43.0, 7.833333333333333 ], [ 44.0, 14.916666666666668 ], [ 45.0, 81.49999999999997 ], [ 46.0, 202.08333333333417 ], [ 47.0, 109.66666666666657 ], [ 48.0, 1091.4166666666667 ], [ 49.0, 1117.8333333333337 ], [ 50.0, 5776.166666666661 ], [ 51.0, 4824.916666666667 ], [ 52.0, 4618.083333333336 ], [ 53.0, 2453.916666666666 ], [ 54.0, 3327.666666666669 ], [ 55.0, 3935.0000000000023 ], [ 56.0, 1125.333333333333 ], [ 57.0, 340.5 ], [ 58.0, 190.75 ], [ 59.0, 49.083333333333336 ], [ 60.0, 22.75 ], [ 61.0, 9.833333333333334 ], [ 62.0, 7.0 ], [ 63.0, 4.75 ], [ 64.0, 5.25 ], [ 65.0, 3.916666666666667 ], [ 66.0, 2.5 ], [ 67.0, 2.333333333333333 ], [ 68.0, 2.5 ], [ 69.0, 5.0 ], [ 70.0, 9.25 ], [ 71.0, 6.5 ], [ 72.0, 2.5 ], [ 73.0, 1.25 ], [ 74.0, 0.0 ], [ 75.0, 0.5 ], [ 76.0, 0.75 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVFS1_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.25 ], [ 23.0, 0.5 ], [ 24.0, 0.75 ], [ 25.0, 0.75 ], [ 26.0, 0.75 ], [ 27.0, 1.75 ], [ 28.0, 1.0 ], [ 29.0, 0.25 ], [ 30.0, 1.25 ], [ 31.0, 0.75 ], [ 32.0, 1.9166666666666665 ], [ 33.0, 2.6666666666666665 ], [ 34.0, 1.0 ], [ 35.0, 0.3333333333333333 ], [ 36.0, 1.3333333333333333 ], [ 37.0, 0.75 ], [ 38.0, 0.75 ], [ 39.0, 2.25 ], [ 40.0, 4.166666666666667 ], [ 41.0, 4.583333333333334 ], [ 42.0, 5.583333333333333 ], [ 43.0, 7.833333333333333 ], [ 44.0, 9.333333333333334 ], [ 45.0, 55.00000000000009 ], [ 46.0, 147.66666666666652 ], [ 47.0, 70.1666666666667 ], [ 48.0, 127.66666666666664 ], [ 49.0, 307.33333333333326 ], [ 50.0, 7135.749999999982 ], [ 51.0, 5970.249999999989 ], [ 52.0, 2827.250000000002 ], [ 53.0, 1751.8333333333326 ], [ 54.0, 2427.4166666666665 ], [ 55.0, 2494.5 ], [ 56.0, 905.916666666667 ], [ 57.0, 192.0833333333334 ], [ 58.0, 125.91666666666664 ], [ 59.0, 66.33333333333333 ], [ 60.0, 26.166666666666664 ], [ 61.0, 14.666666666666668 ], [ 62.0, 7.833333333333333 ], [ 63.0, 2.75 ], [ 64.0, 7.25 ], [ 65.0, 4.833333333333334 ], [ 66.0, 2.9166666666666665 ], [ 67.0, 1.3333333333333333 ], [ 68.0, 1.0833333333333333 ], [ 69.0, 1.25 ], [ 70.0, 2.25 ], [ 71.0, 2.0 ], [ 72.0, 0.5 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVFS2_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.25 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.25 ], [ 22.0, 0.25 ], [ 23.0, 0.5 ], [ 24.0, 0.5 ], [ 25.0, 0.5 ], [ 26.0, 0.0 ], [ 27.0, 0.25 ], [ 28.0, 0.25 ], [ 29.0, 0.75 ], [ 30.0, 0.75 ], [ 31.0, 1.0 ], [ 32.0, 0.5 ], [ 33.0, 1.3333333333333333 ], [ 34.0, 1.0 ], [ 35.0, 1.5833333333333333 ], [ 36.0, 1.5833333333333333 ], [ 37.0, 2.8333333333333335 ], [ 38.0, 10.916666666666668 ], [ 39.0, 12.583333333333336 ], [ 40.0, 18.58333333333334 ], [ 41.0, 8.333333333333332 ], [ 42.0, 6.5 ], [ 43.0, 10.333333333333332 ], [ 44.0, 15.416666666666666 ], [ 45.0, 191.91666666666768 ], [ 46.0, 483.24999999999125 ], [ 47.0, 156.00000000000006 ], [ 48.0, 160.9166666666667 ], [ 49.0, 341.4166666666666 ], [ 50.0, 8448.416666666648 ], [ 51.0, 7322.2499999999645 ], [ 52.0, 7297.416666666645 ], [ 53.0, 2513.2500000000005 ], [ 54.0, 2111.083333333332 ], [ 55.0, 3429.000000000003 ], [ 56.0, 1435.666666666664 ], [ 57.0, 229.666666666667 ], [ 58.0, 120.33333333333327 ], [ 59.0, 89.41666666666661 ], [ 60.0, 51.83333333333335 ], [ 61.0, 21.5 ], [ 62.0, 10.166666666666666 ], [ 63.0, 6.75 ], [ 64.0, 12.083333333333334 ], [ 65.0, 11.750000000000002 ], [ 66.0, 4.416666666666667 ], [ 67.0, 4.083333333333334 ], [ 68.0, 4.083333333333333 ], [ 69.0, 7.833333333333333 ], [ 70.0, 8.75 ], [ 71.0, 5.5 ], [ 72.0, 2.75 ], [ 73.0, 0.5 ], [ 74.0, 0.75 ], [ 75.0, 1.0 ], [ 76.0, 1.5 ], [ 77.0, 1.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVMS1_R1", "pairs": [ [ 0.0, 0.5 ], [ 1.0, 0.25 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.25 ], [ 16.0, 0.0 ], [ 17.0, 0.25 ], [ 18.0, 0.25 ], [ 19.0, 0.25 ], [ 20.0, 0.25 ], [ 21.0, 0.25 ], [ 22.0, 0.25 ], [ 23.0, 0.25 ], [ 24.0, 0.5 ], [ 25.0, 1.25 ], [ 26.0, 0.75 ], [ 27.0, 1.5 ], [ 28.0, 1.5 ], [ 29.0, 3.75 ], [ 30.0, 2.75 ], [ 31.0, 2.75 ], [ 32.0, 3.5 ], [ 33.0, 2.333333333333333 ], [ 34.0, 1.8333333333333333 ], [ 35.0, 3.0 ], [ 36.0, 3.1666666666666665 ], [ 37.0, 2.333333333333333 ], [ 38.0, 5.499999999999999 ], [ 39.0, 6.916666666666666 ], [ 40.0, 7.333333333333332 ], [ 41.0, 10.666666666666668 ], [ 42.0, 10.166666666666666 ], [ 43.0, 7.833333333333333 ], [ 44.0, 17.583333333333336 ], [ 45.0, 308.4166666666666 ], [ 46.0, 976.6666666666954 ], [ 47.0, 405.6666666666647 ], [ 48.0, 1082.2500000000005 ], [ 49.0, 1475.333333333333 ], [ 50.0, 7664.499999999988 ], [ 51.0, 6899.499999999987 ], [ 52.0, 5698.333333333332 ], [ 53.0, 8298.499999999985 ], [ 54.0, 9903.083333333332 ], [ 55.0, 7710.666666666659 ], [ 56.0, 4006.833333333337 ], [ 57.0, 1004.5000000000006 ], [ 58.0, 409.99999999999994 ], [ 59.0, 190.00000000000003 ], [ 60.0, 87.58333333333331 ], [ 61.0, 22.416666666666664 ], [ 62.0, 19.083333333333332 ], [ 63.0, 11.916666666666666 ], [ 64.0, 16.666666666666664 ], [ 65.0, 19.25 ], [ 66.0, 3.0 ], [ 67.0, 1.5 ], [ 68.0, 3.25 ], [ 69.0, 6.333333333333333 ], [ 70.0, 7.333333333333333 ], [ 71.0, 4.5 ], [ 72.0, 1.5 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.75 ], [ 77.0, 1.25 ], [ 78.0, 1.0 ], [ 79.0, 0.5 ], [ 80.0, 0.0 ], [ 81.0, 0.5 ], [ 82.0, 0.25 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.3333333333333333 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVMS2_R1", "pairs": [ [ 0.0, 0.5 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.25 ], [ 21.0, 0.25 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.5 ], [ 25.0, 0.0 ], [ 26.0, 0.5 ], [ 27.0, 1.25 ], [ 28.0, 0.75 ], [ 29.0, 0.75 ], [ 30.0, 1.25 ], [ 31.0, 0.75 ], [ 32.0, 1.25 ], [ 33.0, 1.5 ], [ 34.0, 1.8333333333333333 ], [ 35.0, 1.5 ], [ 36.0, 2.0 ], [ 37.0, 2.5 ], [ 38.0, 1.75 ], [ 39.0, 3.8333333333333335 ], [ 40.0, 4.666666666666666 ], [ 41.0, 12.333333333333336 ], [ 42.0, 19.333333333333336 ], [ 43.0, 17.083333333333336 ], [ 44.0, 15.166666666666668 ], [ 45.0, 235.91666666666865 ], [ 46.0, 588.1666666666648 ], [ 47.0, 172.0833333333336 ], [ 48.0, 346.66666666666663 ], [ 49.0, 798.916666666667 ], [ 50.0, 11422.500000000018 ], [ 51.0, 9686.41666666666 ], [ 52.0, 7235.4166666666415 ], [ 53.0, 6649.749999999987 ], [ 54.0, 7030.833333333327 ], [ 55.0, 6100.499999999995 ], [ 56.0, 3011.3333333333367 ], [ 57.0, 745.583333333334 ], [ 58.0, 384.33333333333326 ], [ 59.0, 203.25000000000009 ], [ 60.0, 49.74999999999999 ], [ 61.0, 17.583333333333336 ], [ 62.0, 21.666666666666668 ], [ 63.0, 17.416666666666668 ], [ 64.0, 28.666666666666668 ], [ 65.0, 14.666666666666666 ], [ 66.0, 3.3333333333333335 ], [ 67.0, 3.9166666666666665 ], [ 68.0, 4.5 ], [ 69.0, 9.5 ], [ 70.0, 15.25 ], [ 71.0, 11.0 ], [ 72.0, 4.5 ], [ 73.0, 1.0 ], [ 74.0, 0.25 ], [ 75.0, 1.25 ], [ 76.0, 1.5 ], [ 77.0, 0.5 ], [ 78.0, 0.0 ], [ 79.0, 0.25 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAFS1_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.9166666666666665 ], [ 46.0, 1.1666666666666665 ], [ 47.0, 0.8333333333333333 ], [ 48.0, 1.5 ], [ 49.0, 14.083333333333334 ], [ 50.0, 823.5000000000001 ], [ 51.0, 598.5833333333333 ], [ 52.0, 80.91666666666664 ], [ 53.0, 357.7499999999997 ], [ 54.0, 13842.083333333347 ], [ 55.0, 34267.333333333285 ], [ 56.0, 4159.250000000006 ], [ 57.0, 185.00000000000006 ], [ 58.0, 47.166666666666664 ], [ 59.0, 16.333333333333336 ], [ 60.0, 5.25 ], [ 61.0, 2.833333333333333 ], [ 62.0, 1.3333333333333333 ], [ 63.0, 0.0 ], [ 64.0, 0.25 ], [ 65.0, 0.0 ], [ 66.0, 0.0 ], [ 67.0, 0.25 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.25 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAFS2_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.25 ], [ 44.0, 0.25 ], [ 45.0, 0.25 ], [ 46.0, 0.5833333333333333 ], [ 47.0, 0.5833333333333333 ], [ 48.0, 2.0 ], [ 49.0, 13.833333333333334 ], [ 50.0, 685.0833333333334 ], [ 51.0, 514.1666666666665 ], [ 52.0, 34.916666666666664 ], [ 53.0, 221.83333333333334 ], [ 54.0, 16194.333333333348 ], [ 55.0, 25421.16666666658 ], [ 56.0, 1204.3333333333342 ], [ 57.0, 107.24999999999997 ], [ 58.0, 29.91666666666666 ], [ 59.0, 9.333333333333334 ], [ 60.0, 3.833333333333333 ], [ 61.0, 0.75 ], [ 62.0, 0.0 ], [ 63.0, 0.5833333333333333 ], [ 64.0, 1.0 ], [ 65.0, 0.0 ], [ 66.0, 0.0 ], [ 67.0, 0.25 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAMS1_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.25 ], [ 42.0, 0.25 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 2.25 ], [ 46.0, 4.916666666666666 ], [ 47.0, 0.5 ], [ 48.0, 2.25 ], [ 49.0, 10.75 ], [ 50.0, 338.08333333333326 ], [ 51.0, 259.58333333333337 ], [ 52.0, 58.58333333333335 ], [ 53.0, 346.91666666666663 ], [ 54.0, 16041.916666666686 ], [ 55.0, 31211.916666666526 ], [ 56.0, 2801.8333333333344 ], [ 57.0, 152.08333333333331 ], [ 58.0, 41.91666666666667 ], [ 59.0, 15.75 ], [ 60.0, 4.833333333333334 ], [ 61.0, 1.0833333333333333 ], [ 62.0, 0.0 ], [ 63.0, 0.3333333333333333 ], [ 64.0, 0.3333333333333333 ], [ 65.0, 0.3333333333333333 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAMS2_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.5 ], [ 45.0, 1.6666666666666665 ], [ 46.0, 3.5833333333333335 ], [ 47.0, 0.5 ], [ 48.0, 4.5 ], [ 49.0, 125.91666666666666 ], [ 50.0, 998.666666666667 ], [ 51.0, 533.6666666666666 ], [ 52.0, 289.91666666666663 ], [ 53.0, 1531.583333333333 ], [ 54.0, 15894.333333333347 ], [ 55.0, 25147.66666666662 ], [ 56.0, 4623.250000000002 ], [ 57.0, 1384.666666666666 ], [ 58.0, 536.5 ], [ 59.0, 29.25 ], [ 60.0, 9.916666666666668 ], [ 61.0, 3.0 ], [ 62.0, 1.0 ], [ 63.0, 1.3333333333333333 ], [ 64.0, 16.25 ], [ 65.0, 2.25 ], [ 66.0, 0.25 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICFS1_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.5 ], [ 22.0, 0.75 ], [ 23.0, 0.5 ], [ 24.0, 0.5 ], [ 25.0, 1.3333333333333333 ], [ 26.0, 1.5833333333333333 ], [ 27.0, 1.75 ], [ 28.0, 3.25 ], [ 29.0, 2.5 ], [ 30.0, 1.0 ], [ 31.0, 2.5 ], [ 32.0, 1.75 ], [ 33.0, 2.0 ], [ 34.0, 3.8333333333333335 ], [ 35.0, 3.0833333333333335 ], [ 36.0, 2.25 ], [ 37.0, 2.333333333333333 ], [ 38.0, 2.25 ], [ 39.0, 3.25 ], [ 40.0, 3.5 ], [ 41.0, 1.5 ], [ 42.0, 6.0 ], [ 43.0, 8.666666666666668 ], [ 44.0, 11.666666666666666 ], [ 45.0, 24.41666666666666 ], [ 46.0, 30.33333333333332 ], [ 47.0, 36.66666666666666 ], [ 48.0, 57.666666666666686 ], [ 49.0, 236.41666666666677 ], [ 50.0, 3766.500000000004 ], [ 51.0, 4372.500000000009 ], [ 52.0, 14300.500000000078 ], [ 53.0, 4556.75 ], [ 54.0, 4901.583333333329 ], [ 55.0, 9674.333333333336 ], [ 56.0, 2779.083333333336 ], [ 57.0, 594.5 ], [ 58.0, 133.66666666666663 ], [ 59.0, 71.41666666666667 ], [ 60.0, 48.58333333333334 ], [ 61.0, 25.83333333333333 ], [ 62.0, 16.333333333333336 ], [ 63.0, 8.333333333333332 ], [ 64.0, 5.499999999999999 ], [ 65.0, 3.5 ], [ 66.0, 1.0833333333333333 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.25 ], [ 70.0, 0.25 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.25 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICFS2_R1", "pairs": [ [ 0.0, 0.5 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.25 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.5 ], [ 26.0, 0.5 ], [ 27.0, 1.0 ], [ 28.0, 1.8333333333333333 ], [ 29.0, 1.25 ], [ 30.0, 1.75 ], [ 31.0, 2.25 ], [ 32.0, 1.0 ], [ 33.0, 1.5 ], [ 34.0, 2.5 ], [ 35.0, 2.8333333333333335 ], [ 36.0, 2.333333333333333 ], [ 37.0, 3.583333333333333 ], [ 38.0, 1.25 ], [ 39.0, 1.75 ], [ 40.0, 1.75 ], [ 41.0, 2.0 ], [ 42.0, 4.5 ], [ 43.0, 8.083333333333334 ], [ 44.0, 9.333333333333332 ], [ 45.0, 18.083333333333332 ], [ 46.0, 80.99999999999999 ], [ 47.0, 85.5 ], [ 48.0, 319.41666666666663 ], [ 49.0, 1051.8333333333335 ], [ 50.0, 2489.0833333333335 ], [ 51.0, 3067.333333333335 ], [ 52.0, 6906.916666666649 ], [ 53.0, 7183.333333333319 ], [ 54.0, 11049.583333333343 ], [ 55.0, 14431.083333333345 ], [ 56.0, 7083.916666666659 ], [ 57.0, 2774.4166666666674 ], [ 58.0, 356.41666666666663 ], [ 59.0, 94.41666666666664 ], [ 60.0, 33.16666666666667 ], [ 61.0, 14.666666666666666 ], [ 62.0, 8.5 ], [ 63.0, 4.083333333333333 ], [ 64.0, 9.75 ], [ 65.0, 6.583333333333333 ], [ 66.0, 0.5833333333333333 ], [ 67.0, 0.5 ], [ 68.0, 0.5 ], [ 69.0, 0.5 ], [ 70.0, 0.5 ], [ 71.0, 0.25 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.25 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICMS1_R1", "pairs": [ [ 0.0, 1.0 ], [ 1.0, 0.5 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.25 ], [ 23.0, 0.5 ], [ 24.0, 0.25 ], [ 25.0, 0.8333333333333333 ], [ 26.0, 1.0 ], [ 27.0, 0.5 ], [ 28.0, 1.0 ], [ 29.0, 2.0 ], [ 30.0, 1.5 ], [ 31.0, 1.25 ], [ 32.0, 0.5 ], [ 33.0, 2.5 ], [ 34.0, 2.25 ], [ 35.0, 1.75 ], [ 36.0, 1.0 ], [ 37.0, 1.0 ], [ 38.0, 2.25 ], [ 39.0, 2.5 ], [ 40.0, 2.75 ], [ 41.0, 4.25 ], [ 42.0, 6.583333333333334 ], [ 43.0, 9.666666666666668 ], [ 44.0, 9.666666666666666 ], [ 45.0, 15.333333333333332 ], [ 46.0, 25.25 ], [ 47.0, 25.833333333333332 ], [ 48.0, 44.666666666666664 ], [ 49.0, 81.75 ], [ 50.0, 1877.6666666666656 ], [ 51.0, 2417.8333333333335 ], [ 52.0, 10529.583333333341 ], [ 53.0, 2734.8333333333344 ], [ 54.0, 11416.166666666677 ], [ 55.0, 30618.083333333176 ], [ 56.0, 3621.2500000000127 ], [ 57.0, 141.83333333333331 ], [ 58.0, 37.333333333333336 ], [ 59.0, 22.16666666666666 ], [ 60.0, 12.66666666666667 ], [ 61.0, 8.75 ], [ 62.0, 5.25 ], [ 63.0, 2.9166666666666665 ], [ 64.0, 1.5 ], [ 65.0, 1.0 ], [ 66.0, 0.0 ], [ 67.0, 0.25 ], [ 68.0, 0.5833333333333333 ], [ 69.0, 0.5 ], [ 70.0, 0.25 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.3333333333333333 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICMS2_R1", "pairs": [ [ 0.0, 0.5 ], [ 1.0, 0.25 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.25 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.25 ], [ 11.0, 0.25 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.25 ], [ 18.0, 0.25 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.25 ], [ 23.0, 0.0 ], [ 24.0, 0.25 ], [ 25.0, 0.25 ], [ 26.0, 0.25 ], [ 27.0, 0.5 ], [ 28.0, 0.75 ], [ 29.0, 0.75 ], [ 30.0, 0.75 ], [ 31.0, 1.5 ], [ 32.0, 0.25 ], [ 33.0, 0.75 ], [ 34.0, 1.0833333333333333 ], [ 35.0, 1.25 ], [ 36.0, 2.0 ], [ 37.0, 1.75 ], [ 38.0, 1.25 ], [ 39.0, 1.75 ], [ 40.0, 3.5833333333333335 ], [ 41.0, 4.833333333333334 ], [ 42.0, 5.583333333333333 ], [ 43.0, 8.833333333333332 ], [ 44.0, 7.666666666666666 ], [ 45.0, 12.333333333333334 ], [ 46.0, 15.166666666666668 ], [ 47.0, 19.666666666666668 ], [ 48.0, 33.666666666666664 ], [ 49.0, 78.91666666666667 ], [ 50.0, 2176.416666666667 ], [ 51.0, 1892.0833333333317 ], [ 52.0, 751.8333333333339 ], [ 53.0, 529.9166666666665 ], [ 54.0, 6401.33333333333 ], [ 55.0, 24534.833333333296 ], [ 56.0, 4174.08333333334 ], [ 57.0, 137.41666666666666 ], [ 58.0, 48.00000000000001 ], [ 59.0, 20.083333333333332 ], [ 60.0, 11.25 ], [ 61.0, 6.833333333333333 ], [ 62.0, 4.583333333333333 ], [ 63.0, 4.25 ], [ 64.0, 3.9166666666666665 ], [ 65.0, 1.0 ], [ 66.0, 0.75 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPFS1_R1", "pairs": [ [ 0.0, 0.5 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.25 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.25 ], [ 20.0, 0.25 ], [ 21.0, 0.5 ], [ 22.0, 0.5 ], [ 23.0, 0.75 ], [ 24.0, 1.75 ], [ 25.0, 1.5 ], [ 26.0, 1.25 ], [ 27.0, 1.5 ], [ 28.0, 1.75 ], [ 29.0, 2.583333333333333 ], [ 30.0, 2.333333333333333 ], [ 31.0, 2.5 ], [ 32.0, 3.75 ], [ 33.0, 2.75 ], [ 34.0, 3.5 ], [ 35.0, 2.75 ], [ 36.0, 2.0 ], [ 37.0, 2.25 ], [ 38.0, 2.75 ], [ 39.0, 3.25 ], [ 40.0, 4.25 ], [ 41.0, 4.75 ], [ 42.0, 5.5 ], [ 43.0, 7.5 ], [ 44.0, 14.25 ], [ 45.0, 17.166666666666668 ], [ 46.0, 30.499999999999993 ], [ 47.0, 31.41666666666666 ], [ 48.0, 46.41666666666667 ], [ 49.0, 79.66666666666667 ], [ 50.0, 810.4166666666677 ], [ 51.0, 3470.4166666666856 ], [ 52.0, 31077.833333333103 ], [ 53.0, 8680.583333333303 ], [ 54.0, 3081.666666666669 ], [ 55.0, 2822.583333333335 ], [ 56.0, 347.6666666666666 ], [ 57.0, 51.58333333333334 ], [ 58.0, 37.83333333333333 ], [ 59.0, 23.583333333333332 ], [ 60.0, 11.416666666666668 ], [ 61.0, 8.75 ], [ 62.0, 8.25 ], [ 63.0, 3.5833333333333335 ], [ 64.0, 2.25 ], [ 65.0, 2.333333333333333 ], [ 66.0, 1.833333333333333 ], [ 67.0, 0.0 ], [ 68.0, 1.0 ], [ 69.0, 1.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 1.5 ], [ 76.0, 1.25 ], [ 77.0, 0.25 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPFS2_R1", "pairs": [ [ 0.0, 0.5 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.5 ], [ 24.0, 0.25 ], [ 25.0, 0.75 ], [ 26.0, 1.0 ], [ 27.0, 0.8333333333333333 ], [ 28.0, 1.0833333333333333 ], [ 29.0, 3.25 ], [ 30.0, 2.25 ], [ 31.0, 3.0 ], [ 32.0, 1.75 ], [ 33.0, 2.5 ], [ 34.0, 1.25 ], [ 35.0, 1.75 ], [ 36.0, 2.25 ], [ 37.0, 3.5 ], [ 38.0, 2.0 ], [ 39.0, 2.583333333333333 ], [ 40.0, 4.833333333333333 ], [ 41.0, 5.5 ], [ 42.0, 9.083333333333332 ], [ 43.0, 8.916666666666666 ], [ 44.0, 11.583333333333332 ], [ 45.0, 21.25 ], [ 46.0, 33.33333333333333 ], [ 47.0, 60.25000000000001 ], [ 48.0, 1019.6666666666669 ], [ 49.0, 1855.499999999999 ], [ 50.0, 2070.666666666665 ], [ 51.0, 2949.1666666666683 ], [ 52.0, 6547.166666666659 ], [ 53.0, 13858.750000000027 ], [ 54.0, 19569.41666666667 ], [ 55.0, 16782.083333333358 ], [ 56.0, 7636.499999999995 ], [ 57.0, 1608.5833333333326 ], [ 58.0, 632.9999999999999 ], [ 59.0, 71.16666666666667 ], [ 60.0, 20.166666666666664 ], [ 61.0, 10.833333333333334 ], [ 62.0, 4.666666666666666 ], [ 63.0, 3.3333333333333335 ], [ 64.0, 10.333333333333334 ], [ 65.0, 3.583333333333333 ], [ 66.0, 0.25 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.25 ], [ 70.0, 0.25 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPMS1_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.5 ], [ 20.0, 0.25 ], [ 21.0, 0.25 ], [ 22.0, 0.0 ], [ 23.0, 0.5 ], [ 24.0, 1.0 ], [ 25.0, 0.8333333333333333 ], [ 26.0, 1.5833333333333333 ], [ 27.0, 3.4166666666666665 ], [ 28.0, 2.333333333333333 ], [ 29.0, 3.25 ], [ 30.0, 4.5 ], [ 31.0, 3.8333333333333335 ], [ 32.0, 3.1666666666666665 ], [ 33.0, 3.25 ], [ 34.0, 2.5 ], [ 35.0, 3.25 ], [ 36.0, 4.0 ], [ 37.0, 4.25 ], [ 38.0, 3.25 ], [ 39.0, 3.333333333333333 ], [ 40.0, 4.5 ], [ 41.0, 10.333333333333334 ], [ 42.0, 9.166666666666666 ], [ 43.0, 15.583333333333334 ], [ 44.0, 17.5 ], [ 45.0, 19.749999999999996 ], [ 46.0, 69.5 ], [ 47.0, 73.83333333333334 ], [ 48.0, 560.6666666666666 ], [ 49.0, 782.5000000000002 ], [ 50.0, 3012.1666666666683 ], [ 51.0, 2941.9166666666756 ], [ 52.0, 2327.3333333333294 ], [ 53.0, 5404.749999999999 ], [ 54.0, 15202.416666666695 ], [ 55.0, 63885.333333333445 ], [ 56.0, 15258.83333333336 ], [ 57.0, 711.2500000000001 ], [ 58.0, 269.3333333333334 ], [ 59.0, 86.49999999999999 ], [ 60.0, 25.916666666666664 ], [ 61.0, 13.333333333333334 ], [ 62.0, 12.25 ], [ 63.0, 8.583333333333334 ], [ 64.0, 18.333333333333332 ], [ 65.0, 13.666666666666668 ], [ 66.0, 1.3333333333333333 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPMS2_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.25 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.25 ], [ 12.0, 0.25 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.25 ], [ 23.0, 0.5 ], [ 24.0, 0.25 ], [ 25.0, 1.0 ], [ 26.0, 0.5 ], [ 27.0, 1.5 ], [ 28.0, 2.0 ], [ 29.0, 2.0 ], [ 30.0, 1.25 ], [ 31.0, 2.0 ], [ 32.0, 2.25 ], [ 33.0, 2.0 ], [ 34.0, 1.8333333333333333 ], [ 35.0, 2.9166666666666665 ], [ 36.0, 1.8333333333333333 ], [ 37.0, 2.25 ], [ 38.0, 4.0 ], [ 39.0, 3.5833333333333335 ], [ 40.0, 6.416666666666667 ], [ 41.0, 6.0 ], [ 42.0, 11.5 ], [ 43.0, 15.750000000000002 ], [ 44.0, 15.666666666666666 ], [ 45.0, 23.916666666666668 ], [ 46.0, 27.083333333333332 ], [ 47.0, 48.916666666666664 ], [ 48.0, 169.41666666666669 ], [ 49.0, 826.3333333333334 ], [ 50.0, 2819.8333333333335 ], [ 51.0, 4156.16666666669 ], [ 52.0, 15178.25000000007 ], [ 53.0, 17068.916666666693 ], [ 54.0, 17158.41666666668 ], [ 55.0, 15772.583333333338 ], [ 56.0, 5502.666666666667 ], [ 57.0, 648.3333333333334 ], [ 58.0, 309.5833333333333 ], [ 59.0, 47.416666666666664 ], [ 60.0, 13.666666666666666 ], [ 61.0, 6.749999999999999 ], [ 62.0, 4.583333333333333 ], [ 63.0, 2.083333333333333 ], [ 64.0, 3.333333333333333 ], [ 65.0, 1.75 ], [ 66.0, 0.5833333333333333 ], [ 67.0, 0.9166666666666665 ], [ 68.0, 0.25 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.25 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVFS1_R1", "pairs": [ [ 0.0, 0.5 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.5833333333333333 ], [ 22.0, 0.0 ], [ 23.0, 0.25 ], [ 24.0, 0.25 ], [ 25.0, 1.0 ], [ 26.0, 2.25 ], [ 27.0, 3.0 ], [ 28.0, 2.25 ], [ 29.0, 2.5 ], [ 30.0, 3.5 ], [ 31.0, 2.833333333333333 ], [ 32.0, 3.833333333333333 ], [ 33.0, 3.75 ], [ 34.0, 3.75 ], [ 35.0, 3.5833333333333335 ], [ 36.0, 3.0 ], [ 37.0, 2.0 ], [ 38.0, 5.0 ], [ 39.0, 5.5 ], [ 40.0, 6.25 ], [ 41.0, 4.25 ], [ 42.0, 6.0 ], [ 43.0, 14.000000000000004 ], [ 44.0, 18.833333333333332 ], [ 45.0, 21.083333333333336 ], [ 46.0, 25.083333333333332 ], [ 47.0, 30.666666666666664 ], [ 48.0, 62.0 ], [ 49.0, 113.16666666666667 ], [ 50.0, 605.5 ], [ 51.0, 661.8333333333336 ], [ 52.0, 5618.083333333323 ], [ 53.0, 12090.250000000051 ], [ 54.0, 6911.499999999995 ], [ 55.0, 38888.66666666667 ], [ 56.0, 8221.666666666666 ], [ 57.0, 158.00000000000006 ], [ 58.0, 46.833333333333336 ], [ 59.0, 25.33333333333333 ], [ 60.0, 16.083333333333336 ], [ 61.0, 8.416666666666666 ], [ 62.0, 5.916666666666666 ], [ 63.0, 4.166666666666667 ], [ 64.0, 2.3333333333333335 ], [ 65.0, 1.0 ], [ 66.0, 0.25 ], [ 67.0, 0.5 ], [ 68.0, 0.0 ], [ 69.0, 0.5 ], [ 70.0, 0.25 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVFS2_R1", "pairs": [ [ 0.0, 1.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.5 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.25 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.25 ], [ 26.0, 0.75 ], [ 27.0, 0.5 ], [ 28.0, 0.5 ], [ 29.0, 0.75 ], [ 30.0, 1.25 ], [ 31.0, 1.75 ], [ 32.0, 1.75 ], [ 33.0, 1.5 ], [ 34.0, 2.0 ], [ 35.0, 1.0 ], [ 36.0, 1.0 ], [ 37.0, 1.25 ], [ 38.0, 2.0 ], [ 39.0, 2.25 ], [ 40.0, 1.75 ], [ 41.0, 3.333333333333333 ], [ 42.0, 4.083333333333334 ], [ 43.0, 11.750000000000002 ], [ 44.0, 15.416666666666673 ], [ 45.0, 23.416666666666657 ], [ 46.0, 30.749999999999982 ], [ 47.0, 31.74999999999999 ], [ 48.0, 49.500000000000014 ], [ 49.0, 75.58333333333333 ], [ 50.0, 711.833333333334 ], [ 51.0, 3065.0833333333453 ], [ 52.0, 27967.416666666486 ], [ 53.0, 6261.2499999999845 ], [ 54.0, 378.24999999999983 ], [ 55.0, 695.3333333333334 ], [ 56.0, 204.00000000000009 ], [ 57.0, 39.25 ], [ 58.0, 37.416666666666664 ], [ 59.0, 34.916666666666664 ], [ 60.0, 27.083333333333332 ], [ 61.0, 14.833333333333334 ], [ 62.0, 6.833333333333334 ], [ 63.0, 2.5 ], [ 64.0, 0.5 ], [ 65.0, 1.1666666666666665 ], [ 66.0, 0.9166666666666665 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.25 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.25 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.25 ], [ 91.0, 0.25 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVMS1_R1", "pairs": [ [ 0.0, 0.5 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.25 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.25 ], [ 21.0, 0.25 ], [ 22.0, 0.25 ], [ 23.0, 0.25 ], [ 24.0, 1.0 ], [ 25.0, 0.75 ], [ 26.0, 1.0 ], [ 27.0, 0.25 ], [ 28.0, 0.75 ], [ 29.0, 2.5 ], [ 30.0, 3.25 ], [ 31.0, 1.0 ], [ 32.0, 2.5 ], [ 33.0, 1.5 ], [ 34.0, 1.75 ], [ 35.0, 1.5 ], [ 36.0, 1.25 ], [ 37.0, 1.75 ], [ 38.0, 1.75 ], [ 39.0, 5.083333333333333 ], [ 40.0, 5.75 ], [ 41.0, 5.75 ], [ 42.0, 10.75 ], [ 43.0, 15.500000000000002 ], [ 44.0, 17.75 ], [ 45.0, 27.249999999999993 ], [ 46.0, 51.666666666666714 ], [ 47.0, 60.58333333333338 ], [ 48.0, 114.74999999999997 ], [ 49.0, 271.66666666666674 ], [ 50.0, 6807.666666666664 ], [ 51.0, 6019.249999999985 ], [ 52.0, 8766.24999999998 ], [ 53.0, 8085.916666666626 ], [ 54.0, 3582.833333333339 ], [ 55.0, 13850.083333333338 ], [ 56.0, 3364.5000000000027 ], [ 57.0, 199.25000000000014 ], [ 58.0, 141.16666666666666 ], [ 59.0, 70.16666666666667 ], [ 60.0, 37.08333333333334 ], [ 61.0, 19.166666666666668 ], [ 62.0, 9.166666666666666 ], [ 63.0, 5.916666666666666 ], [ 64.0, 7.666666666666667 ], [ 65.0, 6.166666666666666 ], [ 66.0, 2.25 ], [ 67.0, 0.5833333333333333 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVMS2_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.25 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.25 ], [ 22.0, 0.5 ], [ 23.0, 0.0 ], [ 24.0, 0.5 ], [ 25.0, 0.75 ], [ 26.0, 0.25 ], [ 27.0, 0.25 ], [ 28.0, 0.5833333333333333 ], [ 29.0, 0.3333333333333333 ], [ 30.0, 0.75 ], [ 31.0, 1.0 ], [ 32.0, 1.75 ], [ 33.0, 0.75 ], [ 34.0, 0.75 ], [ 35.0, 1.25 ], [ 36.0, 1.75 ], [ 37.0, 1.5 ], [ 38.0, 2.0 ], [ 39.0, 2.5 ], [ 40.0, 2.5 ], [ 41.0, 3.666666666666667 ], [ 42.0, 3.9166666666666665 ], [ 43.0, 10.166666666666666 ], [ 44.0, 13.91666666666667 ], [ 45.0, 13.333333333333332 ], [ 46.0, 22.749999999999996 ], [ 47.0, 25.249999999999996 ], [ 48.0, 45.0 ], [ 49.0, 78.66666666666666 ], [ 50.0, 1397.9166666666663 ], [ 51.0, 2837.0833333333394 ], [ 52.0, 20826.999999999993 ], [ 53.0, 5542.6666666666615 ], [ 54.0, 703.4166666666669 ], [ 55.0, 2200.4999999999995 ], [ 56.0, 633.75 ], [ 57.0, 58.000000000000014 ], [ 58.0, 30.499999999999993 ], [ 59.0, 16.833333333333336 ], [ 60.0, 6.999999999999999 ], [ 61.0, 5.999999999999999 ], [ 62.0, 4.583333333333333 ], [ 63.0, 1.25 ], [ 64.0, 1.5 ], [ 65.0, 2.0 ], [ 66.0, 0.5 ], [ 67.0, 0.25 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAFS1_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.25 ], [ 41.0, 0.25 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.5833333333333333 ], [ 46.0, 2.083333333333333 ], [ 47.0, 3.666666666666667 ], [ 48.0, 10.75 ], [ 49.0, 169.83333333333331 ], [ 50.0, 7378.333333333321 ], [ 51.0, 5172.999999999998 ], [ 52.0, 278.7500000000002 ], [ 53.0, 392.66666666666663 ], [ 54.0, 11664.25000000001 ], [ 55.0, 18661.00000000005 ], [ 56.0, 1965.5833333333267 ], [ 57.0, 169.5 ], [ 58.0, 41.583333333333336 ], [ 59.0, 17.41666666666667 ], [ 60.0, 4.5 ], [ 61.0, 1.0833333333333333 ], [ 62.0, 1.75 ], [ 63.0, 0.75 ], [ 64.0, 2.25 ], [ 65.0, 0.5 ], [ 66.0, 0.0 ], [ 67.0, 0.5 ], [ 68.0, 0.25 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAFS2_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.25 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.3333333333333333 ], [ 46.0, 2.333333333333333 ], [ 47.0, 2.333333333333333 ], [ 48.0, 7.416666666666666 ], [ 49.0, 104.91666666666666 ], [ 50.0, 2870.333333333334 ], [ 51.0, 1544.2499999999995 ], [ 52.0, 101.16666666666664 ], [ 53.0, 223.25 ], [ 54.0, 8373.16666666666 ], [ 55.0, 13870.08333333338 ], [ 56.0, 1663.0833333333298 ], [ 57.0, 165.75 ], [ 58.0, 29.499999999999993 ], [ 59.0, 13.166666666666666 ], [ 60.0, 7.0 ], [ 61.0, 3.5833333333333335 ], [ 62.0, 1.0833333333333333 ], [ 63.0, 0.8333333333333333 ], [ 64.0, 2.0 ], [ 65.0, 0.5 ], [ 66.0, 0.5 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.25 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAMS1_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.25 ], [ 45.0, 0.25 ], [ 46.0, 1.3333333333333333 ], [ 47.0, 0.5 ], [ 48.0, 10.833333333333334 ], [ 49.0, 273.5000000000001 ], [ 50.0, 32139.74999999978 ], [ 51.0, 24277.499999999924 ], [ 52.0, 728.083333333334 ], [ 53.0, 211.75000000000009 ], [ 54.0, 387.8333333333333 ], [ 55.0, 562.25 ], [ 56.0, 90.83333333333333 ], [ 57.0, 10.5 ], [ 58.0, 3.75 ], [ 59.0, 1.5 ], [ 60.0, 0.25 ], [ 61.0, 0.5 ], [ 62.0, 0.5 ], [ 63.0, 0.25 ], [ 64.0, 0.25 ], [ 65.0, 0.25 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.25 ], [ 81.0, 0.25 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAMS2_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 1.6666666666666665 ], [ 32.0, 1.9999999999999998 ], [ 33.0, 0.6666666666666666 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.5 ], [ 42.0, 1.5 ], [ 43.0, 1.3333333333333333 ], [ 44.0, 2.75 ], [ 45.0, 12.083333333333334 ], [ 46.0, 4.416666666666667 ], [ 47.0, 5.749999999999999 ], [ 48.0, 15.666666666666666 ], [ 49.0, 235.75000000000026 ], [ 50.0, 28431.249999999807 ], [ 51.0, 21191.249999999967 ], [ 52.0, 753.1666666666687 ], [ 53.0, 301.8333333333332 ], [ 54.0, 468.4166666666665 ], [ 55.0, 684.2500000000001 ], [ 56.0, 214.5000000000002 ], [ 57.0, 158.6666666666667 ], [ 58.0, 126.74999999999993 ], [ 59.0, 122.58333333333319 ], [ 60.0, 95.9999999999999 ], [ 61.0, 65.66666666666671 ], [ 62.0, 47.41666666666668 ], [ 63.0, 20.916666666666664 ], [ 64.0, 15.250000000000002 ], [ 65.0, 6.166666666666667 ], [ 66.0, 3.0 ], [ 67.0, 2.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.25 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCFS1_R1", "pairs": [ [ 0.0, 0.5 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.5 ], [ 24.0, 0.25 ], [ 25.0, 0.5 ], [ 26.0, 1.0 ], [ 27.0, 1.25 ], [ 28.0, 1.5 ], [ 29.0, 1.75 ], [ 30.0, 2.75 ], [ 31.0, 1.75 ], [ 32.0, 2.25 ], [ 33.0, 3.0 ], [ 34.0, 3.0 ], [ 35.0, 1.0 ], [ 36.0, 2.833333333333333 ], [ 37.0, 3.75 ], [ 38.0, 3.75 ], [ 39.0, 2.25 ], [ 40.0, 4.75 ], [ 41.0, 4.5 ], [ 42.0, 7.333333333333332 ], [ 43.0, 11.583333333333334 ], [ 44.0, 13.666666666666668 ], [ 45.0, 20.333333333333332 ], [ 46.0, 22.5 ], [ 47.0, 29.33333333333333 ], [ 48.0, 45.41666666666667 ], [ 49.0, 68.33333333333333 ], [ 50.0, 638.3333333333336 ], [ 51.0, 4392.333333333355 ], [ 52.0, 42063.4166666668 ], [ 53.0, 9208.916666666646 ], [ 54.0, 550.2499999999997 ], [ 55.0, 1022.5000000000003 ], [ 56.0, 258.2500000000001 ], [ 57.0, 49.416666666666664 ], [ 58.0, 26.583333333333332 ], [ 59.0, 20.083333333333336 ], [ 60.0, 10.5 ], [ 61.0, 5.166666666666666 ], [ 62.0, 2.8333333333333335 ], [ 63.0, 1.75 ], [ 64.0, 1.25 ], [ 65.0, 1.5833333333333333 ], [ 66.0, 1.0 ], [ 67.0, 0.5833333333333333 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.5 ], [ 71.0, 0.5 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCFS2_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.3333333333333333 ], [ 21.0, 0.3333333333333333 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.25 ], [ 25.0, 0.5 ], [ 26.0, 0.75 ], [ 27.0, 0.5 ], [ 28.0, 1.25 ], [ 29.0, 1.25 ], [ 30.0, 1.5 ], [ 31.0, 0.5 ], [ 32.0, 1.5 ], [ 33.0, 1.25 ], [ 34.0, 2.0 ], [ 35.0, 1.5 ], [ 36.0, 1.25 ], [ 37.0, 1.25 ], [ 38.0, 2.75 ], [ 39.0, 3.3333333333333335 ], [ 40.0, 3.083333333333333 ], [ 41.0, 2.75 ], [ 42.0, 5.666666666666666 ], [ 43.0, 6.833333333333333 ], [ 44.0, 10.75 ], [ 45.0, 16.5 ], [ 46.0, 20.416666666666664 ], [ 47.0, 31.916666666666664 ], [ 48.0, 41.166666666666664 ], [ 49.0, 61.91666666666668 ], [ 50.0, 425.1666666666663 ], [ 51.0, 3834.41666666669 ], [ 52.0, 34087.41666666641 ], [ 53.0, 7706.833333333276 ], [ 54.0, 358.74999999999983 ], [ 55.0, 615.5000000000001 ], [ 56.0, 168.25000000000006 ], [ 57.0, 35.33333333333333 ], [ 58.0, 25.833333333333332 ], [ 59.0, 23.666666666666664 ], [ 60.0, 14.75 ], [ 61.0, 8.833333333333334 ], [ 62.0, 4.499999999999999 ], [ 63.0, 3.583333333333333 ], [ 64.0, 1.5 ], [ 65.0, 0.75 ], [ 66.0, 0.3333333333333333 ], [ 67.0, 0.3333333333333333 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.5 ], [ 71.0, 0.5 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCMS1_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.25 ], [ 23.0, 0.25 ], [ 24.0, 0.5 ], [ 25.0, 0.75 ], [ 26.0, 0.75 ], [ 27.0, 0.5 ], [ 28.0, 1.0 ], [ 29.0, 0.75 ], [ 30.0, 1.25 ], [ 31.0, 1.5 ], [ 32.0, 0.75 ], [ 33.0, 1.0 ], [ 34.0, 0.5 ], [ 35.0, 0.25 ], [ 36.0, 3.25 ], [ 37.0, 3.0 ], [ 38.0, 2.25 ], [ 39.0, 2.75 ], [ 40.0, 5.333333333333334 ], [ 41.0, 6.5 ], [ 42.0, 7.583333333333333 ], [ 43.0, 10.5 ], [ 44.0, 12.833333333333334 ], [ 45.0, 22.25 ], [ 46.0, 22.916666666666664 ], [ 47.0, 32.83333333333333 ], [ 48.0, 98.08333333333333 ], [ 49.0, 200.5 ], [ 50.0, 670.2499999999998 ], [ 51.0, 3396.6666666666883 ], [ 52.0, 31583.083333333085 ], [ 53.0, 8539.333333333308 ], [ 54.0, 2541.333333333334 ], [ 55.0, 2317.916666666666 ], [ 56.0, 768.5000000000003 ], [ 57.0, 181.16666666666663 ], [ 58.0, 107.91666666666667 ], [ 59.0, 54.58333333333334 ], [ 60.0, 20.166666666666668 ], [ 61.0, 11.5 ], [ 62.0, 12.500000000000002 ], [ 63.0, 8.75 ], [ 64.0, 10.666666666666668 ], [ 65.0, 6.666666666666666 ], [ 66.0, 0.5 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCMS2_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.5 ], [ 27.0, 0.25 ], [ 28.0, 0.75 ], [ 29.0, 1.5833333333333333 ], [ 30.0, 1.8333333333333333 ], [ 31.0, 3.416666666666667 ], [ 32.0, 4.666666666666666 ], [ 33.0, 7.166666666666665 ], [ 34.0, 2.6666666666666665 ], [ 35.0, 0.8333333333333333 ], [ 36.0, 1.3333333333333333 ], [ 37.0, 3.416666666666667 ], [ 38.0, 3.583333333333333 ], [ 39.0, 2.833333333333333 ], [ 40.0, 3.333333333333333 ], [ 41.0, 3.083333333333333 ], [ 42.0, 5.416666666666667 ], [ 43.0, 5.583333333333333 ], [ 44.0, 6.833333333333333 ], [ 45.0, 15.666666666666666 ], [ 46.0, 27.416666666666664 ], [ 47.0, 45.0 ], [ 48.0, 146.83333333333331 ], [ 49.0, 263.83333333333337 ], [ 50.0, 1221.0000000000005 ], [ 51.0, 2838.166666666679 ], [ 52.0, 21504.749999999953 ], [ 53.0, 6670.916666666653 ], [ 54.0, 2720.083333333334 ], [ 55.0, 3234.583333333334 ], [ 56.0, 1278.833333333333 ], [ 57.0, 268.1666666666667 ], [ 58.0, 145.25 ], [ 59.0, 79.08333333333331 ], [ 60.0, 31.249999999999993 ], [ 61.0, 21.33333333333333 ], [ 62.0, 13.16666666666667 ], [ 63.0, 6.5 ], [ 64.0, 7.5 ], [ 65.0, 4.25 ], [ 66.0, 0.5 ], [ 67.0, 0.0 ], [ 68.0, 0.3333333333333333 ], [ 69.0, 0.8333333333333333 ], [ 70.0, 0.5 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPFS1_R1", "pairs": [ [ 0.0, 1.0 ], [ 1.0, 0.25 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.25 ], [ 11.0, 0.25 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.25 ], [ 22.0, 0.5 ], [ 23.0, 0.5 ], [ 24.0, 0.75 ], [ 25.0, 0.5 ], [ 26.0, 1.0833333333333333 ], [ 27.0, 2.083333333333333 ], [ 28.0, 1.5 ], [ 29.0, 2.25 ], [ 30.0, 2.5 ], [ 31.0, 3.75 ], [ 32.0, 2.25 ], [ 33.0, 3.583333333333333 ], [ 34.0, 2.25 ], [ 35.0, 3.0 ], [ 36.0, 2.0 ], [ 37.0, 3.5 ], [ 38.0, 1.9166666666666665 ], [ 39.0, 6.666666666666665 ], [ 40.0, 7.5 ], [ 41.0, 6.75 ], [ 42.0, 7.583333333333333 ], [ 43.0, 9.75 ], [ 44.0, 14.166666666666666 ], [ 45.0, 22.91666666666666 ], [ 46.0, 31.916666666666654 ], [ 47.0, 40.916666666666664 ], [ 48.0, 55.0 ], [ 49.0, 95.83333333333333 ], [ 50.0, 1508.2499999999982 ], [ 51.0, 5286.333333333306 ], [ 52.0, 52111.0000000006 ], [ 53.0, 11020.333333333361 ], [ 54.0, 615.8333333333334 ], [ 55.0, 933.166666666667 ], [ 56.0, 91.24999999999999 ], [ 57.0, 17.916666666666668 ], [ 58.0, 19.75 ], [ 59.0, 17.833333333333336 ], [ 60.0, 13.166666666666666 ], [ 61.0, 9.416666666666666 ], [ 62.0, 3.9166666666666665 ], [ 63.0, 2.75 ], [ 64.0, 1.7499999999999998 ], [ 65.0, 1.0 ], [ 66.0, 0.5 ], [ 67.0, 0.25 ], [ 68.0, 0.0 ], [ 69.0, 0.3333333333333333 ], [ 70.0, 0.5 ], [ 71.0, 0.5 ], [ 72.0, 0.3333333333333333 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.25 ], [ 87.0, 0.25 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPFS2_R1", "pairs": [ [ 0.0, 0.5 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.25 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.5 ], [ 20.0, 0.5 ], [ 21.0, 0.25 ], [ 22.0, 0.5 ], [ 23.0, 0.25 ], [ 24.0, 0.5 ], [ 25.0, 1.0 ], [ 26.0, 2.0 ], [ 27.0, 1.75 ], [ 28.0, 1.25 ], [ 29.0, 2.25 ], [ 30.0, 1.5 ], [ 31.0, 0.25 ], [ 32.0, 2.25 ], [ 33.0, 1.25 ], [ 34.0, 1.0 ], [ 35.0, 2.5 ], [ 36.0, 2.75 ], [ 37.0, 2.75 ], [ 38.0, 2.75 ], [ 39.0, 3.8333333333333335 ], [ 40.0, 2.5 ], [ 41.0, 3.75 ], [ 42.0, 5.75 ], [ 43.0, 11.0 ], [ 44.0, 12.333333333333334 ], [ 45.0, 15.666666666666668 ], [ 46.0, 25.583333333333332 ], [ 47.0, 36.166666666666664 ], [ 48.0, 48.41666666666667 ], [ 49.0, 95.99999999999997 ], [ 50.0, 2410.4166666666642 ], [ 51.0, 5400.249999999973 ], [ 52.0, 42699.50000000009 ], [ 53.0, 9847.916666666662 ], [ 54.0, 797.666666666667 ], [ 55.0, 1270.9166666666663 ], [ 56.0, 158.00000000000006 ], [ 57.0, 30.666666666666664 ], [ 58.0, 22.666666666666664 ], [ 59.0, 17.0 ], [ 60.0, 14.666666666666668 ], [ 61.0, 8.5 ], [ 62.0, 4.583333333333333 ], [ 63.0, 2.5833333333333335 ], [ 64.0, 1.75 ], [ 65.0, 1.1666666666666665 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.25 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPMS1_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.25 ], [ 3.0, 0.25 ], [ 4.0, 0.0 ], [ 5.0, 0.25 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.25 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.25 ], [ 22.0, 0.25 ], [ 23.0, 0.25 ], [ 24.0, 0.5 ], [ 25.0, 1.0 ], [ 26.0, 0.75 ], [ 27.0, 1.25 ], [ 28.0, 1.5 ], [ 29.0, 1.25 ], [ 30.0, 1.5 ], [ 31.0, 2.0 ], [ 32.0, 2.25 ], [ 33.0, 2.833333333333333 ], [ 34.0, 2.583333333333333 ], [ 35.0, 2.0 ], [ 36.0, 1.5 ], [ 37.0, 3.25 ], [ 38.0, 4.083333333333333 ], [ 39.0, 7.583333333333333 ], [ 40.0, 6.75 ], [ 41.0, 7.25 ], [ 42.0, 11.0 ], [ 43.0, 12.5 ], [ 44.0, 16.833333333333336 ], [ 45.0, 21.75 ], [ 46.0, 81.25 ], [ 47.0, 95.91666666666666 ], [ 48.0, 847.6666666666667 ], [ 49.0, 1207.0000000000002 ], [ 50.0, 17155.75000000016 ], [ 51.0, 15805.916666666906 ], [ 52.0, 19968.66666666666 ], [ 53.0, 6866.16666666666 ], [ 54.0, 3230.416666666667 ], [ 55.0, 3296.5833333333358 ], [ 56.0, 1333.6666666666665 ], [ 57.0, 352.9166666666666 ], [ 58.0, 177.83333333333337 ], [ 59.0, 58.83333333333333 ], [ 60.0, 21.583333333333336 ], [ 61.0, 9.666666666666666 ], [ 62.0, 4.916666666666666 ], [ 63.0, 5.583333333333333 ], [ 64.0, 2.75 ], [ 65.0, 3.0 ], [ 66.0, 0.5833333333333333 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.25 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.25 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.3333333333333333 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPMS2_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.25 ], [ 12.0, 0.25 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.25 ], [ 25.0, 0.75 ], [ 26.0, 0.5 ], [ 27.0, 0.5 ], [ 28.0, 0.5 ], [ 29.0, 1.25 ], [ 30.0, 1.0 ], [ 31.0, 1.25 ], [ 32.0, 2.25 ], [ 33.0, 0.75 ], [ 34.0, 0.25 ], [ 35.0, 0.75 ], [ 36.0, 0.75 ], [ 37.0, 1.25 ], [ 38.0, 2.0 ], [ 39.0, 2.5 ], [ 40.0, 3.5833333333333335 ], [ 41.0, 4.583333333333334 ], [ 42.0, 5.5 ], [ 43.0, 7.5 ], [ 44.0, 10.0 ], [ 45.0, 17.583333333333336 ], [ 46.0, 43.0 ], [ 47.0, 52.08333333333334 ], [ 48.0, 247.58333333333334 ], [ 49.0, 437.5833333333332 ], [ 50.0, 8076.749999999969 ], [ 51.0, 8028.416666666612 ], [ 52.0, 17974.08333333337 ], [ 53.0, 4695.666666666669 ], [ 54.0, 1497.6666666666667 ], [ 55.0, 1819.6666666666663 ], [ 56.0, 574.3333333333333 ], [ 57.0, 143.58333333333337 ], [ 58.0, 75.91666666666667 ], [ 59.0, 36.08333333333333 ], [ 60.0, 20.333333333333332 ], [ 61.0, 13.5 ], [ 62.0, 7.166666666666666 ], [ 63.0, 4.25 ], [ 64.0, 3.8333333333333335 ], [ 65.0, 2.5 ], [ 66.0, 0.0 ], [ 67.0, 0.25 ], [ 68.0, 0.0 ], [ 69.0, 0.25 ], [ 70.0, 0.25 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVFS1_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.25 ], [ 22.0, 0.25 ], [ 23.0, 0.0 ], [ 24.0, 0.25 ], [ 25.0, 0.25 ], [ 26.0, 1.0 ], [ 27.0, 1.0 ], [ 28.0, 1.0 ], [ 29.0, 2.0 ], [ 30.0, 2.0 ], [ 31.0, 2.0 ], [ 32.0, 2.833333333333333 ], [ 33.0, 1.75 ], [ 34.0, 1.5 ], [ 35.0, 1.0 ], [ 36.0, 1.25 ], [ 37.0, 2.25 ], [ 38.0, 2.083333333333333 ], [ 39.0, 4.0 ], [ 40.0, 4.25 ], [ 41.0, 5.5 ], [ 42.0, 4.5 ], [ 43.0, 7.25 ], [ 44.0, 13.0 ], [ 45.0, 17.583333333333336 ], [ 46.0, 20.166666666666664 ], [ 47.0, 26.249999999999996 ], [ 48.0, 31.91666666666666 ], [ 49.0, 70.5 ], [ 50.0, 1315.1666666666665 ], [ 51.0, 3117.75000000001 ], [ 52.0, 23053.083333333263 ], [ 53.0, 5232.083333333322 ], [ 54.0, 411.6666666666665 ], [ 55.0, 737.8333333333335 ], [ 56.0, 224.00000000000006 ], [ 57.0, 52.250000000000014 ], [ 58.0, 34.5 ], [ 59.0, 26.916666666666664 ], [ 60.0, 20.833333333333336 ], [ 61.0, 12.583333333333334 ], [ 62.0, 7.083333333333333 ], [ 63.0, 4.75 ], [ 64.0, 3.583333333333333 ], [ 65.0, 1.25 ], [ 66.0, 0.25 ], [ 67.0, 0.0 ], [ 68.0, 0.3333333333333333 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.25 ], [ 82.0, 0.5 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVFS2_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.25 ], [ 19.0, 0.0 ], [ 20.0, 0.25 ], [ 21.0, 0.25 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.5 ], [ 26.0, 1.25 ], [ 27.0, 2.0 ], [ 28.0, 2.4166666666666665 ], [ 29.0, 1.9166666666666665 ], [ 30.0, 1.25 ], [ 31.0, 2.333333333333333 ], [ 32.0, 1.75 ], [ 33.0, 1.0 ], [ 34.0, 2.5 ], [ 35.0, 0.75 ], [ 36.0, 1.75 ], [ 37.0, 2.5 ], [ 38.0, 1.75 ], [ 39.0, 3.9166666666666665 ], [ 40.0, 3.4166666666666665 ], [ 41.0, 4.0 ], [ 42.0, 4.5 ], [ 43.0, 5.5 ], [ 44.0, 10.833333333333334 ], [ 45.0, 12.666666666666668 ], [ 46.0, 23.249999999999996 ], [ 47.0, 33.41666666666667 ], [ 48.0, 55.41666666666667 ], [ 49.0, 143.0 ], [ 50.0, 1518.8333333333333 ], [ 51.0, 1519.7499999999984 ], [ 52.0, 3907.4166666666792 ], [ 53.0, 5243.9166666666615 ], [ 54.0, 4815.083333333333 ], [ 55.0, 25291.583333333332 ], [ 56.0, 5349.666666666666 ], [ 57.0, 116.41666666666664 ], [ 58.0, 45.333333333333336 ], [ 59.0, 20.5 ], [ 60.0, 8.5 ], [ 61.0, 4.583333333333333 ], [ 62.0, 4.75 ], [ 63.0, 3.0 ], [ 64.0, 1.5833333333333333 ], [ 65.0, 0.5833333333333333 ], [ 66.0, 0.5833333333333333 ], [ 67.0, 0.0 ], [ 68.0, 0.3333333333333333 ], [ 69.0, 0.0 ], [ 70.0, 0.25 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVMS1_R1", "pairs": [ [ 0.0, 0.5 ], [ 1.0, 0.5 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.25 ], [ 10.0, 0.25 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.25 ], [ 14.0, 0.25 ], [ 15.0, 0.0 ], [ 16.0, 0.25 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.25 ], [ 24.0, 0.25 ], [ 25.0, 0.5 ], [ 26.0, 1.3333333333333333 ], [ 27.0, 1.5833333333333333 ], [ 28.0, 3.25 ], [ 29.0, 2.8333333333333335 ], [ 30.0, 2.8333333333333335 ], [ 31.0, 2.0 ], [ 32.0, 2.25 ], [ 33.0, 2.5 ], [ 34.0, 3.75 ], [ 35.0, 3.0 ], [ 36.0, 4.0 ], [ 37.0, 6.25 ], [ 38.0, 6.25 ], [ 39.0, 8.0 ], [ 40.0, 6.25 ], [ 41.0, 7.75 ], [ 42.0, 15.5 ], [ 43.0, 14.833333333333332 ], [ 44.0, 23.25 ], [ 45.0, 31.500000000000004 ], [ 46.0, 63.50000000000002 ], [ 47.0, 76.83333333333333 ], [ 48.0, 191.08333333333334 ], [ 49.0, 340.0 ], [ 50.0, 1634.3333333333287 ], [ 51.0, 7504.916666666558 ], [ 52.0, 69673.083333334 ], [ 53.0, 17593.666666666744 ], [ 54.0, 3357.9166666666742 ], [ 55.0, 4158.2500000000055 ], [ 56.0, 2996.9166666666697 ], [ 57.0, 566.9166666666665 ], [ 58.0, 218.25000000000009 ], [ 59.0, 118.24999999999994 ], [ 60.0, 47.41666666666668 ], [ 61.0, 25.666666666666664 ], [ 62.0, 14.583333333333332 ], [ 63.0, 11.25 ], [ 64.0, 14.5 ], [ 65.0, 8.833333333333334 ], [ 66.0, 0.6666666666666666 ], [ 67.0, 0.25 ], [ 68.0, 0.5 ], [ 69.0, 0.5 ], [ 70.0, 0.25 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVMS2_R1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.5 ], [ 26.0, 1.0 ], [ 27.0, 0.75 ], [ 28.0, 1.25 ], [ 29.0, 1.5 ], [ 30.0, 0.25 ], [ 31.0, 0.75 ], [ 32.0, 1.0 ], [ 33.0, 3.5 ], [ 34.0, 2.75 ], [ 35.0, 1.25 ], [ 36.0, 0.5833333333333333 ], [ 37.0, 1.5 ], [ 38.0, 1.5 ], [ 39.0, 3.5 ], [ 40.0, 3.5 ], [ 41.0, 5.0 ], [ 42.0, 5.25 ], [ 43.0, 5.0 ], [ 44.0, 6.75 ], [ 45.0, 11.75 ], [ 46.0, 22.0 ], [ 47.0, 30.083333333333336 ], [ 48.0, 80.0 ], [ 49.0, 172.75 ], [ 50.0, 1621.083333333331 ], [ 51.0, 3130.416666666682 ], [ 52.0, 20332.833333333336 ], [ 53.0, 6373.333333333319 ], [ 54.0, 1824.9166666666654 ], [ 55.0, 1846.8333333333323 ], [ 56.0, 1194.2500000000007 ], [ 57.0, 428.83333333333314 ], [ 58.0, 159.0 ], [ 59.0, 54.833333333333336 ], [ 60.0, 17.166666666666664 ], [ 61.0, 7.666666666666667 ], [ 62.0, 3.166666666666667 ], [ 63.0, 4.75 ], [ 64.0, 6.75 ], [ 65.0, 5.75 ], [ 66.0, 2.0 ], [ 67.0, 1.0833333333333333 ], [ 68.0, 0.5833333333333333 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null } ] } ], "pconfig": { "id": "fastqc_per_sequence_gc_content_plot", "title": "FastQC: Per Sequence GC Content", "anchor": null, "table_title": null, "height": null, "width": null, "square": false, "logswitch": false, "logswitch_active": false, "logswitch_label": "Log10", "cpswitch": true, "cpswitch_c_active": true, "cpswitch_counts_label": "Counts", "cpswitch_percent_label": "Percentages", "xLog": null, "yLog": null, "xlog": false, "ylog": false, "data_labels": [ { "name": "Percentages", "ylab": "Percentage", "tt_suffix": "%", "title": "FastQC: Per Sequence GC Content
Percentages, 64 samples" }, { "name": "Counts", "ylab": "Count", "tt_suffix": "", "title": "FastQC: Per Sequence GC Content
Counts, 64 samples" } ], "xTitle": null, "yTitle": null, "xlab": "% GC", "ylab": "Percentage", "xsuffix": null, "ysuffix": null, "tt_suffix": null, "xLabFormat": null, "yLabFormat": null, "xLabelFormat": null, "yLabelFormat": null, "xlab_format": null, "ylab_format": null, "tt_label": "{point.x}% GC: {point.y}", "xDecimals": null, "yDecimals": null, "decimalPlaces": null, "x_decimals": null, "y_decimals": null, "tt_decimals": null, "xmin": 0, "xmax": 100, "ymin": 0, "ymax": null, "xFloor": null, "xCeiling": null, "yFloor": null, "yCeiling": null, "x_clipmin": null, "x_clipmax": null, "y_clipmin": null, "y_clipmax": null, "save_data_file": true, "showlegend": false, "xMinRange": null, "yMinRange": null, "x_minrange": null, "y_minrange": null, "xPlotBands": null, "yPlotBands": null, "xPlotLines": null, "yPlotLines": null, "x_bands": null, "y_bands": null, "x_lines": null, "y_lines": null, "categories": false, "smooth_points": 500, "smooth_points_sumcounts": null, "extra_series": null, "style": null, "hide_zero_cats": false, "hide_empty": false, "colors": { "CAFS1_R1": "#d9534f", "CAFS2_R1": "#d9534f", "CAMS1_R1": "#d9534f", "CAMS2_R1": "#d9534f", "CCFS1_R1": "#d9534f", "CCFS2_R1": "#d9534f", "CCMS1_R1": "#d9534f", "CCMS2_R1": "#d9534f", "CPFS1_R1": "#d9534f", "CPFS2_R1": "#f0ad4e", "CPMS1_R1": "#d9534f", "CPMS2_R1": "#d9534f", "CVFS1_R1": "#d9534f", "CVFS2_R1": "#d9534f", "CVMS1_R1": "#d9534f", "CVMS2_R1": "#d9534f", "DAFS1_R1": "#d9534f", "DAFS2_R1": "#d9534f", "DAMS1_R1": "#d9534f", "DAMS2_R1": "#d9534f", "DCFS1_R1": "#d9534f", "DCFS2_R1": "#d9534f", "DCMS1_R1": "#d9534f", "DCMS2_R1": "#d9534f", "DPFS1_R1": "#d9534f", "DPFS2_R1": "#d9534f", "DPMS1_R1": "#d9534f", "DPMS2_R1": "#d9534f", "DVFS1_R1": "#d9534f", "DVFS2_R1": "#d9534f", "DVMS1_R1": "#d9534f", "DVMS2_R1": "#d9534f", "IAFS1_R1": "#d9534f", "IAFS2_R1": "#d9534f", "IAMS1_R1": "#d9534f", "IAMS2_R1": "#d9534f", "ICFS1_R1": "#d9534f", "ICFS2_R1": "#d9534f", "ICMS1_R1": "#d9534f", "ICMS2_R1": "#d9534f", "IPFS1_R1": "#d9534f", "IPFS2_R1": "#f0ad4e", "IPMS1_R1": "#d9534f", "IPMS2_R1": "#f0ad4e", "IVFS1_R1": "#d9534f", "IVFS2_R1": "#d9534f", "IVMS1_R1": "#d9534f", "IVMS2_R1": "#d9534f", "JAFS1_R1": "#d9534f", "JAFS2_R1": "#d9534f", "JAMS1_R1": "#d9534f", "JAMS2_R1": "#d9534f", "JCFS1_R1": "#d9534f", "JCFS2_R1": "#d9534f", "JCMS1_R1": "#d9534f", "JCMS2_R1": "#d9534f", "JPFS1_R1": "#d9534f", "JPFS2_R1": "#d9534f", "JPMS1_R1": "#d9534f", "JPMS2_R1": "#d9534f", "JVFS1_R1": "#d9534f", "JVFS2_R1": "#d9534f", "JVMS1_R1": "#d9534f", "JVMS2_R1": "#d9534f" } }, "add_log_tab": false, "add_pct_tab": false, "l_active": false, "p_active": false, "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "yaxis" ], "square": false, "flat": false, "defer_render": false }, "fastqc_per_base_n_content_plot": { "id": "fastqc_per_base_n_content_plot", "anchor": "fastqc_per_base_n_content_plot", "plot_type": "xy_line", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 500, "hoverlabel": { "namelength": -1 }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "white", "plot_bgcolor": "white", "showlegend": false, "title": { "font": { "size": 20 }, "text": "FastQC: Per Base N Content", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "shapes": [ { "fillcolor": "#e6c3c3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 20, "y1": 100 }, { "fillcolor": "#e6dcc3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 5, "y1": 20 }, { "fillcolor": "#c3e6c3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 0, "y1": 5 }, { "fillcolor": "#e6c3c3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 20, "y1": 100 }, { "fillcolor": "#e6dcc3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 5, "y1": 20 }, { "fillcolor": "#c3e6c3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 0, "y1": 5 } ], "hoverdistance": -1 }, "datasets": [ { "plot_id": "fastqc_per_base_n_content_plot", "label": "1", "uid": "fastqc_per_base_n_content_plot", "dconfig": { "title": "FastQC: Per Base N Content
64 samples" }, "layout": { "title": { "text": "FastQC: Per Base N Content
64 samples" }, "xaxis": { "hoverformat": null, "ticksuffix": " bp", "title": { "text": "Position in Read (bp)" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": null } }, "yaxis": { "hoverformat": null, "ticksuffix": "%", "title": { "text": "Percentage N-Count" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": 100, "minallowed": 0, "maxallowed": null }, "range": [ 0, 5 ] } }, "trace_params": { "hovertemplate": "%{text}
Base %{x}: %{y:.2f}%", "mode": "lines", "line": { "width": 2 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "n_samples": 64, "lines": [ { "name": "CAFS1_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0012199510799616935 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAFS2_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0006603100816143261 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.00013206376038351315 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAMS1_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0002721588318942935 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAMS2_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0011956430766287647 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCFS1_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0023074757599671415 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.6105418628265485 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCFS2_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0009852265282094986 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.00019708316909735908 ], [ 185, 0.0 ], [ 190, 9.854304113679253e-05 ], [ 195, 9.854342956756185e-05 ], [ 200, 0.6307802222167476 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 9.854974199677546e-05 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 9.855819220621527e-05 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.00024813218497758124 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCMS1_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0023810657650364304 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.6208299004176648 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCMS2_R1", "pairs": [ [ 1, 0.0005078126983643353 ], [ 2, 0.002031250793457341 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.00010156976065085902 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.00010156976065085902 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.00010157130813687751 ], [ 200, 0.6376646724833169 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.00010157213348203495 ], [ 220, 0.0001015723398204201 ], [ 225, 0.00010157326835352779 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0003047263049904011 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.00010157708583466906 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.00010161290158688869 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPFS1_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.004675956233049659 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.6189575802927755 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPFS2_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.003348363766239564 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.00033483637662395645 ], [ 35, 0.0003348408612999862 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.6200814868560586 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.00011164140779815233 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPMS1_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0026555252628970008 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.6202332735763451 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 8.853937478805886e-05 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPMS2_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0039066887394580445 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.6106870229007634 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.00019536420283102266 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 9.772047449153595e-05 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVFS1_R1", "pairs": [ [ 1, 0.0009115687186078523 ], [ 2, 0.004102059233735335 ], [ 3, 0.00045578435930392617 ], [ 4, 0.00045578435930392617 ], [ 5, 0.00045578435930392617 ], [ 6, 0.00045578435930392617 ], [ 7, 0.00045578435930392617 ], [ 8, 0.00045578435930392617 ], [ 9, 0.00045578435930392617 ], [ 10, 0.00045578435930392617 ], [ 15, 0.00045578435930392617 ], [ 20, 0.00045578435930392617 ], [ 25, 0.00045578435930392617 ], [ 30, 0.00045578435930392617 ], [ 35, 9.115720424500868e-05 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.6296062636068251 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 9.117432530999271e-05 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVFS2_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.004353336106569668 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.630780542548663 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVMS1_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0021814532841779193 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.6308291427137761 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVMS2_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0021895732521731515 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.6190768152754664 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 8.759681638130545e-05 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 8.760502747731688e-05 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAFS1_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0002226080762210053 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAFS2_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0026652452025586353 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0005337717378540241 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAMS1_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAMS2_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCFS1_R1", "pairs": [ [ 1, 0.002444270629644114 ], [ 2, 0.006518055012384304 ], [ 3, 0.002444270629644114 ], [ 4, 0.002444270629644114 ], [ 5, 0.002444270629644114 ], [ 6, 0.002444270629644114 ], [ 7, 0.002444270629644114 ], [ 8, 0.002444270629644114 ], [ 9, 0.002444270629644114 ], [ 10, 0.002444270629644114 ], [ 15, 0.002444270629644114 ], [ 20, 0.002444270629644114 ], [ 25, 0.002444270629644114 ], [ 30, 0.002444270629644114 ], [ 35, 0.0004888652785065491 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.6302689223659678 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCFS2_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.002805639335063478 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.6021710969187167 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCMS1_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.004137719868089491 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.6152923508425479 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 8.29898934907707e-05 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCMS2_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.005307799280262418 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.6310782489933361 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPFS1_R1", "pairs": [ [ 1, 0.0007044337057439524 ], [ 2, 0.002113301117231857 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.00014100613517694155 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.00014102741290852115 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.00014106640559977202 ], [ 200, 0.6056032050558627 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0001410936735007739 ], [ 220, 0.0 ], [ 225, 0.00014110362791537733 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.00028222278666779557 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.00014111517679614926 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPFS2_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0022708864783849455 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.00015210675460465174 ], [ 185, 0.00015216855406396558 ], [ 190, 0.0 ], [ 195, 0.0003046597712005118 ], [ 200, 0.6313656481629606 ], [ 205, 0.00015239813708517227 ], [ 210, 0.0 ], [ 215, 0.00015247877114308762 ], [ 220, 0.0 ], [ 225, 0.00030500590948949637 ], [ 230, 0.00015250946702516558 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0003050691820637625 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.00015255855960310364 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.000305205586483055 ], [ 295, 0.0004599674956303088 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPMS1_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0012194675804543737 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.6447042153737159 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPMS2_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0011522064754003918 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.6384398515771658 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.00046194710705624206 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVFS1_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.004168982768204558 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.6040959430129668 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVFS2_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.005912262031453234 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.6134653669116571 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVMS1_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.004220452311903484 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.6327401997720203 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.00012083336354167422 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVMS2_R1", "pairs": [ [ 1, 0.0006208904811280338 ], [ 2, 0.0012417809622560676 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.00012417809622560676 ], [ 35, 0.00012417871303665383 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.6447280053727333 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.00012477322466417288 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAFS1_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0018239077832224802 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.00012159607001501712 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0002431945057497261 ], [ 295, 0.0 ], [ 300, 0.00030528198897321454 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAFS2_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0007825644637477012 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAMS1_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0006590654451987082 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAMS2_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0006593131275836833 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICFS1_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.001429500603964005 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0001430338918806811 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0002860718755587341 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0002860964288013275 ], [ 200, 0.6042356576284037 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.00014304821440066376 ], [ 220, 0.0 ], [ 225, 0.00028610052141820024 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.00042915999084458686 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.00028610870700322585 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICFS2_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.005207851124895843 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.00034734483816625084 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0006946896763325017 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0003473971270257595 ], [ 200, 0.6319153740598565 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0003473971270257595 ], [ 220, 0.00011579904234191984 ], [ 225, 0.00034741281675363566 ], [ 230, 0.0 ], [ 235, 0.00011580856381167675 ], [ 240, 0.0 ], [ 245, 0.0006948546016745996 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.00034742850789878715 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.00011589701391343653 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICMS1_R1", "pairs": [ [ 1, 0.0005131441883854945 ], [ 2, 0.0061577302606259324 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.00010262883767709889 ], [ 35, 0.00010262936431371744 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.00010263568437474341 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.00010263726451162623 ], [ 180, 0.00020527473971163003 ], [ 185, 0.0 ], [ 190, 0.000102639898181221 ], [ 195, 0.0 ], [ 200, 0.6188159461345815 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.000102639898181221 ], [ 225, 0.0001026407409840373 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.00010264095168690404 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.00010270093180555427 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICMS2_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.004774599132614491 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.00015915330442048303 ], [ 35, 0.0001591543176179055 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.00015916343697525804 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.6412745909467116 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.00015916597031554654 ], [ 225, 0.00015916749035842928 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.00015919586982235333 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPFS1_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0018637939389421108 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.6198775903315003 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.00024858060474689523 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPFS2_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0022278860035289715 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.6237689942515932 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 8.912354127043825e-05 ], [ 230, 8.912417671541759e-05 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 8.913076999180889e-05 ], [ 295, 0.00017832607100409168 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPMS1_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.002602969120109672 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.6139125353974494 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.00017356038889097803 ], [ 275, 5.785440014533025e-05 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 5.785637502039437e-05 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPMS2_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.004916239568354166 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 8.19373261392361e-05 ], [ 35, 8.193759468913287e-05 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.6283035721602597 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVFS1_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0030575296034384106 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.6130204602239966 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 8.736256776059161e-05 ], [ 225, 8.736256776059161e-05 ], [ 230, 8.736256776059161e-05 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 8.736256776059161e-05 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.00017481249175103555 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVFS2_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0023544184586407157 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.00015701421763740706 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0003140318867977854 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.00015701791574418642 ], [ 200, 0.6329392183648155 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.00015701865538644648 ], [ 220, 0.0 ], [ 225, 0.0003140397762780634 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.00047106484207551174 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.00015702161402517058 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.00015718204038006617 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVMS1_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.005124296209942415 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.6109433986450542 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVMS2_R1", "pairs": [ [ 1, 0.000911269672034045 ], [ 2, 0.002733809016102135 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.600913125495521 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.00018226556092226375 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.00018227021194380246 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAFS1_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0007554581853894387 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0001511030522816561 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.00015110419389690162 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.00030220838779380324 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0003022239146761444 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAFS2_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0011883682515537914 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.00023771602443720732 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAMS1_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0006118340950667817 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.00012237430629065123 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAMS2_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.00013537551814979572 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0001353958636563653 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCFS1_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.003187352584942946 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.6163577085095621 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCFS2_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0059131166066594834 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.6098282229553011 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCMS1_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.00681591454082423 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.00024785143784815383 ], [ 35, 0.00012392633323047447 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.6212150132745666 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.00012395797824537482 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCMS2_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.003923045538712614 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.6294194743327134 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.00015696985393955093 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPFS1_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.004280400474268372 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.6231593726457092 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 8.561086778600023e-05 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 8.56129933127691e-05 ], [ 295, 8.564532898940225e-05 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPFS2_R1", "pairs": [ [ 1, 0.0004956089051008069 ], [ 2, 0.0024780445255040344 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.6295567527916693 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 9.912865908662854e-05 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 9.916591548485686e-05 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPMS1_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0037860323800419306 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.6298720661110085 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0001893356684732445 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 9.466783423662225e-05 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPMS2_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0022356193783487715 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.6220652028084612 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0004472145243351784 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0001490757304710793 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0004474626629696307 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVFS1_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0027323648617878773 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.6241344121291639 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVFS2_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.005331378494551998 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.6295444699923356 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVMS1_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0020154846808767934 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.6270034878329066 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVMS2_R1", "pairs": [ [ 1, 0.0 ], [ 2, 0.002557021581262146 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 15, 0.0 ], [ 20, 0.0 ], [ 25, 0.0 ], [ 30, 0.0 ], [ 35, 0.0 ], [ 40, 0.0 ], [ 45, 0.0 ], [ 50, 0.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.629640680277908 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.00017052188222053594 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 0.0 ], [ 300, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null } ] } ], "pconfig": { "id": "fastqc_per_base_n_content_plot", "title": "FastQC: Per Base N Content", "anchor": null, "table_title": null, "height": null, "width": null, "square": false, "logswitch": false, "logswitch_active": false, "logswitch_label": "Log10", "cpswitch": true, "cpswitch_c_active": true, "cpswitch_counts_label": "Counts", "cpswitch_percent_label": "Percentages", "xLog": null, "yLog": null, "xlog": false, "ylog": false, "data_labels": [], "xTitle": null, "yTitle": null, "xlab": "Position in Read (bp)", "ylab": "Percentage N-Count", "xsuffix": null, "ysuffix": null, "tt_suffix": null, "xLabFormat": null, "yLabFormat": null, "xLabelFormat": null, "yLabelFormat": null, "xlab_format": null, "ylab_format": null, "tt_label": "Base {point.x}: {point.y:.2f}%", "xDecimals": null, "yDecimals": null, "decimalPlaces": null, "x_decimals": null, "y_decimals": null, "tt_decimals": null, "xmin": 0, "xmax": null, "ymin": 0, "ymax": null, "xFloor": null, "xCeiling": null, "yFloor": null, "yCeiling": null, "x_clipmin": null, "x_clipmax": null, "y_clipmin": null, "y_clipmax": 100, "save_data_file": true, "showlegend": false, "xMinRange": null, "yMinRange": null, "x_minrange": null, "y_minrange": 5, "xPlotBands": null, "yPlotBands": null, "xPlotLines": null, "yPlotLines": null, "x_bands": null, "y_bands": [ { "from_": 20, "to": 100, "color": "#e6c3c3" }, { "from_": 5, "to": 20, "color": "#e6dcc3" }, { "from_": 0, "to": 5, "color": "#c3e6c3" } ], "x_lines": null, "y_lines": null, "categories": false, "smooth_points": 500, "smooth_points_sumcounts": null, "extra_series": null, "style": null, "hide_zero_cats": false, "hide_empty": false, "colors": { "CAFS1_R1": "#5cb85c", "CAFS2_R1": "#5cb85c", "CAMS1_R1": "#5cb85c", "CAMS2_R1": "#5cb85c", "CCFS1_R1": "#5cb85c", "CCFS2_R1": "#5cb85c", "CCMS1_R1": "#5cb85c", "CCMS2_R1": "#5cb85c", "CPFS1_R1": "#5cb85c", "CPFS2_R1": "#5cb85c", "CPMS1_R1": "#5cb85c", "CPMS2_R1": "#5cb85c", "CVFS1_R1": "#5cb85c", "CVFS2_R1": "#5cb85c", "CVMS1_R1": "#5cb85c", "CVMS2_R1": "#5cb85c", "DAFS1_R1": "#5cb85c", "DAFS2_R1": "#5cb85c", "DAMS1_R1": "#5cb85c", "DAMS2_R1": "#5cb85c", "DCFS1_R1": "#5cb85c", "DCFS2_R1": "#5cb85c", "DCMS1_R1": "#5cb85c", "DCMS2_R1": "#5cb85c", "DPFS1_R1": "#5cb85c", "DPFS2_R1": "#5cb85c", "DPMS1_R1": "#5cb85c", "DPMS2_R1": "#5cb85c", "DVFS1_R1": "#5cb85c", "DVFS2_R1": "#5cb85c", "DVMS1_R1": "#5cb85c", "DVMS2_R1": "#5cb85c", "IAFS1_R1": "#5cb85c", "IAFS2_R1": "#5cb85c", "IAMS1_R1": "#5cb85c", "IAMS2_R1": "#5cb85c", "ICFS1_R1": "#5cb85c", "ICFS2_R1": "#5cb85c", "ICMS1_R1": "#5cb85c", "ICMS2_R1": "#5cb85c", "IPFS1_R1": "#5cb85c", "IPFS2_R1": "#5cb85c", "IPMS1_R1": "#5cb85c", "IPMS2_R1": "#5cb85c", "IVFS1_R1": "#5cb85c", "IVFS2_R1": "#5cb85c", "IVMS1_R1": "#5cb85c", "IVMS2_R1": "#5cb85c", "JAFS1_R1": "#5cb85c", "JAFS2_R1": "#5cb85c", "JAMS1_R1": "#5cb85c", "JAMS2_R1": "#5cb85c", "JCFS1_R1": "#5cb85c", "JCFS2_R1": "#5cb85c", "JCMS1_R1": "#5cb85c", "JCMS2_R1": "#5cb85c", "JPFS1_R1": "#5cb85c", "JPFS2_R1": "#5cb85c", "JPMS1_R1": "#5cb85c", "JPMS2_R1": "#5cb85c", "JVFS1_R1": "#5cb85c", "JVFS2_R1": "#5cb85c", "JVMS1_R1": "#5cb85c", "JVMS2_R1": "#5cb85c" } }, "add_log_tab": false, "add_pct_tab": false, "l_active": false, "p_active": false, "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "yaxis" ], "square": false, "flat": false, "defer_render": false }, "fastqc_sequence_length_distribution_plot": { "id": "fastqc_sequence_length_distribution_plot", "anchor": "fastqc_sequence_length_distribution_plot", "plot_type": "xy_line", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 500, "hoverlabel": { "namelength": -1 }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "white", "plot_bgcolor": "white", "showlegend": false, "title": { "font": { "size": 20 }, "text": "FastQC: Sequence Length Distribution", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "hoverdistance": -1 }, "datasets": [ { "plot_id": "fastqc_sequence_length_distribution_plot", "label": "1", "uid": "fastqc_sequence_length_distribution_plot", "dconfig": { "title": "FastQC: Sequence Length Distribution
64 samples" }, "layout": { "title": { "text": "FastQC: Sequence Length Distribution
64 samples" }, "xaxis": { "hoverformat": null, "ticksuffix": " bp", "title": { "text": "Sequence Length (bp)" }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "yaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "Read Count" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": null } } }, "trace_params": { "hovertemplate": "%{text}
%{x}: %{y}", "mode": "lines", "line": { "width": 2 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "n_samples": 64, "lines": [ { "name": "CAFS1_R1", "pairs": [ [ 30, 1.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 2.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 1.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 1.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0 ], [ 210, 0.0 ], [ 220, 1.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0 ], [ 260, 1.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 112.0 ], [ 300, 163822.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAFS2_R1", "pairs": [ [ 224, 1.0 ], [ 226, 0.0 ], [ 228, 0.0 ], [ 230, 0.0 ], [ 232, 0.0 ], [ 234, 0.0 ], [ 236, 0.0 ], [ 238, 0.0 ], [ 240, 0.0 ], [ 242, 0.0 ], [ 244, 0.0 ], [ 246, 0.0 ], [ 248, 0.0 ], [ 250, 0.0 ], [ 252, 0.0 ], [ 254, 1.0 ], [ 256, 0.0 ], [ 258, 0.0 ], [ 260, 0.0 ], [ 262, 0.0 ], [ 264, 0.0 ], [ 266, 0.0 ], [ 268, 0.0 ], [ 270, 0.0 ], [ 272, 0.0 ], [ 274, 0.0 ], [ 276, 0.0 ], [ 278, 0.0 ], [ 280, 0.0 ], [ 282, 0.0 ], [ 284, 0.0 ], [ 286, 0.0 ], [ 288, 0.0 ], [ 290, 0.0 ], [ 292, 0.0 ], [ 294, 1.0 ], [ 296, 8.0 ], [ 298, 104.0 ], [ 300, 151329.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAMS1_R1", "pairs": [ [ 100, 3.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 1.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 1.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 138.0 ], [ 300, 146835.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAMS2_R1", "pairs": [ [ 65, 1.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 2.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 1.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 1.0 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 3.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 2.0 ], [ 260, 0.0 ], [ 265, 1.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 4.0 ], [ 295, 162.0 ], [ 300, 167097.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCFS1_R1", "pairs": [ [ 40, 1.0 ], [ 50, 2.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 1.0 ], [ 90, 0.0 ], [ 100, 2.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 1.0 ], [ 140, 0.0 ], [ 150, 3.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 17.0 ], [ 190, 0.0 ], [ 200, 1.0 ], [ 210, 0.0 ], [ 220, 7.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 1.0 ], [ 260, 1.0 ], [ 270, 4.0 ], [ 280, 4.0 ], [ 290, 393.0 ], [ 300, 216249.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCFS2_R1", "pairs": [ [ 40, 5.0 ], [ 50, 3.0 ], [ 60, 0.0 ], [ 70, 1.0 ], [ 80, 1.0 ], [ 90, 0.0 ], [ 100, 8.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 5.0 ], [ 140, 2.0 ], [ 150, 4.0 ], [ 160, 9.0 ], [ 170, 1.0 ], [ 180, 3.0 ], [ 190, 2.0 ], [ 200, 1.0 ], [ 210, 0.0 ], [ 220, 23.0 ], [ 230, 5.0 ], [ 240, 1.0 ], [ 250, 1.0 ], [ 260, 3.0 ], [ 270, 15.0 ], [ 280, 7.0 ], [ 290, 632.0 ], [ 300, 202267.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCMS1_R1", "pairs": [ [ 95, 1.0 ], [ 100, 4.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 1.0 ], [ 145, 3.0 ], [ 150, 0.0 ], [ 155, 1.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 1.0 ], [ 185, 2.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 6.0 ], [ 230, 0.0 ], [ 235, 1.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 1.0 ], [ 265, 2.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 1.0 ], [ 285, 1.0 ], [ 290, 2.0 ], [ 295, 283.0 ], [ 300, 209680.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCMS2_R1", "pairs": [ [ 50, 1.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 1.0 ], [ 75, 0.0 ], [ 80, 1.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 1.0 ], [ 100, 5.0 ], [ 105, 0.0 ], [ 110, 1.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 1.0 ], [ 135, 2.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 1.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 3.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 1.0 ], [ 210, 0.0 ], [ 215, 1.0 ], [ 220, 0.0 ], [ 225, 4.0 ], [ 230, 0.0 ], [ 235, 2.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 2.0 ], [ 255, 1.0 ], [ 260, 0.0 ], [ 265, 1.0 ], [ 270, 1.0 ], [ 275, 1.0 ], [ 280, 3.0 ], [ 285, 1.0 ], [ 290, 2.0 ], [ 295, 316.0 ], [ 300, 196570.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPFS1_R1", "pairs": [ [ 30, 1.0 ], [ 40, 13.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 1.0 ], [ 80, 1.0 ], [ 90, 0.0 ], [ 100, 1.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 1.0 ], [ 150, 9.0 ], [ 160, 1.0 ], [ 170, 0.0 ], [ 180, 3.0 ], [ 190, 0.0 ], [ 200, 0.0 ], [ 210, 1.0 ], [ 220, 1.0 ], [ 230, 0.0 ], [ 240, 2.0 ], [ 250, 0.0 ], [ 260, 0.0 ], [ 270, 17.0 ], [ 280, 3.0 ], [ 290, 1325.0 ], [ 300, 148322.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPFS2_R1", "pairs": [ [ 30, 3.0 ], [ 40, 1.0 ], [ 50, 3.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 1.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 1.0 ], [ 120, 0.0 ], [ 130, 5.0 ], [ 140, 0.0 ], [ 150, 1.0 ], [ 160, 1.0 ], [ 170, 0.0 ], [ 180, 5.0 ], [ 190, 1.0 ], [ 200, 0.0 ], [ 210, 0.0 ], [ 220, 5.0 ], [ 230, 1.0 ], [ 240, 0.0 ], [ 250, 0.0 ], [ 260, 1.0 ], [ 270, 9.0 ], [ 280, 9.0 ], [ 290, 463.0 ], [ 300, 178682.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPMS1_R1", "pairs": [ [ 50, 2.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 1.0 ], [ 75, 0.0 ], [ 80, 3.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 2.0 ], [ 100, 12.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 3.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 1.0 ], [ 150, 0.0 ], [ 155, 1.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 1.0 ], [ 185, 2.0 ], [ 190, 0.0 ], [ 195, 1.0 ], [ 200, 1.0 ], [ 205, 1.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 2.0 ], [ 225, 13.0 ], [ 230, 0.0 ], [ 235, 4.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 1.0 ], [ 260, 0.0 ], [ 265, 4.0 ], [ 270, 1.0 ], [ 275, 5.0 ], [ 280, 3.0 ], [ 285, 3.0 ], [ 290, 3.0 ], [ 295, 539.0 ], [ 300, 225335.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPMS2_R1", "pairs": [ [ 30, 1.0 ], [ 40, 1.0 ], [ 50, 1.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 1.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 3.0 ], [ 140, 1.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 1.0 ], [ 180, 14.0 ], [ 190, 1.0 ], [ 200, 0.0 ], [ 210, 0.0 ], [ 220, 7.0 ], [ 230, 0.0 ], [ 240, 1.0 ], [ 250, 0.0 ], [ 260, 0.0 ], [ 270, 5.0 ], [ 280, 20.0 ], [ 290, 314.0 ], [ 300, 204406.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVFS1_R1", "pairs": [ [ 30, 1.0 ], [ 40, 4.0 ], [ 50, 4.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 1.0 ], [ 90, 0.0 ], [ 100, 6.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 1.0 ], [ 140, 1.0 ], [ 150, 0.0 ], [ 160, 3.0 ], [ 170, 1.0 ], [ 180, 2.0 ], [ 190, 1.0 ], [ 200, 8.0 ], [ 210, 0.0 ], [ 220, 6.0 ], [ 230, 3.0 ], [ 240, 0.0 ], [ 250, 2.0 ], [ 260, 2.0 ], [ 270, 6.0 ], [ 280, 10.0 ], [ 290, 455.0 ], [ 300, 218885.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVFS2_R1", "pairs": [ [ 40, 1.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 1.0 ], [ 100, 1.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 1.0 ], [ 140, 0.0 ], [ 150, 1.0 ], [ 160, 1.0 ], [ 170, 0.0 ], [ 180, 3.0 ], [ 190, 1.0 ], [ 200, 0.0 ], [ 210, 0.0 ], [ 220, 8.0 ], [ 230, 1.0 ], [ 240, 0.0 ], [ 250, 0.0 ], [ 260, 3.0 ], [ 270, 5.0 ], [ 280, 8.0 ], [ 290, 300.0 ], [ 300, 206403.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVMS1_R1", "pairs": [ [ 30, 1.0 ], [ 40, 1.0 ], [ 50, 1.0 ], [ 60, 0.0 ], [ 70, 1.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 1.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 6.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 1.0 ], [ 180, 4.0 ], [ 190, 1.0 ], [ 200, 5.0 ], [ 210, 0.0 ], [ 220, 5.0 ], [ 230, 3.0 ], [ 240, 0.0 ], [ 250, 0.0 ], [ 260, 0.0 ], [ 270, 1.0 ], [ 280, 5.0 ], [ 290, 217.0 ], [ 300, 183111.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVMS2_R1", "pairs": [ [ 50, 3.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 1.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 4.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 2.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 1.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 1.0 ], [ 170, 0.0 ], [ 175, 1.0 ], [ 180, 1.0 ], [ 185, 0.0 ], [ 190, 1.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 1.0 ], [ 225, 11.0 ], [ 230, 0.0 ], [ 235, 6.0 ], [ 240, 1.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 1.0 ], [ 260, 0.0 ], [ 265, 1.0 ], [ 270, 1.0 ], [ 275, 5.0 ], [ 280, 9.0 ], [ 285, 6.0 ], [ 290, 3.0 ], [ 295, 363.0 ], [ 300, 227932.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAFS1_R1", "pairs": [ [ 75, 6.0 ], [ 80, 0.0 ], [ 85, 3.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 4.0 ], [ 110, 3.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 2.0 ], [ 130, 0.0 ], [ 135, 1.0 ], [ 140, 3.0 ], [ 145, 3.0 ], [ 150, 0.0 ], [ 155, 1.0 ], [ 160, 2.0 ], [ 165, 0.0 ], [ 170, 6.0 ], [ 175, 1.0 ], [ 180, 0.0 ], [ 185, 5.0 ], [ 190, 8.0 ], [ 195, 6.0 ], [ 200, 2.0 ], [ 205, 4.0 ], [ 210, 4.0 ], [ 215, 3.0 ], [ 220, 0.0 ], [ 225, 1.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 1.0 ], [ 245, 1.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 3.0 ], [ 265, 0.0 ], [ 270, 1.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 1.0 ], [ 290, 0.0 ], [ 295, 671.0 ], [ 300, 89173.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAFS2_R1", "pairs": [ [ 30, 1.0 ], [ 40, 0.0 ], [ 50, 1.0 ], [ 60, 1.0 ], [ 70, 13.0 ], [ 80, 5.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 4.0 ], [ 120, 2.0 ], [ 130, 2.0 ], [ 140, 6.0 ], [ 150, 0.0 ], [ 160, 3.0 ], [ 170, 1.0 ], [ 180, 6.0 ], [ 190, 0.0 ], [ 200, 1.0 ], [ 210, 2.0 ], [ 220, 0.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0 ], [ 260, 1.0 ], [ 270, 1.0 ], [ 280, 0.0 ], [ 290, 542.0 ], [ 300, 36928.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAMS1_R1", "pairs": [ [ 75, 7.0 ], [ 80, 0.0 ], [ 85, 4.0 ], [ 90, 0.0 ], [ 95, 1.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 2.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 1.0 ], [ 135, 1.0 ], [ 140, 4.0 ], [ 145, 0.0 ], [ 150, 1.0 ], [ 155, 1.0 ], [ 160, 0.0 ], [ 165, 3.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 3.0 ], [ 190, 5.0 ], [ 195, 0.0 ], [ 200, 3.0 ], [ 205, 2.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 1.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 3.0 ], [ 250, 0.0 ], [ 255, 1.0 ], [ 260, 0.0 ], [ 265, 1.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 0.0 ], [ 295, 984.0 ], [ 300, 62598.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAMS2_R1", "pairs": [ [ 40, 1.0 ], [ 50, 0.0 ], [ 60, 1.0 ], [ 70, 1.0 ], [ 80, 5.0 ], [ 90, 0.0 ], [ 100, 1.0 ], [ 110, 5.0 ], [ 120, 1.0 ], [ 130, 0.0 ], [ 140, 3.0 ], [ 150, 2.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 10.0 ], [ 190, 8.0 ], [ 200, 6.0 ], [ 210, 12.0 ], [ 220, 1.0 ], [ 230, 0.0 ], [ 240, 4.0 ], [ 250, 1.0 ], [ 260, 1.0 ], [ 270, 2.0 ], [ 280, 1.0 ], [ 290, 1030.0 ], [ 300, 79723.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCFS1_R1", "pairs": [ [ 30, 4.0 ], [ 40, 2.0 ], [ 50, 0.0 ], [ 60, 10.0 ], [ 70, 0.0 ], [ 80, 8.0 ], [ 90, 1.0 ], [ 100, 12.0 ], [ 110, 19.0 ], [ 120, 5.0 ], [ 130, 23.0 ], [ 140, 84.0 ], [ 150, 5.0 ], [ 160, 15.0 ], [ 170, 35.0 ], [ 180, 40.0 ], [ 190, 80.0 ], [ 200, 15.0 ], [ 210, 27.0 ], [ 220, 7.0 ], [ 230, 15.0 ], [ 240, 8.0 ], [ 250, 11.0 ], [ 260, 4.0 ], [ 270, 7.0 ], [ 280, 3.0 ], [ 290, 2083.0 ], [ 300, 120213.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCFS2_R1", "pairs": [ [ 40, 3.0 ], [ 50, 2.0 ], [ 60, 11.0 ], [ 70, 3.0 ], [ 80, 19.0 ], [ 90, 5.0 ], [ 100, 19.0 ], [ 110, 49.0 ], [ 120, 28.0 ], [ 130, 50.0 ], [ 140, 129.0 ], [ 150, 22.0 ], [ 160, 29.0 ], [ 170, 49.0 ], [ 180, 48.0 ], [ 190, 107.0 ], [ 200, 23.0 ], [ 210, 62.0 ], [ 220, 16.0 ], [ 230, 10.0 ], [ 240, 14.0 ], [ 250, 9.0 ], [ 260, 8.0 ], [ 270, 18.0 ], [ 280, 30.0 ], [ 290, 3394.0 ], [ 300, 67128.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCMS1_R1", "pairs": [ [ 30, 1.0 ], [ 40, 18.0 ], [ 50, 0.0 ], [ 60, 6.0 ], [ 70, 11.0 ], [ 80, 12.0 ], [ 90, 2.0 ], [ 100, 9.0 ], [ 110, 15.0 ], [ 120, 30.0 ], [ 130, 42.0 ], [ 140, 33.0 ], [ 150, 6.0 ], [ 160, 9.0 ], [ 170, 7.0 ], [ 180, 18.0 ], [ 190, 13.0 ], [ 200, 9.0 ], [ 210, 5.0 ], [ 220, 15.0 ], [ 230, 1.0 ], [ 240, 4.0 ], [ 250, 10.0 ], [ 260, 0.0 ], [ 270, 6.0 ], [ 280, 3.0 ], [ 290, 2560.0 ], [ 300, 238834.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCMS2_R1", "pairs": [ [ 30, 1.0 ], [ 40, 24.0 ], [ 50, 2.0 ], [ 60, 20.0 ], [ 70, 50.0 ], [ 80, 44.0 ], [ 90, 10.0 ], [ 100, 18.0 ], [ 110, 72.0 ], [ 120, 16.0 ], [ 130, 75.0 ], [ 140, 106.0 ], [ 150, 25.0 ], [ 160, 42.0 ], [ 170, 65.0 ], [ 180, 72.0 ], [ 190, 131.0 ], [ 200, 33.0 ], [ 210, 50.0 ], [ 220, 9.0 ], [ 230, 28.0 ], [ 240, 12.0 ], [ 250, 20.0 ], [ 260, 10.0 ], [ 270, 18.0 ], [ 280, 14.0 ], [ 290, 4241.0 ], [ 300, 88993.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPFS1_R1", "pairs": [ [ 40, 8.0 ], [ 50, 1.0 ], [ 60, 2.0 ], [ 70, 2.0 ], [ 80, 14.0 ], [ 90, 2.0 ], [ 100, 4.0 ], [ 110, 13.0 ], [ 120, 18.0 ], [ 130, 13.0 ], [ 140, 28.0 ], [ 150, 3.0 ], [ 160, 18.0 ], [ 170, 9.0 ], [ 180, 29.0 ], [ 190, 18.0 ], [ 200, 23.0 ], [ 210, 4.0 ], [ 220, 16.0 ], [ 230, 0.0 ], [ 240, 1.0 ], [ 250, 2.0 ], [ 260, 5.0 ], [ 270, 5.0 ], [ 280, 4.0 ], [ 290, 1538.0 ], [ 300, 140178.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPFS2_R1", "pairs": [ [ 30, 2.0 ], [ 40, 16.0 ], [ 50, 0.0 ], [ 60, 21.0 ], [ 70, 32.0 ], [ 80, 48.0 ], [ 90, 3.0 ], [ 100, 25.0 ], [ 110, 60.0 ], [ 120, 25.0 ], [ 130, 53.0 ], [ 140, 147.0 ], [ 150, 19.0 ], [ 160, 41.0 ], [ 170, 84.0 ], [ 180, 120.0 ], [ 190, 138.0 ], [ 200, 45.0 ], [ 210, 79.0 ], [ 220, 6.0 ], [ 230, 20.0 ], [ 240, 7.0 ], [ 250, 9.0 ], [ 260, 11.0 ], [ 270, 14.0 ], [ 280, 17.0 ], [ 290, 3190.0 ], [ 300, 127875.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPMS1_R1", "pairs": [ [ 30, 1.0 ], [ 40, 3.0 ], [ 50, 7.0 ], [ 60, 30.0 ], [ 70, 3.0 ], [ 80, 14.0 ], [ 90, 2.0 ], [ 100, 11.0 ], [ 110, 10.0 ], [ 120, 5.0 ], [ 130, 8.0 ], [ 140, 33.0 ], [ 150, 4.0 ], [ 160, 1.0 ], [ 170, 18.0 ], [ 180, 26.0 ], [ 190, 21.0 ], [ 200, 6.0 ], [ 210, 21.0 ], [ 220, 8.0 ], [ 230, 1.0 ], [ 240, 2.0 ], [ 250, 2.0 ], [ 260, 11.0 ], [ 270, 6.0 ], [ 280, 4.0 ], [ 290, 504.0 ], [ 300, 81241.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPMS2_R1", "pairs": [ [ 40, 4.0 ], [ 50, 0.0 ], [ 60, 6.0 ], [ 70, 20.0 ], [ 80, 6.0 ], [ 90, 1.0 ], [ 100, 2.0 ], [ 110, 14.0 ], [ 120, 2.0 ], [ 130, 9.0 ], [ 140, 16.0 ], [ 150, 10.0 ], [ 160, 7.0 ], [ 170, 12.0 ], [ 180, 28.0 ], [ 190, 34.0 ], [ 200, 9.0 ], [ 210, 12.0 ], [ 220, 2.0 ], [ 230, 1.0 ], [ 240, 2.0 ], [ 250, 2.0 ], [ 260, 1.0 ], [ 270, 5.0 ], [ 280, 13.0 ], [ 290, 738.0 ], [ 300, 85834.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVFS1_R1", "pairs": [ [ 40, 2.0 ], [ 50, 0.0 ], [ 60, 3.0 ], [ 70, 1.0 ], [ 80, 6.0 ], [ 90, 1.0 ], [ 100, 1.0 ], [ 110, 7.0 ], [ 120, 3.0 ], [ 130, 6.0 ], [ 140, 16.0 ], [ 150, 3.0 ], [ 160, 2.0 ], [ 170, 12.0 ], [ 180, 7.0 ], [ 190, 14.0 ], [ 200, 3.0 ], [ 210, 7.0 ], [ 220, 3.0 ], [ 230, 5.0 ], [ 240, 8.0 ], [ 250, 0.0 ], [ 260, 2.0 ], [ 270, 5.0 ], [ 280, 9.0 ], [ 290, 837.0 ], [ 300, 70997.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVFS2_R1", "pairs": [ [ 30, 1.0 ], [ 40, 2.0 ], [ 50, 0.0 ], [ 60, 6.0 ], [ 70, 2.0 ], [ 80, 22.0 ], [ 90, 3.0 ], [ 100, 6.0 ], [ 110, 27.0 ], [ 120, 7.0 ], [ 130, 49.0 ], [ 140, 130.0 ], [ 150, 15.0 ], [ 160, 9.0 ], [ 170, 23.0 ], [ 180, 51.0 ], [ 190, 65.0 ], [ 200, 21.0 ], [ 210, 60.0 ], [ 220, 10.0 ], [ 230, 11.0 ], [ 240, 5.0 ], [ 250, 5.0 ], [ 260, 6.0 ], [ 270, 15.0 ], [ 280, 18.0 ], [ 290, 2207.0 ], [ 300, 98708.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVMS1_R1", "pairs": [ [ 30, 1.0 ], [ 40, 13.0 ], [ 50, 0.0 ], [ 60, 3.0 ], [ 70, 53.0 ], [ 80, 3.0 ], [ 90, 5.0 ], [ 100, 4.0 ], [ 110, 2.0 ], [ 120, 3.0 ], [ 130, 15.0 ], [ 140, 26.0 ], [ 150, 3.0 ], [ 160, 4.0 ], [ 170, 11.0 ], [ 180, 39.0 ], [ 190, 40.0 ], [ 200, 29.0 ], [ 210, 10.0 ], [ 220, 36.0 ], [ 230, 9.0 ], [ 240, 1.0 ], [ 250, 4.0 ], [ 260, 4.0 ], [ 270, 10.0 ], [ 280, 11.0 ], [ 290, 2845.0 ], [ 300, 162675.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVMS2_R1", "pairs": [ [ 30, 1.0 ], [ 40, 9.0 ], [ 50, 1.0 ], [ 60, 6.0 ], [ 70, 44.0 ], [ 80, 16.0 ], [ 90, 0.0 ], [ 100, 5.0 ], [ 110, 12.0 ], [ 120, 5.0 ], [ 130, 11.0 ], [ 140, 42.0 ], [ 150, 18.0 ], [ 160, 12.0 ], [ 170, 10.0 ], [ 180, 54.0 ], [ 190, 1.0 ], [ 200, 4.0 ], [ 210, 5.0 ], [ 220, 26.0 ], [ 230, 8.0 ], [ 240, 2.0 ], [ 250, 0.0 ], [ 260, 7.0 ], [ 270, 4.0 ], [ 280, 7.0 ], [ 290, 2376.0 ], [ 300, 158373.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAFS1_R1", "pairs": [ [ 50, 1.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 1.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 1.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 7.0 ], [ 295, 391.0 ], [ 300, 164081.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAFS2_R1", "pairs": [ [ 50, 1.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 1.0 ], [ 270, 0.0 ], [ 275, 2.0 ], [ 280, 0.0 ], [ 285, 1.0 ], [ 290, 4.0 ], [ 295, 456.0 ], [ 300, 127320.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAMS1_R1", "pairs": [ [ 50, 4.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 2.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 1.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 1.0 ], [ 285, 0.0 ], [ 290, 6.0 ], [ 295, 492.0 ], [ 300, 151224.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAMS2_R1", "pairs": [ [ 50, 1.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 1.0 ], [ 75, 0.0 ], [ 80, 0.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 5.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 1.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 4.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 4.0 ], [ 295, 365.0 ], [ 300, 151292.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICFS1_R1", "pairs": [ [ 30, 3.0 ], [ 40, 31.0 ], [ 50, 0.0 ], [ 60, 1.0 ], [ 70, 0.0 ], [ 80, 7.0 ], [ 90, 0.0 ], [ 100, 1.0 ], [ 110, 0.0 ], [ 120, 7.0 ], [ 130, 9.0 ], [ 140, 16.0 ], [ 150, 6.0 ], [ 160, 1.0 ], [ 170, 2.0 ], [ 180, 12.0 ], [ 190, 0.0 ], [ 200, 0.0 ], [ 210, 0.0 ], [ 220, 5.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 1.0 ], [ 260, 0.0 ], [ 270, 13.0 ], [ 280, 1.0 ], [ 290, 1104.0 ], [ 300, 138689.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICFS2_R1", "pairs": [ [ 30, 2.0 ], [ 40, 13.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 3.0 ], [ 80, 3.0 ], [ 90, 2.0 ], [ 100, 20.0 ], [ 110, 0.0 ], [ 120, 4.0 ], [ 130, 3.0 ], [ 140, 22.0 ], [ 150, 3.0 ], [ 160, 2.0 ], [ 170, 0.0 ], [ 180, 26.0 ], [ 190, 0.0 ], [ 200, 0.0 ], [ 210, 0.0 ], [ 220, 14.0 ], [ 230, 1.0 ], [ 240, 0.0 ], [ 250, 0.0 ], [ 260, 3.0 ], [ 270, 3.0 ], [ 280, 8.0 ], [ 290, 615.0 ], [ 300, 172069.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICMS1_R1", "pairs": [ [ 30, 2.0 ], [ 40, 1.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 1.0 ], [ 80, 7.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 2.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 1.0 ], [ 150, 0.0 ], [ 160, 1.0 ], [ 170, 1.0 ], [ 180, 5.0 ], [ 190, 0.0 ], [ 200, 0.0 ], [ 210, 0.0 ], [ 220, 2.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0 ], [ 260, 1.0 ], [ 270, 4.0 ], [ 280, 5.0 ], [ 290, 1074.0 ], [ 300, 193770.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICMS2_R1", "pairs": [ [ 30, 2.0 ], [ 40, 2.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 1.0 ], [ 140, 3.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 1.0 ], [ 190, 0.0 ], [ 200, 1.0 ], [ 210, 0.0 ], [ 220, 3.0 ], [ 230, 1.0 ], [ 240, 2.0 ], [ 250, 2.0 ], [ 260, 0.0 ], [ 270, 7.0 ], [ 280, 6.0 ], [ 290, 501.0 ], [ 300, 125133.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPFS1_R1", "pairs": [ [ 40, 4.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 2.0 ], [ 80, 2.0 ], [ 90, 1.0 ], [ 100, 0.0 ], [ 110, 2.0 ], [ 120, 4.0 ], [ 130, 1.0 ], [ 140, 1.0 ], [ 150, 8.0 ], [ 160, 0.0 ], [ 170, 1.0 ], [ 180, 1.0 ], [ 190, 0.0 ], [ 200, 2.0 ], [ 210, 4.0 ], [ 220, 2.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0 ], [ 260, 0.0 ], [ 270, 5.0 ], [ 280, 8.0 ], [ 290, 1144.0 ], [ 300, 159770.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPFS2_R1", "pairs": [ [ 40, 1.0 ], [ 50, 1.0 ], [ 60, 0.0 ], [ 70, 1.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 6.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 2.0 ], [ 140, 0.0 ], [ 150, 2.0 ], [ 160, 1.0 ], [ 170, 0.0 ], [ 180, 3.0 ], [ 190, 1.0 ], [ 200, 1.0 ], [ 210, 0.0 ], [ 220, 3.0 ], [ 230, 1.0 ], [ 240, 0.0 ], [ 250, 0.0 ], [ 260, 0.0 ], [ 270, 10.0 ], [ 280, 4.0 ], [ 290, 477.0 ], [ 300, 223914.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPMS1_R1", "pairs": [ [ 40, 9.0 ], [ 50, 2.0 ], [ 60, 0.0 ], [ 70, 2.0 ], [ 80, 4.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 1.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 13.0 ], [ 150, 2.0 ], [ 160, 1.0 ], [ 170, 1.0 ], [ 180, 7.0 ], [ 190, 0.0 ], [ 200, 0.0 ], [ 210, 0.0 ], [ 220, 10.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0 ], [ 260, 0.0 ], [ 270, 17.0 ], [ 280, 5.0 ], [ 290, 818.0 ], [ 300, 344867.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPMS2_R1", "pairs": [ [ 30, 1.0 ], [ 40, 0.0 ], [ 50, 1.0 ], [ 60, 0.0 ], [ 70, 1.0 ], [ 80, 1.0 ], [ 90, 0.0 ], [ 100, 1.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 11.0 ], [ 150, 4.0 ], [ 160, 0.0 ], [ 170, 1.0 ], [ 180, 14.0 ], [ 190, 0.0 ], [ 200, 1.0 ], [ 210, 0.0 ], [ 220, 1.0 ], [ 230, 1.0 ], [ 240, 0.0 ], [ 250, 4.0 ], [ 260, 1.0 ], [ 270, 6.0 ], [ 280, 9.0 ], [ 290, 760.0 ], [ 300, 243271.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVFS1_R1", "pairs": [ [ 50, 2.0 ], [ 55, 0.0 ], [ 60, 0.0 ], [ 65, 0.0 ], [ 70, 0.0 ], [ 75, 0.0 ], [ 80, 2.0 ], [ 85, 1.0 ], [ 90, 0.0 ], [ 95, 1.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 1.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 2.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 1.0 ], [ 190, 0.0 ], [ 195, 1.0 ], [ 200, 1.0 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 1.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 2.0 ], [ 285, 1.0 ], [ 290, 31.0 ], [ 295, 713.0 ], [ 300, 228183.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVFS2_R1", "pairs": [ [ 40, 35.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 4.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 2.0 ], [ 130, 1.0 ], [ 140, 0.0 ], [ 150, 1.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 3.0 ], [ 190, 0.0 ], [ 200, 0.0 ], [ 210, 1.0 ], [ 220, 2.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0 ], [ 260, 0.0 ], [ 270, 5.0 ], [ 280, 8.0 ], [ 290, 1033.0 ], [ 300, 126325.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVMS1_R1", "pairs": [ [ 30, 1.0 ], [ 40, 18.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 1.0 ], [ 80, 7.0 ], [ 90, 1.0 ], [ 100, 1.0 ], [ 110, 0.0 ], [ 120, 3.0 ], [ 130, 1.0 ], [ 140, 12.0 ], [ 150, 49.0 ], [ 160, 0.0 ], [ 170, 1.0 ], [ 180, 2.0 ], [ 190, 1.0 ], [ 200, 1.0 ], [ 210, 0.0 ], [ 220, 7.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 2.0 ], [ 260, 0.0 ], [ 270, 3.0 ], [ 280, 4.0 ], [ 290, 900.0 ], [ 300, 155104.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVMS2_R1", "pairs": [ [ 80, 1.0 ], [ 85, 1.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 1.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 1.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 2.0 ], [ 220, 0.0 ], [ 225, 1.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 2.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 2.0 ], [ 275, 1.0 ], [ 280, 7.0 ], [ 285, 15.0 ], [ 290, 6.0 ], [ 295, 911.0 ], [ 300, 108786.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAFS1_R1", "pairs": [ [ 30, 1.0 ], [ 40, 0.0 ], [ 50, 1.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 4.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 2.0 ], [ 120, 0.0 ], [ 130, 1.0 ], [ 140, 1.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 1.0 ], [ 190, 0.0 ], [ 200, 0.0 ], [ 210, 0.0 ], [ 220, 0.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0 ], [ 260, 0.0 ], [ 270, 2.0 ], [ 280, 0.0 ], [ 290, 778.0 ], [ 300, 131579.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAFS2_R1", "pairs": [ [ 75, 1.0 ], [ 80, 1.0 ], [ 85, 1.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 1.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 2.0 ], [ 145, 7.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 1.0 ], [ 190, 0.0 ], [ 195, 1.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 1.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 2.0 ], [ 295, 466.0 ], [ 300, 83665.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAMS1_R1", "pairs": [ [ 85, 1.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 3.0 ], [ 130, 3.0 ], [ 135, 1.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 1.0 ], [ 155, 1.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 0.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 0.0 ], [ 290, 2.0 ], [ 295, 867.0 ], [ 300, 162564.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAMS2_R1", "pairs": [ [ 80, 2.0 ], [ 85, 1.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 1.0 ], [ 125, 0.0 ], [ 130, 3.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 2.0 ], [ 155, 1.0 ], [ 160, 3.0 ], [ 165, 1.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 1.0 ], [ 190, 1.0 ], [ 195, 1.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 7.0 ], [ 215, 1.0 ], [ 220, 0.0 ], [ 225, 1.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 1.0 ], [ 270, 1.0 ], [ 275, 0.0 ], [ 280, 0.0 ], [ 285, 1.0 ], [ 290, 3.0 ], [ 295, 1070.0 ], [ 300, 146643.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCFS1_R1", "pairs": [ [ 40, 3.0 ], [ 50, 1.0 ], [ 60, 0.0 ], [ 70, 2.0 ], [ 80, 4.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 1.0 ], [ 130, 1.0 ], [ 140, 5.0 ], [ 150, 9.0 ], [ 160, 2.0 ], [ 170, 0.0 ], [ 180, 10.0 ], [ 190, 2.0 ], [ 200, 8.0 ], [ 210, 1.0 ], [ 220, 1.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0 ], [ 260, 0.0 ], [ 270, 1.0 ], [ 280, 6.0 ], [ 290, 1404.0 ], [ 300, 186783.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCFS2_R1", "pairs": [ [ 30, 1.0 ], [ 40, 6.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 3.0 ], [ 80, 4.0 ], [ 90, 1.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 1.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 8.0 ], [ 160, 1.0 ], [ 170, 0.0 ], [ 180, 4.0 ], [ 190, 1.0 ], [ 200, 0.0 ], [ 210, 3.0 ], [ 220, 1.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 2.0 ], [ 260, 2.0 ], [ 270, 4.0 ], [ 280, 9.0 ], [ 290, 1182.0 ], [ 300, 150971.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCMS1_R1", "pairs": [ [ 30, 1.0 ], [ 40, 1.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 3.0 ], [ 80, 6.0 ], [ 90, 1.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 1.0 ], [ 130, 4.0 ], [ 140, 0.0 ], [ 150, 2.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 5.0 ], [ 190, 0.0 ], [ 200, 9.0 ], [ 210, 0.0 ], [ 220, 8.0 ], [ 230, 1.0 ], [ 240, 0.0 ], [ 250, 1.0 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 7.0 ], [ 290, 1068.0 ], [ 300, 160269.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCMS2_R1", "pairs": [ [ 30, 1.0 ], [ 40, 7.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 1.0 ], [ 80, 6.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 5.0 ], [ 140, 7.0 ], [ 150, 1.0 ], [ 160, 1.0 ], [ 170, 0.0 ], [ 180, 4.0 ], [ 190, 0.0 ], [ 200, 0.0 ], [ 210, 0.0 ], [ 220, 6.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0 ], [ 260, 0.0 ], [ 270, 11.0 ], [ 280, 13.0 ], [ 290, 1267.0 ], [ 300, 126122.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPFS1_R1", "pairs": [ [ 110, 1.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 1.0 ], [ 130, 0.0 ], [ 135, 2.0 ], [ 140, 1.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 1.0 ], [ 185, 0.0 ], [ 190, 1.0 ], [ 195, 0.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 2.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 1.0 ], [ 280, 0.0 ], [ 285, 3.0 ], [ 290, 1.0 ], [ 295, 1814.0 ], [ 300, 231795.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPFS2_R1", "pairs": [ [ 70, 1.0 ], [ 75, 0.0 ], [ 80, 3.0 ], [ 85, 2.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 0.0 ], [ 150, 0.0 ], [ 155, 1.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 3.0 ], [ 190, 0.0 ], [ 195, 1.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 3.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 1.0 ], [ 240, 0.0 ], [ 245, 1.0 ], [ 250, 1.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 1.0 ], [ 275, 4.0 ], [ 280, 2.0 ], [ 285, 1.0 ], [ 290, 0.0 ], [ 295, 1776.0 ], [ 300, 199971.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPMS1_R1", "pairs": [ [ 70, 1.0 ], [ 75, 0.0 ], [ 80, 2.0 ], [ 85, 0.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 0.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 1.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 0.0 ], [ 145, 8.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 10.0 ], [ 190, 0.0 ], [ 195, 0.0 ], [ 200, 1.0 ], [ 205, 1.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 2.0 ], [ 225, 10.0 ], [ 230, 0.0 ], [ 235, 1.0 ], [ 240, 1.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 0.0 ], [ 260, 0.0 ], [ 265, 0.0 ], [ 270, 0.0 ], [ 275, 1.0 ], [ 280, 2.0 ], [ 285, 0.0 ], [ 290, 7.0 ], [ 295, 1829.0 ], [ 300, 209426.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPMS2_R1", "pairs": [ [ 40, 11.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 2.0 ], [ 80, 2.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 1.0 ], [ 120, 0.0 ], [ 130, 2.0 ], [ 140, 4.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 2.0 ], [ 190, 1.0 ], [ 200, 0.0 ], [ 210, 1.0 ], [ 220, 3.0 ], [ 230, 0.0 ], [ 240, 2.0 ], [ 250, 0.0 ], [ 260, 0.0 ], [ 270, 4.0 ], [ 280, 8.0 ], [ 290, 870.0 ], [ 300, 133278.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVFS1_R1", "pairs": [ [ 30, 1.0 ], [ 40, 30.0 ], [ 50, 1.0 ], [ 60, 0.0 ], [ 70, 2.0 ], [ 80, 1.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 2.0 ], [ 130, 2.0 ], [ 140, 3.0 ], [ 150, 1.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0 ], [ 210, 1.0 ], [ 220, 1.0 ], [ 230, 1.0 ], [ 240, 0.0 ], [ 250, 0.0 ], [ 260, 0.0 ], [ 270, 5.0 ], [ 280, 1.0 ], [ 290, 827.0 ], [ 300, 108916.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVFS2_R1", "pairs": [ [ 80, 1.0 ], [ 85, 4.0 ], [ 90, 0.0 ], [ 95, 0.0 ], [ 100, 1.0 ], [ 105, 0.0 ], [ 110, 0.0 ], [ 115, 0.0 ], [ 120, 0.0 ], [ 125, 0.0 ], [ 130, 0.0 ], [ 135, 0.0 ], [ 140, 1.0 ], [ 145, 1.0 ], [ 150, 0.0 ], [ 155, 0.0 ], [ 160, 0.0 ], [ 165, 0.0 ], [ 170, 0.0 ], [ 175, 0.0 ], [ 180, 0.0 ], [ 185, 1.0 ], [ 190, 0.0 ], [ 195, 1.0 ], [ 200, 0.0 ], [ 205, 0.0 ], [ 210, 0.0 ], [ 215, 0.0 ], [ 220, 0.0 ], [ 225, 0.0 ], [ 230, 0.0 ], [ 235, 0.0 ], [ 240, 0.0 ], [ 245, 0.0 ], [ 250, 0.0 ], [ 255, 1.0 ], [ 260, 1.0 ], [ 265, 0.0 ], [ 270, 2.0 ], [ 275, 1.0 ], [ 280, 2.0 ], [ 285, 3.0 ], [ 290, 14.0 ], [ 295, 427.0 ], [ 300, 149594.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVMS1_R1", "pairs": [ [ 30, 1.0 ], [ 40, 32.0 ], [ 50, 1.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 10.0 ], [ 90, 1.0 ], [ 100, 1.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 3.0 ], [ 140, 27.0 ], [ 150, 5.0 ], [ 160, 4.0 ], [ 170, 0.0 ], [ 180, 19.0 ], [ 190, 0.0 ], [ 200, 0.0 ], [ 210, 0.0 ], [ 220, 23.0 ], [ 230, 1.0 ], [ 240, 0.0 ], [ 250, 0.0 ], [ 260, 0.0 ], [ 270, 11.0 ], [ 280, 5.0 ], [ 290, 2386.0 ], [ 300, 344781.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVMS2_R1", "pairs": [ [ 30, 1.0 ], [ 40, 2.0 ], [ 50, 3.0 ], [ 60, 0.0 ], [ 70, 1.0 ], [ 80, 3.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 5.0 ], [ 150, 1.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 3.0 ], [ 190, 0.0 ], [ 200, 0.0 ], [ 210, 0.0 ], [ 220, 16.0 ], [ 230, 0.0 ], [ 240, 2.0 ], [ 250, 0.0 ], [ 260, 0.0 ], [ 270, 8.0 ], [ 280, 9.0 ], [ 290, 1086.0 ], [ 300, 116184.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null } ] } ], "pconfig": { "id": "fastqc_sequence_length_distribution_plot", "title": "FastQC: Sequence Length Distribution", "anchor": null, "table_title": null, "height": null, "width": null, "square": false, "logswitch": false, "logswitch_active": false, "logswitch_label": "Log10", "cpswitch": true, "cpswitch_c_active": true, "cpswitch_counts_label": "Counts", "cpswitch_percent_label": "Percentages", "xLog": null, "yLog": null, "xlog": false, "ylog": false, "data_labels": [], "xTitle": null, "yTitle": null, "xlab": "Sequence Length (bp)", "ylab": "Read Count", "xsuffix": null, "ysuffix": null, "tt_suffix": null, "xLabFormat": null, "yLabFormat": null, "xLabelFormat": null, "yLabelFormat": null, "xlab_format": null, "ylab_format": null, "tt_label": "{point.x} bp: {point.y}", "xDecimals": null, "yDecimals": null, "decimalPlaces": null, "x_decimals": null, "y_decimals": null, "tt_decimals": null, "xmin": null, "xmax": null, "ymin": 0, "ymax": null, "xFloor": null, "xCeiling": null, "yFloor": null, "yCeiling": null, "x_clipmin": null, "x_clipmax": null, "y_clipmin": null, "y_clipmax": null, "save_data_file": true, "showlegend": false, "xMinRange": null, "yMinRange": null, "x_minrange": null, "y_minrange": null, "xPlotBands": null, "yPlotBands": null, "xPlotLines": null, "yPlotLines": null, "x_bands": null, "y_bands": null, "x_lines": null, "y_lines": null, "categories": false, "smooth_points": 500, "smooth_points_sumcounts": null, "extra_series": null, "style": null, "hide_zero_cats": false, "hide_empty": false, "colors": { "CAFS1_R1": "#f0ad4e", "CAFS2_R1": "#f0ad4e", "CAMS1_R1": "#f0ad4e", "CAMS2_R1": "#f0ad4e", "CCFS1_R1": "#f0ad4e", "CCFS2_R1": "#f0ad4e", "CCMS1_R1": "#f0ad4e", "CCMS2_R1": "#f0ad4e", "CPFS1_R1": "#f0ad4e", "CPFS2_R1": "#f0ad4e", "CPMS1_R1": "#f0ad4e", "CPMS2_R1": "#f0ad4e", "CVFS1_R1": "#f0ad4e", "CVFS2_R1": "#f0ad4e", "CVMS1_R1": "#f0ad4e", "CVMS2_R1": "#f0ad4e", "DAFS1_R1": "#f0ad4e", "DAFS2_R1": "#f0ad4e", "DAMS1_R1": "#f0ad4e", "DAMS2_R1": "#f0ad4e", "DCFS1_R1": "#f0ad4e", "DCFS2_R1": "#f0ad4e", "DCMS1_R1": "#f0ad4e", "DCMS2_R1": "#f0ad4e", "DPFS1_R1": "#f0ad4e", "DPFS2_R1": "#f0ad4e", "DPMS1_R1": "#f0ad4e", "DPMS2_R1": "#f0ad4e", "DVFS1_R1": "#f0ad4e", "DVFS2_R1": "#f0ad4e", "DVMS1_R1": "#f0ad4e", "DVMS2_R1": "#f0ad4e", "IAFS1_R1": "#f0ad4e", "IAFS2_R1": "#f0ad4e", "IAMS1_R1": "#f0ad4e", "IAMS2_R1": "#f0ad4e", "ICFS1_R1": "#f0ad4e", "ICFS2_R1": "#f0ad4e", "ICMS1_R1": "#f0ad4e", "ICMS2_R1": "#f0ad4e", "IPFS1_R1": "#f0ad4e", "IPFS2_R1": "#f0ad4e", "IPMS1_R1": "#f0ad4e", "IPMS2_R1": "#f0ad4e", "IVFS1_R1": "#f0ad4e", "IVFS2_R1": "#f0ad4e", "IVMS1_R1": "#f0ad4e", "IVMS2_R1": "#f0ad4e", "JAFS1_R1": "#f0ad4e", "JAFS2_R1": "#f0ad4e", "JAMS1_R1": "#f0ad4e", "JAMS2_R1": "#f0ad4e", "JCFS1_R1": "#f0ad4e", "JCFS2_R1": "#f0ad4e", "JCMS1_R1": "#f0ad4e", "JCMS2_R1": "#f0ad4e", "JPFS1_R1": "#f0ad4e", "JPFS2_R1": "#f0ad4e", "JPMS1_R1": "#f0ad4e", "JPMS2_R1": "#f0ad4e", "JVFS1_R1": "#f0ad4e", "JVFS2_R1": "#f0ad4e", "JVMS1_R1": "#f0ad4e", "JVMS2_R1": "#f0ad4e" } }, "add_log_tab": false, "add_pct_tab": false, "l_active": false, "p_active": false, "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "yaxis" ], "square": false, "flat": false, "defer_render": false }, "fastqc_sequence_duplication_levels_plot": { "id": "fastqc_sequence_duplication_levels_plot", "anchor": "fastqc_sequence_duplication_levels_plot", "plot_type": "xy_line", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 500, "hoverlabel": { "namelength": -1 }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "white", "plot_bgcolor": "white", "showlegend": false, "title": { "font": { "size": 20 }, "text": "FastQC: Sequence Duplication Levels", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "hoverdistance": -1 }, "datasets": [ { "plot_id": "fastqc_sequence_duplication_levels_plot", "label": "1", "uid": "fastqc_sequence_duplication_levels_plot", "dconfig": { "title": "FastQC: Sequence Duplication Levels
64 samples" }, "layout": { "title": { "text": "FastQC: Sequence Duplication Levels
64 samples" }, "xaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "Sequence Duplication Level" }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null }, "type": "category" }, "yaxis": { "hoverformat": ",.2f", "ticksuffix": "%", "title": { "text": "% of Library" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": 100 } } }, "trace_params": { "hovertemplate": "%{text}
%{x}: %{y}", "mode": "lines", "line": { "width": 2 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "n_samples": 64, "lines": [ { "name": "CAFS1_R1", "pairs": [ [ 1.0, 2.615575115437871 ], [ 2.0, 1.4114833995156795 ], [ 3.0, 0.9643713287097188 ], [ 4.0, 0.6075356378209233 ], [ 5.0, 0.5642273744822832 ], [ 6.0, 0.5160393068237964 ], [ 7.0, 0.4184432204268609 ], [ 8.0, 0.3611055196686613 ], [ 9.0, 0.28546855271103627 ], [ ">10", 2.5472578549600158 ], [ ">50", 0.7033017975979163 ], [ ">100", 13.792156934506927 ], [ ">500", 13.21816995138495 ], [ ">1k", 38.89631025795865 ], [ ">5k", 23.098553747994703 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAFS2_R1", "pairs": [ [ 1.0, 2.7812260637595414 ], [ 2.0, 1.4209872956340297 ], [ 3.0, 1.0518739600116214 ], [ 4.0, 0.7448297720609598 ], [ 5.0, 0.6471038799820396 ], [ 6.0, 0.4635376772932569 ], [ 7.0, 0.38364015741792346 ], [ 8.0, 0.31166635852196195 ], [ 9.0, 0.2852539552573889 ], [ ">10", 2.55209846543937 ], [ ">50", 0.8590634161802382 ], [ ">100", 13.091967988167244 ], [ ">500", 13.455798843136737 ], [ ">1k", 61.950952167137686 ], [ ">5k", 0.0 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAMS1_R1", "pairs": [ [ 1.0, 2.817428458680891 ], [ 2.0, 1.4097347902407162 ], [ 3.0, 0.8858468614350447 ], [ 4.0, 0.7402468396630789 ], [ 5.0, 0.4660561444569935 ], [ 6.0, 0.4817047449278123 ], [ 7.0, 0.33814584495638805 ], [ 8.0, 0.32113649661854154 ], [ 9.0, 0.23881125066336462 ], [ ">10", 4.779626882934861 ], [ ">50", 2.628284505164038 ], [ ">100", 12.974730912109294 ], [ ">500", 2.171073221842725 ], [ ">1k", 31.471376668617072 ], [ ">5k", 38.275796377689176 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAMS2_R1", "pairs": [ [ 1.0, 2.5150352116886068 ], [ 2.0, 1.3032509535253536 ], [ 3.0, 0.925427741310664 ], [ 4.0, 0.6934729844446836 ], [ 5.0, 0.5559740306323756 ], [ 6.0, 0.5021700921840813 ], [ 7.0, 0.39336657221086363 ], [ 8.0, 0.29651948300393366 ], [ 9.0, 0.25287851070698375 ], [ ">10", 3.9743175867140144 ], [ ">50", 2.237048196372419 ], [ ">100", 10.978992551143632 ], [ ">500", 4.735344404988223 ], [ ">1k", 36.15445317263891 ], [ ">5k", 34.48174850843526 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCFS1_R1", "pairs": [ [ 1.0, 3.9587054137996276 ], [ 2.0, 1.7786023157826725 ], [ 3.0, 1.1408160157277547 ], [ 4.0, 0.8823787306114349 ], [ 5.0, 0.6091736006313254 ], [ 6.0, 0.6036356588074042 ], [ 7.0, 0.38119499554657177 ], [ 8.0, 0.3470443542990581 ], [ 9.0, 0.2658212075482147 ], [ ">10", 3.2212361609141293 ], [ ">50", 2.7417426979929576 ], [ ">100", 14.162363224374328 ], [ ">500", 9.536335820792202 ], [ ">1k", 38.56438088117884 ], [ ">5k", 21.806568921993474 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCFS2_R1", "pairs": [ [ 1.0, 4.268986546731758 ], [ 2.0, 1.922176956536732 ], [ 3.0, 1.198528071566855 ], [ 4.0, 0.8807925162192917 ], [ 5.0, 0.6748801718235066 ], [ 6.0, 0.5615791210794142 ], [ 7.0, 0.4482780703353218 ], [ 8.0, 0.3625633623810955 ], [ 9.0, 0.3901497051709614 ], [ ">10", 3.3960758427381417 ], [ ">50", 2.8670091970896405 ], [ ">100", 14.913373957507181 ], [ ">500", 8.166542692328534 ], [ ">1k", 33.45188892556121 ], [ ">5k", 26.49717486293036 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCMS1_R1", "pairs": [ [ 1.0, 4.073051097671318 ], [ 2.0, 1.7467498452307253 ], [ 3.0, 1.2014857850373828 ], [ 4.0, 0.8857564645935521 ], [ 5.0, 0.6381256250297633 ], [ 6.0, 0.5800276203628744 ], [ 7.0, 0.43335396923663033 ], [ 8.0, 0.35430258583742086 ], [ 9.0, 0.35144530691937714 ], [ ">10", 3.2730130006190774 ], [ ">50", 2.6782227725129766 ], [ ">100", 14.53783513500643 ], [ ">500", 5.175960760036192 ], [ ">1k", 43.982570598599935 ], [ ">5k", 20.088099433306347 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCMS2_R1", "pairs": [ [ 1.0, 4.143751618652976 ], [ 2.0, 1.7905475744326462 ], [ 3.0, 1.1105863713228015 ], [ 4.0, 0.8510940824586261 ], [ 5.0, 0.7388674761201078 ], [ 6.0, 0.545390838043296 ], [ 7.0, 0.47277362217719615 ], [ 8.0, 0.3656251428223214 ], [ 9.0, 0.2787891714020201 ], [ ">10", 3.0854699552617015 ], [ ">50", 2.9920324187626637 ], [ ">100", 14.753990138277398 ], [ ">500", 2.698516679108078 ], [ ">1k", 45.637127202002816 ], [ ">5k", 20.535437709155353 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPFS1_R1", "pairs": [ [ 1.0, 3.100158982511924 ], [ 2.0, 1.3359874951570454 ], [ 3.0, 0.9378632216002458 ], [ 4.0, 0.7962485471135989 ], [ 5.0, 0.7548329347637306 ], [ 6.0, 0.6733376975591508 ], [ 7.0, 0.575142616665108 ], [ 8.0, 0.5076752481596772 ], [ 9.0, 0.52905104808219 ], [ ">10", 7.267103979906748 ], [ ">50", 1.0854898398150994 ], [ ">100", 3.797544454983901 ], [ ">500", 8.574367743917916 ], [ ">1k", 16.177472578856662 ], [ ">5k", 23.700418164085985 ], [ ">10k+", 30.187305446821018 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPFS2_R1", "pairs": [ [ 1.0, 4.543171570159382 ], [ 2.0, 1.9610250457609713 ], [ 3.0, 1.3175811420152685 ], [ 4.0, 0.9643287646769946 ], [ 5.0, 0.6306085093084512 ], [ 6.0, 0.5022545649359347 ], [ 7.0, 0.41798741015223895 ], [ 8.0, 0.39287468190544217 ], [ 9.0, 0.24108219116924864 ], [ ">10", 3.4404437698111523 ], [ ">50", 1.9995312290727263 ], [ ">100", 17.6793606857449 ], [ ">500", 12.324768962900128 ], [ ">1k", 50.78295906067235 ], [ ">5k", 2.8020224117148085 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPMS1_R1", "pairs": [ [ 1.0, 4.132882484155366 ], [ 2.0, 1.7437949226356972 ], [ 3.0, 1.140548100414262 ], [ 4.0, 0.8745529865807458 ], [ 5.0, 0.6284743122189569 ], [ 6.0, 0.5815600325744432 ], [ 7.0, 0.5049923874942464 ], [ 8.0, 0.38593633820769746 ], [ 9.0, 0.33857947101936764 ], [ ">10", 3.76641999787558 ], [ ">50", 1.7929221399992918 ], [ ">100", 13.280724427291718 ], [ ">500", 12.47344474737103 ], [ ">1k", 28.8491838685692 ], [ ">5k", 29.50598378359239 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPMS2_R1", "pairs": [ [ 1.0, 4.039516156599618 ], [ 2.0, 1.8605605121668936 ], [ 3.0, 1.1851916963330842 ], [ 4.0, 0.8907250325964342 ], [ 5.0, 0.605536754615997 ], [ 6.0, 0.5684232115911455 ], [ 7.0, 0.437549138819301 ], [ 8.0, 0.34769529781176595 ], [ 9.0, 0.27688656440908893 ], [ ">10", 3.501858118831705 ], [ ">50", 1.696479585109656 ], [ ">100", 14.620294271329302 ], [ ">500", 12.277257699839337 ], [ ">1k", 40.960654761032735 ], [ ">5k", 16.73137119891394 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVFS1_R1", "pairs": [ [ 1.0, 4.124848451700531 ], [ 2.0, 1.8231374372157045 ], [ 3.0, 1.1472092323679821 ], [ 4.0, 0.8094730221237727 ], [ 5.0, 0.6494927120080947 ], [ 6.0, 0.5496759373205349 ], [ 7.0, 0.40519229542119034 ], [ 8.0, 0.3135796392011012 ], [ 9.0, 0.28714414636147345 ], [ ">10", 3.301701898797641 ], [ ">50", 1.5200408382785937 ], [ ">100", 18.650240198357356 ], [ ">500", 16.48936655089744 ], [ ">1k", 27.431837449066098 ], [ ">5k", 22.49706019088249 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVFS2_R1", "pairs": [ [ 1.0, 4.097940388317581 ], [ 2.0, 1.8284011647592604 ], [ 3.0, 1.1521829562054389 ], [ 4.0, 0.8010138436088188 ], [ 5.0, 0.5756077740908783 ], [ 6.0, 0.5049869883620814 ], [ 7.0, 0.4571002911898151 ], [ 8.0, 0.3057009354835589 ], [ 9.0, 0.2612001663941801 ], [ ">10", 3.3549710261296903 ], [ ">50", 2.051872418229837 ], [ ">100", 20.144337277133374 ], [ ">500", 7.77650939836895 ], [ ">1k", 36.172353413499216 ], [ ">5k", 20.51582195822732 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVMS1_R1", "pairs": [ [ 1.0, 3.8399031434741824 ], [ 2.0, 1.7440719007002465 ], [ 3.0, 1.1354464344146071 ], [ 4.0, 0.8616740472502781 ], [ 5.0, 0.7007918675421566 ], [ 6.0, 0.5628149473179033 ], [ 7.0, 0.48864553565585395 ], [ 8.0, 0.48864553565585395 ], [ 9.0, 0.3681202417050239 ], [ ">10", 3.0474902379965534 ], [ ">50", 3.2896315525403024 ], [ ">100", 13.225060535328637 ], [ ">500", 7.534739643550534 ], [ ">1k", 62.71296437686787 ], [ ">5k", 0.0 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVMS2_R1", "pairs": [ [ 1.0, 3.7752622013969477 ], [ 2.0, 1.7026121608898426 ], [ 3.0, 1.1468984694882967 ], [ 4.0, 0.8442994460379672 ], [ 5.0, 0.665630268660638 ], [ 6.0, 0.6227146329180443 ], [ 7.0, 0.47820279827461626 ], [ 8.0, 0.3573383547546583 ], [ 9.0, 0.44141796763810737 ], [ ">10", 3.302752293577982 ], [ ">50", 2.4111580652930744 ], [ ">100", 13.475509623174442 ], [ ">500", 5.388101858947691 ], [ ">1k", 63.19590111887193 ], [ ">5k", 2.1922007400757595 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAFS1_R1", "pairs": [ [ 1.0, 3.457556245065003 ], [ 2.0, 1.550284144619046 ], [ 3.0, 1.0142461548727186 ], [ 4.0, 0.8096175446791001 ], [ 5.0, 0.6950700074511504 ], [ 6.0, 0.6205585026523871 ], [ 7.0, 0.35031528375537985 ], [ 8.0, 0.5249168696271089 ], [ 9.0, 0.4003603242918627 ], [ ">10", 7.24429764565887 ], [ ">50", 0.8096175446791001 ], [ ">100", 11.390251226103492 ], [ ">500", 8.10173600685061 ], [ ">1k", 24.030516353607133 ], [ ">5k", 39.00065614608703 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAFS2_R1", "pairs": [ [ 1.0, 5.413113006396589 ], [ 2.0, 2.5426439232409384 ], [ 3.0, 1.6791044776119404 ], [ 4.0, 1.2260127931769722 ], [ 5.0, 0.8528784648187633 ], [ 6.0, 0.767590618336887 ], [ 7.0, 0.4291044776119403 ], [ 8.0, 0.6183368869936035 ], [ 9.0, 0.6236673773987207 ], [ ">10", 8.102345415778252 ], [ ">50", 4.386993603411514 ], [ ">100", 15.980810234541579 ], [ ">500", 14.200426439232409 ], [ ">1k", 43.17697228144989 ], [ ">5k", 0.0 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAMS1_R1", "pairs": [ [ 1.0, 2.879326061672901 ], [ 2.0, 1.2007669820513627 ], [ 3.0, 0.9052902901329645 ], [ 4.0, 0.8109892182441141 ], [ 5.0, 0.6365322352497407 ], [ 6.0, 0.603526860088643 ], [ 7.0, 0.5280860025775627 ], [ 8.0, 0.37720428755540186 ], [ 9.0, 0.5233709489831201 ], [ ">10", 8.20262156979851 ], [ ">50", 3.154370854682048 ], [ ">100", 5.312293716405243 ], [ ">500", 2.5869927388174645 ], [ ">1k", 7.188885046993368 ], [ ">5k", 65.08974318674755 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAMS2_R1", "pairs": [ [ 1.0, 2.149247082987911 ], [ 2.0, 0.8290129796211286 ], [ 3.0, 0.5827837513455995 ], [ 4.0, 0.6285650651455722 ], [ 5.0, 0.513493114242938 ], [ 6.0, 0.43801581311325305 ], [ 7.0, 0.5110184486321285 ], [ 8.0, 0.33655452307007017 ], [ 9.0, 0.2895358764646927 ], [ ">10", 7.751890025860256 ], [ ">50", 1.1432955121939148 ], [ ">100", 4.028755614397605 ], [ ">500", 0.0 ], [ ">1k", 0.0 ], [ ">5k", 80.79783219292493 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCFS1_R1", "pairs": [ [ 1.0, 3.59633685308304 ], [ 2.0, 1.389975231390953 ], [ 3.0, 1.1023660539694955 ], [ 4.0, 0.9353408942771477 ], [ 5.0, 0.8229044453135185 ], [ 6.0, 0.5964020336331638 ], [ 7.0, 0.6900990744361882 ], [ 8.0, 0.5540346760526659 ], [ 9.0, 0.535295267892061 ], [ ">10", 6.576717507495763 ], [ ">50", 1.006224742536827 ], [ ">100", 6.2703689219137 ], [ ">500", 0.0 ], [ ">1k", 52.86712944857255 ], [ ">5k", 23.05680484943293 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCFS2_R1", "pairs": [ [ 1.0, 5.165182015851863 ], [ 2.0, 2.2697622220663534 ], [ 3.0, 1.7254681910640386 ], [ 4.0, 1.4252647822122466 ], [ 5.0, 1.1152416356877324 ], [ 6.0, 0.8837763905449955 ], [ 7.0, 0.7070211124359963 ], [ 8.0, 0.6957985550957424 ], [ 9.0, 0.6060180963737112 ], [ ">10", 4.76818404994038 ], [ ">50", 1.0310724556358282 ], [ ">100", 6.569404503051132 ], [ ">500", 5.038928245774006 ], [ ">1k", 67.99887774426597 ], [ ">5k", 0.0 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCMS1_R1", "pairs": [ [ 1.0, 2.9319882985282133 ], [ 2.0, 1.0940131331228613 ], [ 3.0, 0.796924846594036 ], [ 4.0, 0.7298937847309861 ], [ 5.0, 0.6413465795538711 ], [ 6.0, 0.5983142929257403 ], [ 7.0, 0.5734879737172034 ], [ 8.0, 0.47335515290943775 ], [ 9.0, 0.46176953727878717 ], [ ">10", 7.832703710293405 ], [ ">50", 1.7254291849933177 ], [ ">100", 5.081947541987512 ], [ ">500", 1.0555323383496291 ], [ ">1k", 13.506345193417715 ], [ ">5k", 53.036465725197466 ], [ ">10k+", 9.460482706399812 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCMS2_R1", "pairs": [ [ 1.0, 4.977654165030096 ], [ 2.0, 2.1740745851954864 ], [ 3.0, 1.5031687561703166 ], [ 4.0, 1.27387182726298 ], [ 5.0, 1.0244052610906467 ], [ 6.0, 0.9490345113109203 ], [ 7.0, 0.7579537372214732 ], [ 8.0, 0.7813080540546278 ], [ 9.0, 0.6210125157907029 ], [ ">10", 5.894841880659441 ], [ ">50", 1.5679239073895184 ], [ ">100", 8.998842899756902 ], [ ">500", 0.5403339667307141 ], [ ">1k", 68.93557393233617 ], [ ">5k", 0.0 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPFS1_R1", "pairs": [ [ 1.0, 3.195311289254568 ], [ 2.0, 1.468039842770397 ], [ 3.0, 1.1073697854294933 ], [ 4.0, 0.9664830442807029 ], [ 5.0, 0.8206652671917046 ], [ 6.0, 0.7312021865622226 ], [ 7.0, 0.6854139956888657 ], [ 8.0, 0.5071922681356458 ], [ 9.0, 0.5452316882458192 ], [ ">10", 6.029952521168233 ], [ ">50", 1.435635892306175 ], [ ">100", 4.80142013835078 ], [ ">500", 0.622719395877654 ], [ ">1k", 48.018427985742264 ], [ ">5k", 29.064934698995476 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPFS2_R1", "pairs": [ [ 1.0, 3.869590559167947 ], [ 2.0, 1.7092205560644023 ], [ 3.0, 1.2762382008523394 ], [ 4.0, 1.1233318446410865 ], [ 5.0, 0.9159242129485947 ], [ 6.0, 0.8720204076998191 ], [ 7.0, 0.7524203865048786 ], [ 8.0, 0.708516581256103 ], [ 9.0, 0.5586380736826966 ], [ ">10", 6.075378291839191 ], [ ">50", 0.16123293996533114 ], [ ">100", 5.293436381115308 ], [ ">500", 0.0 ], [ ">1k", 67.78747530410955 ], [ ">5k", 8.896576260152756 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPMS1_R1", "pairs": [ [ 1.0, 5.549796958647854 ], [ 2.0, 2.2584539590015 ], [ 3.0, 1.3462922088216285 ], [ 4.0, 1.0926429520871188 ], [ 5.0, 0.8902113337316928 ], [ 6.0, 0.8341158250307916 ], [ 7.0, 0.5377852029803788 ], [ 8.0, 0.6829018450544493 ], [ 9.0, 0.42803312073948513 ], [ ">10", 5.914417765203712 ], [ ">50", 4.138872968062144 ], [ ">100", 11.336170627903858 ], [ ">500", 6.660731924441789 ], [ ">1k", 58.329573308293604 ], [ ">5k", 0.0 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPMS2_R1", "pairs": [ [ 1.0, 5.7829243000345665 ], [ 2.0, 2.4449821407996315 ], [ 3.0, 1.496716211545109 ], [ 4.0, 1.0876829127779697 ], [ 5.0, 0.7489342090102546 ], [ 6.0, 0.691323885240235 ], [ 7.0, 0.6291047355686139 ], [ 8.0, 0.44244728655375043 ], [ 9.0, 0.41479433114414105 ], [ ">10", 6.254176748473326 ], [ ">50", 2.6108998732572877 ], [ ">100", 13.599493029150825 ], [ ">500", 19.17271575066252 ], [ ">1k", 44.62380458578178 ], [ ">5k", 0.0 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVFS1_R1", "pairs": [ [ 1.0, 5.483602001111729 ], [ 2.0, 2.217898832684825 ], [ 3.0, 1.3549193996664814 ], [ 4.0, 1.2062256809338523 ], [ 5.0, 0.8963312951639799 ], [ 6.0, 0.7003891050583658 ], [ 7.0, 0.48638132295719844 ], [ 8.0, 0.6003335186214565 ], [ 9.0, 0.5252918287937743 ], [ ">10", 9.585881045025015 ], [ ">50", 3.8187882156753754 ], [ ">100", 9.235686492495832 ], [ ">500", 9.299610894941635 ], [ ">1k", 47.4124513618677 ], [ ">5k", 7.176209005002779 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVFS2_R1", "pairs": [ [ 1.0, 4.855937881833589 ], [ 2.0, 1.9293681762642387 ], [ 3.0, 1.297741515903985 ], [ 4.0, 1.131212802018052 ], [ 5.0, 0.9607425801111504 ], [ 6.0, 0.7685940640889204 ], [ 7.0, 0.7449450159631075 ], [ 8.0, 0.6306412833550116 ], [ 9.0, 0.5321035828307911 ], [ ">10", 7.847542469748927 ], [ ">50", 1.7766347404516967 ], [ ">100", 10.044933191439045 ], [ ">500", 7.655393953726695 ], [ ">1k", 53.94939103701076 ], [ ">5k", 5.8748177052540305 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVMS1_R1", "pairs": [ [ 1.0, 5.066954461319555 ], [ 2.0, 2.2211637595789195 ], [ 3.0, 1.3547651921210186 ], [ 4.0, 1.0587306085289312 ], [ 5.0, 0.789827504084795 ], [ 6.0, 0.5751873579365606 ], [ 7.0, 0.45158839737367285 ], [ 8.0, 0.4389270404379623 ], [ 9.0, 0.33643034143459205 ], [ ">10", 5.417252003207543 ], [ ">50", 3.460167974002014 ], [ ">100", 15.02722191741178 ], [ ">500", 13.370995845869082 ], [ ">1k", 46.89103395052424 ], [ ">5k", 3.5397536461693364 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVMS2_R1", "pairs": [ [ 1.0, 4.654195046535742 ], [ 2.0, 1.9533214536287944 ], [ 3.0, 1.1231908803606132 ], [ 4.0, 0.9810069601822935 ], [ 5.0, 0.863037768767967 ], [ 6.0, 0.6482096622976673 ], [ 7.0, 0.5432791709870296 ], [ 8.0, 0.44207402256316003 ], [ 9.0, 0.42468908909157516 ], [ ">10", 6.6093791716079195 ], [ ">50", 1.6615029274986186 ], [ ">100", 17.398593062169766 ], [ ">500", 3.705474391372106 ], [ ">1k", 32.60109649258967 ], [ ">5k", 26.390949900347078 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAFS1_R1", "pairs": [ [ 1.0, 1.146630026385866 ], [ 2.0, 0.4875913473814764 ], [ 3.0, 0.39396408117605575 ], [ 4.0, 0.39882783526464904 ], [ 5.0, 0.30094478423170923 ], [ 6.0, 0.38302063447672086 ], [ 7.0, 0.29364915309881934 ], [ 8.0, 0.3258715239357498 ], [ 9.0, 0.3064165075813767 ], [ ">10", 5.053440498048419 ], [ ">50", 0.32769543171897225 ], [ ">100", 2.7668681071485026 ], [ ">500", 0.0 ], [ ">1k", 0.0 ], [ ">5k", 68.1521382278912 ], [ ">10k+", 19.662941841660487 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAFS2_R1", "pairs": [ [ 1.0, 1.3843565363696835 ], [ 2.0, 0.6010095081582345 ], [ 3.0, 0.3568493954689517 ], [ 4.0, 0.3255468169190437 ], [ 5.0, 0.23085651680557184 ], [ 6.0, 0.24885549947176897 ], [ 7.0, 0.22459600109559025 ], [ 8.0, 0.2817232069491724 ], [ 9.0, 0.23946472590679657 ], [ ">10", 5.754979066400595 ], [ ">50", 0.6839613413154908 ], [ ">100", 2.5002934616739054 ], [ ">500", 4.532613374026686 ], [ ">1k", 0.8138670422976092 ], [ ">5k", 7.006299643933168 ], [ ">10k+", 74.81472786320774 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAMS1_R1", "pairs": [ [ 1.0, 1.3049495814934424 ], [ 2.0, 0.5839319844460555 ], [ 3.0, 0.4191656231463784 ], [ 4.0, 0.37171291109207144 ], [ 5.0, 0.3295327225993541 ], [ 6.0, 0.3361233770513412 ], [ 7.0, 0.4198246885915771 ], [ 8.0, 0.36380412574968696 ], [ 9.0, 0.3796216964344559 ], [ ">10", 5.8162525538786 ], [ ">50", 0.5931589006788374 ], [ ">100", 2.0879193303895076 ], [ ">500", 0.0 ], [ ">1k", 17.033546431160616 ], [ ">5k", 12.354840835694985 ], [ ">10k+", 57.605615237593085 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAMS2_R1", "pairs": [ [ 1.0, 2.1210103314367093 ], [ 2.0, 1.1036901755750859 ], [ 3.0, 0.8524918739657026 ], [ 4.0, 0.6487641175423444 ], [ 5.0, 0.5933818148253149 ], [ 6.0, 0.474705451860252 ], [ 7.0, 0.45228880552240674 ], [ 8.0, 0.39031337152954054 ], [ 9.0, 0.45690399741549254 ], [ ">10", 4.211692259004569 ], [ ">50", 1.288297851298517 ], [ ">100", 5.7445952806366325 ], [ ">500", 4.876279891608922 ], [ ">1k", 36.73099365081458 ], [ ">5k", 40.05459112696393 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICFS1_R1", "pairs": [ [ 1.0, 4.2027317756541756 ], [ 2.0, 1.918389810519695 ], [ 3.0, 1.3594550743697689 ], [ 4.0, 1.132164478339492 ], [ 5.0, 0.9041591320072333 ], [ 6.0, 0.8920083768735392 ], [ 7.0, 0.7454845649672287 ], [ 8.0, 0.5832362464173141 ], [ 9.0, 0.5210529701448798 ], [ ">10", 5.841654218098907 ], [ ">50", 1.7189744762667163 ], [ ">100", 6.050361306277652 ], [ ">500", 7.935157852604193 ], [ ">1k", 34.43309579798298 ], [ ">5k", 31.76207391947623 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICFS2_R1", "pairs": [ [ 1.0, 4.78601518377928 ], [ 2.0, 2.084297750208314 ], [ 3.0, 1.3974400518470513 ], [ 4.0, 1.094806036478104 ], [ 5.0, 0.81300342560874 ], [ 6.0, 0.6770206462364596 ], [ 7.0, 0.6521386908619573 ], [ 8.0, 0.41662808999166745 ], [ 9.0, 0.3437181742431256 ], [ ">10", 4.595060642533099 ], [ ">50", 3.156536431811869 ], [ ">100", 10.397185445792056 ], [ ">500", 8.960397185445792 ], [ ">1k", 47.60149523192297 ], [ ">5k", 13.024257013239515 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICMS1_R1", "pairs": [ [ 1.0, 2.3604632665732743 ], [ 2.0, 0.9575270555273326 ], [ 3.0, 0.7373881987099555 ], [ 4.0, 0.7163492869861503 ], [ 5.0, 0.7055732590300549 ], [ 6.0, 0.5880632398897767 ], [ 7.0, 0.545985416442166 ], [ 8.0, 0.4967235743571586 ], [ 9.0, 0.5080127465016394 ], [ ">10", 6.562087881073703 ], [ ">50", 0.7260990265654746 ], [ ">100", 2.170086772682256 ], [ ">500", 2.156745023784233 ], [ ">1k", 16.5027170984775 ], [ ">5k", 57.84109977062455 ], [ ">10k+", 6.425078382774776 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICMS2_R1", "pairs": [ [ 1.0, 2.9196673695937614 ], [ 2.0, 1.3209724266900091 ], [ 3.0, 1.0098277165479648 ], [ 4.0, 0.7448374646878606 ], [ 5.0, 0.7559781959972944 ], [ 6.0, 0.5490789002506664 ], [ 7.0, 0.5681772967811244 ], [ 8.0, 0.5411212350296424 ], [ 9.0, 0.5299805037202084 ], [ ">10", 6.423427366410694 ], [ ">50", 1.2199100783830024 ], [ ">100", 4.149126646241993 ], [ ">500", 1.359169219750925 ], [ ">1k", 27.359248796403136 ], [ ">5k", 41.41487287629809 ], [ ">10k+", 9.134603907213624 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPFS1_R1", "pairs": [ [ 1.0, 2.692560977125036 ], [ 2.0, 1.0474521936854662 ], [ 3.0, 0.672829611958102 ], [ 4.0, 0.46719101402815566 ], [ 5.0, 0.4348852524198258 ], [ 6.0, 0.3764863756663063 ], [ 7.0, 0.34790820193586064 ], [ 8.0, 0.3131173817422746 ], [ 9.0, 0.30752599992544827 ], [ ">10", 6.936419776096221 ], [ ">50", 2.3987027994184964 ], [ ">100", 4.699867049365689 ], [ ">500", 6.551235695381519 ], [ ">1k", 2.8217840235583553 ], [ ">5k", 0.0 ], [ ">10k+", 69.93203364769325 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPFS2_R1", "pairs": [ [ 1.0, 4.027126739978969 ], [ 2.0, 1.8117168980697596 ], [ 3.0, 1.1776605414654144 ], [ 4.0, 0.8376851373268932 ], [ 5.0, 0.6772773450728073 ], [ 6.0, 0.5614272728893007 ], [ 7.0, 0.417951414262035 ], [ 8.0, 0.3635909957759281 ], [ 9.0, 0.34086655853993264 ], [ ">10", 3.4888694815263697 ], [ ">50", 1.1393409022047158 ], [ ">100", 16.129894665549756 ], [ ">500", 10.329370666761724 ], [ ">1k", 40.142050011585006 ], [ ">5k", 18.55517136899139 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPMS1_R1", "pairs": [ [ 1.0, 2.3279220497514164 ], [ 2.0, 0.838734494257561 ], [ 3.0, 0.523196793142044 ], [ 4.0, 0.4141613088885611 ], [ 5.0, 0.33549379770302434 ], [ 6.0, 0.3036797306794617 ], [ 7.0, 0.2469928476192955 ], [ 8.0, 0.23368878322762385 ], [ 9.0, 0.23947315905008978 ], [ ">10", 5.719012375672072 ], [ ">50", 3.3809676682313405 ], [ ">100", 7.486139189435416 ], [ ">500", 3.6215977024459236 ], [ ">1k", 9.445018061713506 ], [ ">5k", 5.844533331019583 ], [ ">10k+", 59.03938870716308 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPMS2_R1", "pairs": [ [ 1.0, 3.0070998693099646 ], [ 2.0, 1.2266017723043645 ], [ 3.0, 0.9303983383110259 ], [ 4.0, 0.7734883587543887 ], [ 5.0, 0.6083846465838281 ], [ 6.0, 0.5162051546771874 ], [ 7.0, 0.4875270905284548 ], [ 8.0, 0.4621265194252916 ], [ 9.0, 0.34659488956896867 ], [ ">10", 6.178074390898402 ], [ ">50", 2.850599576384024 ], [ ">100", 6.700424845036032 ], [ ">500", 6.48288124413636 ], [ ">1k", 18.5669981031509 ], [ ">5k", 36.989786512296746 ], [ ">10k+", 13.872808688634064 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVFS1_R1", "pairs": [ [ 1.0, 2.04199298515351 ], [ 2.0, 0.7862218980270199 ], [ 3.0, 0.4979405354171126 ], [ 4.0, 0.4804689376831788 ], [ 5.0, 0.4127664964641854 ], [ 6.0, 0.34593763513188874 ], [ 7.0, 0.3057529603438411 ], [ 8.0, 0.30750012011723443 ], [ 9.0, 0.2830398832897272 ], [ ">10", 5.869583258715052 ], [ ">50", 2.8766985668921956 ], [ ">100", 2.741293684454209 ], [ ">500", 2.145075411783719 ], [ ">1k", 10.296012544607173 ], [ ">5k", 13.4413369266586 ], [ ">10k+", 57.16837815526136 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVFS2_R1", "pairs": [ [ 1.0, 2.40150682781353 ], [ 2.0, 0.6686548422539633 ], [ 3.0, 0.5014911316904724 ], [ 4.0, 0.37670695338251453 ], [ 5.0, 0.42379532255532887 ], [ 6.0, 0.414377648720766 ], [ 7.0, 0.3845550149113169 ], [ 8.0, 0.2825302150368859 ], [ 9.0, 0.381415790299796 ], [ ">10", 8.28519855595668 ], [ ">50", 2.626746193690159 ], [ ">100", 3.819651546068121 ], [ ">500", 0.0 ], [ ">1k", 0.0 ], [ ">5k", 7.04206560979438 ], [ ">10k+", 72.3913043478261 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVMS1_R1", "pairs": [ [ 1.0, 3.3903624799031506 ], [ 2.0, 1.4757973084634157 ], [ 3.0, 1.2279094793074514 ], [ 4.0, 1.0658536116680224 ], [ 5.0, 0.951197483970561 ], [ 6.0, 0.9684919836791166 ], [ 7.0, 0.7263689877593374 ], [ 8.0, 0.6969042845521686 ], [ 9.0, 0.6168371562718182 ], [ ">10", 6.954951030944343 ], [ ">50", 1.6609125090475856 ], [ ">100", 1.8287332099231997 ], [ ">500", 0.0 ], [ ">1k", 51.34865070875422 ], [ ">5k", 27.08702976575561 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVMS2_R1", "pairs": [ [ 1.0, 3.0691562554106637 ], [ 2.0, 1.1500223261069649 ], [ 3.0, 0.790070805653517 ], [ 4.0, 0.6779846359933295 ], [ 5.0, 0.60599433190264 ], [ 6.0, 0.5412941851882227 ], [ 7.0, 0.49755324093058856 ], [ 8.0, 0.35721771143734565 ], [ 9.0, 0.36906421717378823 ], [ ">10", 7.15711200415539 ], [ ">50", 1.4461849695180293 ], [ ">100", 3.6888196323938147 ], [ ">500", 11.716194173341716 ], [ ">1k", 4.970064791273682 ], [ ">5k", 30.824607926223607 ], [ ">10k+", 32.1386587932967 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAFS1_R1", "pairs": [ [ 1.0, 2.1711868248092467 ], [ 2.0, 1.05008687769132 ], [ 3.0, 0.7637682254287226 ], [ 4.0, 0.5832137191206467 ], [ 5.0, 0.5363753116265014 ], [ 6.0, 0.39888192188562366 ], [ 7.0, 0.4600740349021682 ], [ 8.0, 0.39283825640250813 ], [ 9.0, 0.4215456674473068 ], [ ">10", 5.901639344262295 ], [ ">50", 0.40341467099796025 ], [ ">100", 3.438845659892725 ], [ ">500", 6.645010198685503 ], [ ">1k", 24.75258744428496 ], [ ">5k", 26.44859107048425 ], [ ">10k+", 25.631940772078266 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAFS2_R1", "pairs": [ [ 1.0, 2.6571914104742778 ], [ 2.0, 1.3238422322309238 ], [ 3.0, 0.8164089888174547 ], [ 4.0, 0.6702396938763384 ], [ 5.0, 0.6179514908079716 ], [ 6.0, 0.5918073892737882 ], [ 7.0, 0.3660174214785678 ], [ 8.0, 0.3897847865096436 ], [ 9.0, 0.2780781708635872 ], [ ">10", 4.997088497783693 ], [ ">50", 0.592995757525342 ], [ ">100", 7.436808518223627 ], [ ">500", 13.378649775992585 ], [ ">1k", 6.677441205480754 ], [ ">5k", 59.20569466066144 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAMS1_R1", "pairs": [ [ 1.0, 1.1838989739542225 ], [ 2.0, 0.40748150731447663 ], [ 3.0, 0.2900093610616545 ], [ 4.0, 0.1835502285200345 ], [ 5.0, 0.27226617230471784 ], [ 6.0, 0.2276022833648428 ], [ 7.0, 0.22270761060430855 ], [ 8.0, 0.2104709287029729 ], [ 9.0, 0.14316917824562692 ], [ ">10", 5.927448713006981 ], [ ">50", 2.474868914545132 ], [ ">100", 1.6329851997332403 ], [ ">500", 0.0 ], [ ">1k", 0.0 ], [ ">5k", 0.0 ], [ ">10k+", 86.82354092864179 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAMS2_R1", "pairs": [ [ 1.0, 1.9601340146874684 ], [ 2.0, 0.743172357778605 ], [ 3.0, 0.4893566618159667 ], [ 4.0, 0.3790314393042066 ], [ 5.0, 0.32488409083217706 ], [ 6.0, 0.3289451419675793 ], [ 7.0, 0.3269146163998782 ], [ 8.0, 0.2869809469017564 ], [ 9.0, 0.29239568174895936 ], [ ">10", 6.7785711868421945 ], [ ">50", 1.3753426511895495 ], [ ">100", 2.1090392229855497 ], [ ">500", 0.0 ], [ ">1k", 0.0 ], [ ">5k", 0.0 ], [ ">10k+", 84.60523198754612 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCFS1_R1", "pairs": [ [ 1.0, 1.9017870423492913 ], [ 2.0, 0.5291005291005291 ], [ 3.0, 0.3091732007394658 ], [ 4.0, 0.29748624126134166 ], [ 5.0, 0.23905144387072097 ], [ 6.0, 0.21673997577612036 ], [ 7.0, 0.2045217908671724 ], [ 8.0, 0.2337391895624827 ], [ 9.0, 0.19124115509657677 ], [ ">10", 6.459701238817704 ], [ ">50", 5.062047130320223 ], [ ">100", 3.2356940991479144 ], [ ">500", 0.0 ], [ ">1k", 0.0 ], [ ">5k", 0.0 ], [ ">10k+", 81.11971696309045 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCFS2_R1", "pairs": [ [ 1.0, 2.1635436650810753 ], [ 2.0, 0.5479488055504455 ], [ 3.0, 0.3567580352684555 ], [ 4.0, 0.23652466426637933 ], [ 5.0, 0.31536621902183914 ], [ 6.0, 0.31536621902183914 ], [ 7.0, 0.29434180442038316 ], [ 8.0, 0.24178076791674333 ], [ 9.0, 0.28382959711965516 ], [ ">10", 7.555648997398229 ], [ ">50", 4.4644030380279105 ], [ ">100", 2.2377861291424668 ], [ ">500", 0.0 ], [ ">1k", 0.0 ], [ ">5k", 0.0 ], [ ">10k+", 80.98670205776457 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCMS1_R1", "pairs": [ [ 1.0, 2.898622565634159 ], [ 2.0, 0.9567065500938738 ], [ 3.0, 0.5465124204551791 ], [ 4.0, 0.4510896168836399 ], [ 5.0, 0.42754373028806536 ], [ 6.0, 0.40151932931400913 ], [ 7.0, 0.3643416136367861 ], [ 8.0, 0.3767341855291938 ], [ 9.0, 0.34575275579817455 ], [ ">10", 8.487672489110027 ], [ ">50", 3.235700521107648 ], [ ">100", 4.973139100423206 ], [ ">500", 1.2045579879420276 ], [ ">1k", 5.488050462552746 ], [ ">5k", 0.0 ], [ ">10k+", 69.84205667123126 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCMS2_R1", "pairs": [ [ 1.0, 3.8587075918777267 ], [ 2.0, 1.5299877600979193 ], [ 3.0, 0.9179926560587516 ], [ 4.0, 0.7312556884160312 ], [ 5.0, 0.7022251514295578 ], [ 6.0, 0.5319649750494304 ], [ 7.0, 0.43938110033581274 ], [ 8.0, 0.3891661174402912 ], [ 9.0, 0.4448733640900104 ], [ ">10", 8.046951009007312 ], [ ">50", 2.4519034616953834 ], [ ">100", 10.488654552302043 ], [ ">500", 5.730000313843643 ], [ ">1k", 9.24034146188369 ], [ ">5k", 26.2122210714622 ], [ ">10k+", 28.284373725010198 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPFS1_R1", "pairs": [ [ 1.0, 1.625696100127128 ], [ 2.0, 0.5478912607063516 ], [ 3.0, 0.33387123699293303 ], [ 4.0, 0.26196050902522444 ], [ 5.0, 0.20973962323915024 ], [ 6.0, 0.22343690475680905 ], [ 7.0, 0.17977681991927166 ], [ 8.0, 0.12327553365892913 ], [ 9.0, 0.16179913792734446 ], [ ">10", 4.520958980922255 ], [ ">50", 3.849364146509547 ], [ ">100", 2.4132897873925083 ], [ ">500", 3.099866023465155 ], [ ">1k", 2.1192262748102713 ], [ ">5k", 3.7539112159333627 ], [ ">10k+", 76.57593644461376 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPFS2_R1", "pairs": [ [ 1.0, 1.9279186408421387 ], [ 2.0, 0.6700632396962909 ], [ 3.0, 0.45496897488254073 ], [ 4.0, 0.3945046884602422 ], [ 5.0, 0.2701068532799398 ], [ 6.0, 0.25276054160141154 ], [ 7.0, 0.23937910116368968 ], [ 8.0, 0.2815058580972583 ], [ 9.0, 0.2007216065658268 ], [ ">10", 5.080486886188371 ], [ ">50", 3.7274745752631686 ], [ ">100", 2.404694407549115 ], [ ">500", 2.01465019923478 ], [ ">1k", 7.730012092857284 ], [ ">5k", 2.883948218781595 ], [ ">10k+", 71.46680411553635 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPMS1_R1", "pairs": [ [ 1.0, 3.096974486874299 ], [ 2.0, 1.155686384007799 ], [ 3.0, 0.8035853726638996 ], [ 4.0, 0.649304553177191 ], [ 5.0, 0.5466084248685537 ], [ 6.0, 0.5082748470206291 ], [ 7.0, 0.4803528582178199 ], [ 8.0, 0.35210101134389954 ], [ 9.0, 0.35352077348641525 ], [ ">10", 7.9416761711854535 ], [ ">50", 1.5432814489145918 ], [ ">100", 8.493490390576564 ], [ ">500", 5.118242523769184 ], [ ">1k", 7.7599466169434415 ], [ ">5k", 33.85233527209742 ], [ ">10k+", 27.344618864852844 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPMS2_R1", "pairs": [ [ 1.0, 3.5024703594130755 ], [ 2.0, 1.1982919867949415 ], [ 3.0, 0.860713460664277 ], [ 4.0, 0.649820032640043 ], [ 5.0, 0.7489324917468385 ], [ 6.0, 0.7019844848015142 ], [ 7.0, 0.5425103024793019 ], [ 8.0, 0.5961651675596724 ], [ 9.0, 0.5633760833438904 ], [ ">10", 8.041522903920532 ], [ ">50", 2.3697565410496977 ], [ ">100", 7.694256693817023 ], [ ">500", 0.5052499795068224 ], [ ">1k", 24.363779985244914 ], [ ">5k", 39.52649581566573 ], [ ">10k+", 8.134673711351729 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVFS1_R1", "pairs": [ [ 1.0, 2.775171911289221 ], [ 2.0, 1.0200828817341407 ], [ 3.0, 0.6257115533494239 ], [ 4.0, 0.4918256751218179 ], [ 5.0, 0.42351655357712104 ], [ 6.0, 0.4043899995446058 ], [ 7.0, 0.4271597067261715 ], [ 8.0, 0.5246140534632724 ], [ 9.0, 0.5983879047315451 ], [ ">10", 8.403843526572247 ], [ ">50", 2.3134022496470696 ], [ ">100", 1.8370599754087162 ], [ ">500", 4.240630265494786 ], [ ">1k", 0.0 ], [ ">5k", 24.000182157657452 ], [ ">10k+", 51.91402158568241 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVFS2_R1", "pairs": [ [ 1.0, 2.8109693112525407 ], [ 2.0, 1.1169237946086434 ], [ 3.0, 0.8117023757955416 ], [ 4.0, 0.6131085268734797 ], [ 5.0, 0.5764552997234347 ], [ 6.0, 0.5917830128952717 ], [ 7.0, 0.4851554430042318 ], [ 8.0, 0.36253373762953583 ], [ 9.0, 0.36586584918863085 ], [ ">10", 6.2337143047549235 ], [ ">50", 2.28516210722735 ], [ ">100", 3.3154510012995235 ], [ ">500", 6.774182799640132 ], [ ">1k", 18.140015327713172 ], [ ">5k", 12.568724800906333 ], [ ">10k+", 42.94825230748726 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVMS1_R1", "pairs": [ [ 1.0, 2.315791898327436 ], [ 2.0, 0.7480327429882727 ], [ 3.0, 0.4042486417072883 ], [ 4.0, 0.3386014263873013 ], [ 5.0, 0.29800380638678303 ], [ 6.0, 0.2263101370241657 ], [ 7.0, 0.21968783021557048 ], [ 8.0, 0.19578994042803136 ], [ 9.0, 0.2176723455346937 ], [ ">10", 5.643357106455022 ], [ ">50", 3.888445802177299 ], [ ">100", 6.50137772774257 ], [ ">500", 2.8933722225901284 ], [ ">1k", 4.827661663465885 ], [ ">5k", 0.0 ], [ ">10k+", 71.28164670856955 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVMS2_R1", "pairs": [ [ 1.0, 3.847465139272442 ], [ 2.0, 1.2444171695475776 ], [ 3.0, 0.8412601002352461 ], [ 4.0, 0.6477788005864102 ], [ 5.0, 0.6222085847737888 ], [ 6.0, 0.6034570931778664 ], [ 7.0, 0.5369745320650506 ], [ 8.0, 0.5386792131192254 ], [ 9.0, 0.4832770788585456 ], [ ">10", 8.355494187037605 ], [ ">50", 4.333299239712249 ], [ ">100", 7.111929358017115 ], [ ">500", 2.2910913368108825 ], [ ">1k", 12.992226654392963 ], [ ">5k", 35.163308444989944 ], [ ">10k+", 20.387133067403088 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null } ] } ], "pconfig": { "id": "fastqc_sequence_duplication_levels_plot", "title": "FastQC: Sequence Duplication Levels", "anchor": null, "table_title": null, "height": null, "width": null, "square": false, "logswitch": false, "logswitch_active": false, "logswitch_label": "Log10", "cpswitch": true, "cpswitch_c_active": true, "cpswitch_counts_label": "Counts", "cpswitch_percent_label": "Percentages", "xLog": null, "yLog": null, "xlog": false, "ylog": false, "data_labels": [], "xTitle": null, "yTitle": null, "xlab": "Sequence Duplication Level", "ylab": "% of Library", "xsuffix": null, "ysuffix": null, "tt_suffix": "%", "xLabFormat": null, "yLabFormat": null, "xLabelFormat": null, "yLabelFormat": null, "xlab_format": null, "ylab_format": null, "tt_label": null, "xDecimals": null, "yDecimals": null, "decimalPlaces": null, "x_decimals": null, "y_decimals": null, "tt_decimals": 2, "xmin": null, "xmax": null, "ymin": 0, "ymax": 100, "xFloor": null, "xCeiling": null, "yFloor": null, "yCeiling": null, "x_clipmin": null, "x_clipmax": null, "y_clipmin": null, "y_clipmax": null, "save_data_file": true, "showlegend": false, "xMinRange": null, "yMinRange": null, "x_minrange": null, "y_minrange": null, "xPlotBands": null, "yPlotBands": null, "xPlotLines": null, "yPlotLines": null, "x_bands": null, "y_bands": null, "x_lines": null, "y_lines": null, "categories": true, "smooth_points": 500, "smooth_points_sumcounts": null, "extra_series": null, "style": null, "hide_zero_cats": false, "hide_empty": false, "colors": { "CAFS1_R1": "#d9534f", "CAFS2_R1": "#d9534f", "CAMS1_R1": "#d9534f", "CAMS2_R1": "#d9534f", "CCFS1_R1": "#d9534f", "CCFS2_R1": "#d9534f", "CCMS1_R1": "#d9534f", "CCMS2_R1": "#d9534f", "CPFS1_R1": "#d9534f", "CPFS2_R1": "#d9534f", "CPMS1_R1": "#d9534f", "CPMS2_R1": "#d9534f", "CVFS1_R1": "#d9534f", "CVFS2_R1": "#d9534f", "CVMS1_R1": "#d9534f", "CVMS2_R1": "#d9534f", "DAFS1_R1": "#d9534f", "DAFS2_R1": "#d9534f", "DAMS1_R1": "#d9534f", "DAMS2_R1": "#d9534f", "DCFS1_R1": "#d9534f", "DCFS2_R1": "#d9534f", "DCMS1_R1": "#d9534f", "DCMS2_R1": "#d9534f", "DPFS1_R1": "#d9534f", "DPFS2_R1": "#d9534f", "DPMS1_R1": "#d9534f", "DPMS2_R1": "#d9534f", "DVFS1_R1": "#d9534f", "DVFS2_R1": "#d9534f", "DVMS1_R1": "#d9534f", "DVMS2_R1": "#d9534f", "IAFS1_R1": "#d9534f", "IAFS2_R1": "#d9534f", "IAMS1_R1": "#d9534f", "IAMS2_R1": "#d9534f", "ICFS1_R1": "#d9534f", "ICFS2_R1": "#d9534f", "ICMS1_R1": "#d9534f", "ICMS2_R1": "#d9534f", "IPFS1_R1": "#d9534f", "IPFS2_R1": "#d9534f", "IPMS1_R1": "#d9534f", "IPMS2_R1": "#d9534f", "IVFS1_R1": "#d9534f", "IVFS2_R1": "#d9534f", "IVMS1_R1": "#d9534f", "IVMS2_R1": "#d9534f", "JAFS1_R1": "#d9534f", "JAFS2_R1": "#d9534f", "JAMS1_R1": "#d9534f", "JAMS2_R1": "#d9534f", "JCFS1_R1": "#d9534f", "JCFS2_R1": "#d9534f", "JCMS1_R1": "#d9534f", "JCMS2_R1": "#d9534f", "JPFS1_R1": "#d9534f", "JPFS2_R1": "#d9534f", "JPMS1_R1": "#d9534f", "JPMS2_R1": "#d9534f", "JVFS1_R1": "#d9534f", "JVFS2_R1": "#d9534f", "JVMS1_R1": "#d9534f", "JVMS2_R1": "#d9534f" } }, "add_log_tab": false, "add_pct_tab": false, "l_active": false, "p_active": false, "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "yaxis" ], "square": false, "flat": false, "defer_render": false }, "fastqc_overrepresented_sequences_plot": { "id": "fastqc_overrepresented_sequences_plot", "anchor": "fastqc_overrepresented_sequences_plot", "plot_type": "bar_graph", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 800, "hoverlabel": { "namelength": -1, "bgcolor": "rgba(255, 255, 255, 0.8)", "font": { "color": "black" } }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "white", "plot_bgcolor": "white", "showlegend": true, "title": { "font": { "size": 20 }, "text": "FastQC: Overrepresented sequences sample summary", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)", "showgrid": false, "categoryorder": "trace", "type": "category" }, "barmode": "relative", "bargroupgap": 0, "bargap": 0.2, "legend": { "tracegroupgap": 0, "traceorder": "normal" }, "hovermode": "y unified" }, "datasets": [ { "plot_id": "fastqc_overrepresented_sequences_plot", "label": "1", "uid": "fastqc_overrepresented_sequences_plot", "dconfig": { "title": "FastQC: Overrepresented sequences sample summary
64 samples" }, "layout": { "title": { "text": "FastQC: Overrepresented sequences sample summary
64 samples" }, "xaxis": { "title": { "text": "Percentage of Total Sequences" }, "hoverformat": ",.2f", "ticksuffix": "%", "autorangeoptions": { "minallowed": 0, "maxallowed": 89.9995136245911 } }, "yaxis": { "title": null, "hoverformat": null, "ticksuffix": "" }, "showlegend": true }, "trace_params": { "hovertemplate": "%{meta}: %{x}", "orientation": "h", "marker": { "line": { "width": 0 } }, "textposition": "inside", "insidetextanchor": "start" }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "n_samples": 64, "cats": [ { "name": "Top overrepresented sequence", "color": "124,181,236", "data": [ 10.951723432545771, 12.658107575055212, 10.947985738562526, 12.592558859693066, 8.134673711351729, 6.239381362309101, 14.1882917352259, 14.489583645445869, 10.965696889809497, 11.689913066108176, 13.121205750177396, 13.058052315080426, 12.501269078479812, 13.43893589814186, 11.093417628254644, 9.990179043589938, 12.478926888834213, 4.8219627335558135, 13.31816041437765, 11.359596056660392, 5.258327904985476, 11.774096986629415, 2.8387723456966154, 11.57913047800102, 9.134603907213624, 6.425078382774776, 3.6941023979261183, 5.799483950281969, 6.161940490397104, 9.40354577209517, 12.89274954024338, 6.8129035395970385, 4.882682743590858, 3.5397536461693364, 5.8748177052540305, 7.176209005002779, 4.109920497753198, 3.113300732900016, 4.621253983513364, 5.393848884881444, 4.534983705056209, 4.7856867994323045, 6.029318931051413, 5.3374722982661975, 11.797968299533526, 10.964071291610349, 5.818230277185501, 7.4277961276259745, 2.1922007400757595, 2.5086712768046073, 3.119890876374929, 3.0697076599119426, 2.998383607534049, 3.453953191941366, 2.8020224117148085, 8.91170458644507, 3.1347277870030417, 3.301109576646507, 3.619229651377593, 3.3966043186716326, 4.833387137271782, 5.356583978554614, 3.285042656031272, 3.516508987989582 ], "data_pct": [] }, { "name": "Sum of remaining overrepresented sequences", "color": "67,67,72", "data": [ 66.16293341515802, 66.83088068042764, 71.54643297457596, 69.39933512455029, 70.54944072255219, 74.3382725280758, 71.21503479174514, 72.45005842746644, 68.22646957285882, 67.84561333936439, 69.4554676618223, 70.72841631074562, 73.51111712748319, 74.695153662133, 75.83215486815055, 76.58306262748359, 70.76009003344363, 74.58413133571183, 69.40040809919954, 73.85331720122475, 74.63875881338363, 68.70884055078825, 76.67848931505868, 71.83248220076787, 73.83917558588311, 77.82550018729762, 72.19759744468108, 74.29900864133117, 80.46916722158856, 79.09642127463256, 76.34620651876205, 83.18661008499406, 70.50956481786177, 71.92675706473575, 71.550195104647, 68.40188993885495, 74.3495794446365, 74.64361059961224, 77.35623396186422, 76.52404232237701, 74.04061528009257, 74.72970344961709, 74.42379182156134, 76.67106635380003, 73.36888602927529, 70.09084336591957, 72.48134328358206, 75.09536360502227, 74.71305642530274, 75.55627058746542, 75.5182888486877, 76.51571088686526, 76.33083793590106, 74.61273589916088, 75.67581142015267, 73.43188467755938, 73.81768508503325, 72.86870803371593, 73.69888521618324, 74.36025234554904, 79.39847196814806, 77.4360788689464, 83.55827896780328, 83.4879621327185 ], "data_pct": [] } ], "samples": [ "JVMS2_R1", "JVMS1_R1", "JVFS2_R1", "JVFS1_R1", "JPMS2_R1", "JPMS1_R1", "JPFS2_R1", "JPFS1_R1", "JCMS2_R1", "JCMS1_R1", "JCFS2_R1", "JCFS1_R1", "JAMS2_R1", "JAMS1_R1", "JAFS2_R1", "JAFS1_R1", "IVMS2_R1", "IVMS1_R1", "IVFS2_R1", "IVFS1_R1", "IPMS2_R1", "IPMS1_R1", "IPFS2_R1", "IPFS1_R1", "ICMS2_R1", "ICMS1_R1", "ICFS2_R1", "ICFS1_R1", "IAMS2_R1", "IAMS1_R1", "IAFS2_R1", "IAFS1_R1", "DVMS2_R1", "DVMS1_R1", "DVFS2_R1", "DVFS1_R1", "DPMS2_R1", "DPMS1_R1", "DPFS2_R1", "DPFS1_R1", "DCMS2_R1", "DCMS1_R1", "DCFS2_R1", "DCFS1_R1", "DAMS2_R1", "DAMS1_R1", "DAFS2_R1", "DAFS1_R1", "CVMS2_R1", "CVMS1_R1", "CVFS2_R1", "CVFS1_R1", "CPMS2_R1", "CPMS1_R1", "CPFS2_R1", "CPFS1_R1", "CCMS2_R1", "CCMS1_R1", "CCFS2_R1", "CCFS1_R1", "CAMS2_R1", "CAMS1_R1", "CAFS2_R1", "CAFS1_R1" ] } ], "pconfig": { "id": "fastqc_overrepresented_sequences_plot", "title": "FastQC: Overrepresented sequences sample summary", "anchor": null, "table_title": null, "height": null, "width": null, "square": false, "logswitch": false, "logswitch_active": false, "logswitch_label": "Log10", "cpswitch": false, "cpswitch_c_active": true, "cpswitch_counts_label": "Counts", "cpswitch_percent_label": "Percentages", "xLog": null, "yLog": null, "xlog": false, "ylog": false, "data_labels": [], "xTitle": null, "yTitle": null, "xlab": null, "ylab": "Percentage of Total Sequences", "xsuffix": null, "ysuffix": null, "tt_suffix": "%", "xLabFormat": null, "yLabFormat": null, "xLabelFormat": null, "yLabelFormat": null, "xlab_format": null, "ylab_format": null, "tt_label": null, "xDecimals": null, "yDecimals": null, "decimalPlaces": null, "x_decimals": null, "y_decimals": null, "tt_decimals": 2, "xmin": null, "xmax": null, "ymin": 0, "ymax": null, "xFloor": null, "xCeiling": null, "yFloor": null, "yCeiling": null, "x_clipmin": null, "x_clipmax": null, "y_clipmin": null, "y_clipmax": 100, "save_data_file": true, "showlegend": null, "xMinRange": null, "yMinRange": null, "x_minrange": null, "y_minrange": null, "xPlotBands": null, "yPlotBands": null, "xPlotLines": null, "yPlotLines": null, "x_bands": null, "y_bands": null, "x_lines": null, "y_lines": null, "stacking": "relative", "hide_zero_cats": true, "sort_samples": true, "use_legend": true, "suffix": null, "lab_format": null }, "add_log_tab": false, "add_pct_tab": false, "l_active": false, "p_active": false, "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "xaxis" ], "square": false, "flat": false, "defer_render": false }, "fastqc_top_overrepresented_sequences_table": { "id": "fastqc_top_overrepresented_sequences_table", "anchor": "fastqc_top_overrepresented_sequences_table", "plot_type": "violin", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 500, "hoverlabel": { "namelength": -1 }, "margin": { "b": 40, "l": 60, "pad": 0, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "white", "plot_bgcolor": "white", "showlegend": false, "title": { "font": { "size": 20 }, "text": "FastQC: Top overrepresented sequences", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": false, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.1)", "tickfont": { "color": "rgba(0,0,0,0.5)", "size": 9 }, "zerolinecolor": "rgba(0,0,0,0.1)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.1)", "tickfont": { "color": "rgba(0,0,0,0.5)", "size": 9 }, "zerolinecolor": "rgba(0,0,0,0.1)" }, "violingap": 0, "grid": { "columns": 1, "roworder": "top to bottom", "ygap": 0.4 } }, "datasets": [ { "plot_id": "fastqc_top_overrepresented_sequences_table", "label": "1", "uid": "fastqc_top_overrepresented_sequences_table", "dconfig": { "ylab": "", "title": "FastQC: Top overrepresented sequences
20 samples" }, "layout": { "title": { "text": "FastQC: Top overrepresented sequences
20 samples" }, "xaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": null }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "yaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "" }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } } }, "trace_params": { "hovertemplate": "%{text}: %{x}", "orientation": "h", "box": { "visible": true }, "meanline": { "visible": true }, "fillcolor": "#b5b5b5", "line": { "width": 2, "color": "#b5b5b5" }, "opacity": 0.5, "points": false, "hoveron": "points" }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "n_samples": 20, "metrics": [ "fastqc-samples", "fastqc-total_count", "fastqc-total_percent" ], "header_by_metric": { "fastqc-samples": { "title": "Reports", "description": "Number of FastQC reports where this sequence is founds as overrepresented", "suffix": "", "dmin": 0.0, "dmax": 56, "hidden": false, "xaxis": { "ticksuffix": null, "tickvals": null, "range": [ -0.28, 56.2814 ] }, "show_only_outliers": false, "show_points": true, "namespace": "", "color": null, "hoverformat": null }, "fastqc-total_count": { "title": "Occurrences", "description": "Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)", "suffix": "", "dmin": 0.0, "dmax": 178188, "hidden": false, "xaxis": { "ticksuffix": null, "tickvals": null, "range": [ -890.94, 179083.3947 ] }, "show_only_outliers": false, "show_points": true, "namespace": "", "color": null, "hoverformat": null }, "fastqc-total_percent": { "title": "% of all reads", "description": "Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)", "suffix": "%", "dmin": 0.0, "dmax": 100.0, "hidden": false, "xaxis": { "ticksuffix": "%", "tickvals": null, "range": [ -0.5, 100.5025 ] }, "show_only_outliers": false, "show_points": true, "namespace": "", "color": null, "hoverformat": ".2f" } }, "violin_value_by_sample_by_metric": { "fastqc-samples": { "CCTACGGGGGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": 56, "CCTACGGGGGGCTGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": 55, "CCTACGGGTGGCTGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": 55, "CCTACGGGTGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": 55, "CCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": 55, "CCTACGGGCGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": 55, "CCTACGGGCGGCTGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": 54, "CCTACGGGAGGCTGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": 52, "CCTACGGGGGGCAGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": 50, "CCTACGGGTGGCTGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": 48, "CCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": 47, "CCTACGGGGGGCTGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": 46, "CCTACGGGTGGCAGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": 45, "CCTACGGGCGGCAGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": 45, "CCTACGGGCGGCTGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": 44, "CCTACGGGGGGCAGCAGTAGGGAATCTTCCACAATGGACGAAAGTCTGAT": 43, "CCTACGGGGGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGAT": 41, "CCTACGGGAGGCTGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": 41, "CCTACGGGAGGCAGCAGTAGGGAATCTTCCACAATGGACGAAAGTCTGAT": 41, "CCTACGGGTGGCTGCAGTAGGGAATCTTCCACAATGGACGAAAGTCTGAT": 41 }, "fastqc-total_count": { "CCTACGGGGGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": 178188, "CCTACGGGGGGCTGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": 158813, "CCTACGGGTGGCTGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": 167612, "CCTACGGGTGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": 152134, "CCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": 154418, "CCTACGGGCGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": 133258, "CCTACGGGCGGCTGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": 145792, "CCTACGGGAGGCTGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": 117228, "CCTACGGGGGGCAGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": 161208, "CCTACGGGTGGCTGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": 134535, "CCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": 126569, "CCTACGGGGGGCTGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": 109907, "CCTACGGGTGGCAGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": 115797, "CCTACGGGCGGCAGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": 108323, "CCTACGGGCGGCTGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": 103139, "CCTACGGGGGGCAGCAGTAGGGAATCTTCCACAATGGACGAAAGTCTGAT": 158431, "CCTACGGGGGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGAT": 139601, "CCTACGGGAGGCTGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": 54813, "CCTACGGGAGGCAGCAGTAGGGAATCTTCCACAATGGACGAAAGTCTGAT": 127778, "CCTACGGGTGGCTGCAGTAGGGAATCTTCCACAATGGACGAAAGTCTGAT": 132928 }, "fastqc-total_percent": { "CCTACGGGGGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": 1.7320864970099084, "CCTACGGGGGGCTGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": 1.5437507174985665, "CCTACGGGTGGCTGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": 1.6292818929267108, "CCTACGGGTGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": 1.4788271215575985, "CCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": 1.5010288722881227, "CCTACGGGCGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": 1.2953418996708328, "CCTACGGGCGGCTGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": 1.417179353110583, "CCTACGGGAGGCTGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": 1.1395213811899654, "CCTACGGGGGGCAGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": 1.5670314499852587, "CCTACGGGTGGCTGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": 1.3077550501449482, "CCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": 1.2303210981662462, "CCTACGGGGGGCTGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": 1.0683571880646732, "CCTACGGGTGGCAGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": 1.1256112650361212, "CCTACGGGCGGCAGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": 1.052959826787462, "CCTACGGGCGGCTGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": 1.0025684626074984, "CCTACGGGGGGCAGCAGTAGGGAATCTTCCACAATGGACGAAAGTCTGAT": 1.54003746496833, "CCTACGGGGGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGAT": 1.3569993886742104, "CCTACGGGAGGCTGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": 0.532812855863493, "CCTACGGGAGGCAGCAGTAGGGAATCTTCCACAATGGACGAAAGTCTGAT": 1.2420732508077539, "CCTACGGGTGGCTGCAGTAGGGAATCTTCCACAATGGACGAAAGTCTGAT": 1.2921341160714137 } }, "scatter_value_by_sample_by_metric": { "fastqc-samples": {}, "fastqc-total_count": {}, "fastqc-total_percent": {} }, "all_samples": [ "CCTACGGGAGGCAGCAGTAGGGAATCTTCCACAATGGACGAAAGTCTGAT", "CCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT", "CCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT", "CCTACGGGAGGCTGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT", "CCTACGGGAGGCTGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT", "CCTACGGGCGGCAGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT", "CCTACGGGCGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT", "CCTACGGGCGGCTGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT", "CCTACGGGCGGCTGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT", "CCTACGGGGGGCAGCAGTAGGGAATCTTCCACAATGGACGAAAGTCTGAT", "CCTACGGGGGGCAGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT", "CCTACGGGGGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGAT", "CCTACGGGGGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT", "CCTACGGGGGGCTGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT", "CCTACGGGGGGCTGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT", "CCTACGGGTGGCAGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT", "CCTACGGGTGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT", "CCTACGGGTGGCTGCAGTAGGGAATCTTCCACAATGGACGAAAGTCTGAT", "CCTACGGGTGGCTGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT", "CCTACGGGTGGCTGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT" ], "scatter_trace_params": { "mode": "markers", "marker": { "size": 4, "color": "#0b79e6" }, "showlegend": false, "hovertemplate": "%{text}: %{x}", "hoverlabel": { "bgcolor": "white" } } } ], "pconfig": { "id": "fastqc_top_overrepresented_sequences_table", "title": "FastQC: Top overrepresented sequences", "anchor": null, "table_title": null, "height": null, "width": null, "square": false, "logswitch": false, "logswitch_active": false, "logswitch_label": "Log10", "cpswitch": true, "cpswitch_c_active": true, "cpswitch_counts_label": "Counts", "cpswitch_percent_label": "Percentages", "xLog": null, "yLog": null, "xlog": false, "ylog": false, "data_labels": [], "xTitle": null, "yTitle": null, "xlab": null, "ylab": null, "xsuffix": null, "ysuffix": null, "tt_suffix": null, "xLabFormat": null, "yLabFormat": null, "xLabelFormat": null, "yLabelFormat": null, "xlab_format": null, "ylab_format": null, "tt_label": null, "xDecimals": null, "yDecimals": null, "decimalPlaces": null, "x_decimals": null, "y_decimals": null, "tt_decimals": null, "xmin": null, "xmax": null, "ymin": null, "ymax": null, "xFloor": null, "xCeiling": null, "yFloor": null, "yCeiling": null, "x_clipmin": null, "x_clipmax": null, "y_clipmin": null, "y_clipmax": null, "save_data_file": true, "showlegend": null, "xMinRange": null, "yMinRange": null, "x_minrange": null, "y_minrange": null, "xPlotBands": null, "yPlotBands": null, "xPlotLines": null, "yPlotLines": null, "x_bands": null, "y_bands": null, "x_lines": null, "y_lines": null, "namespace": "FastQC", "save_file": false, "raw_data_fn": null, "defaultsort": null, "sortRows": true, "sort_rows": false, "only_defined_headers": true, "col1_header": "Overrepresented sequence", "no_beeswarm": false, "no_violin": false, "scale": "GnBu", "min": null }, "add_log_tab": false, "add_pct_tab": false, "l_active": false, "p_active": false, "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [], "square": false, "flat": false, "defer_render": false, "violin_height": 70, "extra_height": 63, "no_violin": false, "show_table": true, "show_table_by_default": true, "n_samples": 20, "main_table_dt": { "id": "fastqc_top_overrepresented_sequences_table", "anchor": "fastqc_top_overrepresented_sequences_table_table", "pconfig": { "id": "fastqc_top_overrepresented_sequences_table", "title": "FastQC: Top overrepresented sequences", "anchor": null, "table_title": null, "height": null, "width": null, "square": false, "logswitch": false, "logswitch_active": false, "logswitch_label": "Log10", "cpswitch": true, "cpswitch_c_active": true, "cpswitch_counts_label": "Counts", "cpswitch_percent_label": "Percentages", "xLog": null, "yLog": null, "xlog": false, "ylog": false, "data_labels": [], "xTitle": null, "yTitle": null, "xlab": null, "ylab": null, "xsuffix": null, "ysuffix": null, "tt_suffix": null, "xLabFormat": null, "yLabFormat": null, "xLabelFormat": null, "yLabelFormat": null, "xlab_format": null, "ylab_format": null, "tt_label": null, "xDecimals": null, "yDecimals": null, "decimalPlaces": null, "x_decimals": null, "y_decimals": null, "tt_decimals": null, "xmin": null, "xmax": null, "ymin": null, "ymax": null, "xFloor": null, "xCeiling": null, "yFloor": null, "yCeiling": null, "x_clipmin": null, "x_clipmax": null, "y_clipmin": null, "y_clipmax": null, "save_data_file": true, "showlegend": null, "xMinRange": null, "yMinRange": null, "x_minrange": null, "y_minrange": null, "xPlotBands": null, "yPlotBands": null, "xPlotLines": null, "yPlotLines": null, "x_bands": null, "y_bands": null, "x_lines": null, "y_lines": null, "namespace": "FastQC", "save_file": false, "raw_data_fn": null, "defaultsort": null, "sortRows": true, "sort_rows": false, "only_defined_headers": true, "col1_header": "Overrepresented sequence", "no_beeswarm": false, "no_violin": false, "scale": "GnBu", "min": null }, "sections": [ { "column_by_key": { "samples": { "rid": "fastqc-samples", "title": "Reports", "description": "Number of FastQC reports where this sequence is founds as overrepresented", "scale": "Greens", "hidden": false, "placement": 1000.0, "namespace": "", "colour": null, "color": null, "max": null, "dmax": 56, "min": 0.0, "dmin": 0.0, "ceiling": null, "floor": null, "minRange": null, "minrange": null, "shared_key": null, "tt_decimals": null, "suffix": null, "cond_formatting_colours": [ { "blue": "#337ab7" }, { "lbue": "#5bc0de" }, { "pass": "#5cb85c" }, { "warn": "#f0ad4e" }, { "fail": "#d9534f" } ], "cond_formatting_rules": {}, "bgcols": {}, "bars_zero_centrepoint": false }, "total_count": { "rid": "fastqc-total_count", "title": "Occurrences", "description": "Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)", "scale": "Blues", "hidden": false, "placement": 1000.0, "namespace": "", "colour": null, "color": null, "max": null, "dmax": 178188, "min": 0.0, "dmin": 0.0, "ceiling": null, "floor": null, "minRange": null, "minrange": null, "shared_key": null, "tt_decimals": null, "suffix": null, "cond_formatting_colours": [ { "blue": "#337ab7" }, { "lbue": "#5bc0de" }, { "pass": "#5cb85c" }, { "warn": "#f0ad4e" }, { "fail": "#d9534f" } ], "cond_formatting_rules": {}, "bgcols": {}, "bars_zero_centrepoint": false }, "total_percent": { "rid": "fastqc-total_percent", "title": "% of all reads", "description": "Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)", "scale": "Blues", "hidden": false, "placement": 1000.0, "namespace": "", "colour": null, "color": null, "max": 100.0, "dmax": 100.0, "min": 0.0, "dmin": 0.0, "ceiling": null, "floor": null, "minRange": null, "minrange": null, "shared_key": null, "tt_decimals": null, "suffix": "%", "cond_formatting_colours": [ { "blue": "#337ab7" }, { "lbue": "#5bc0de" }, { "pass": "#5cb85c" }, { "warn": "#f0ad4e" }, { "fail": "#d9534f" } ], "cond_formatting_rules": {}, "bgcols": {}, "bars_zero_centrepoint": false } }, "rows_by_sgroup": { "CCTACGGGGGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": [ { "sample": "CCTACGGGGGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT", "raw_data": { "total_percent": 1.7320864970099084, "total_count": 178188, "samples": 56 }, "formatted_data": { "total_percent": "1.7321", "total_count": "178,188", "samples": "56" } } ], "CCTACGGGGGGCTGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": [ { "sample": "CCTACGGGGGGCTGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT", "raw_data": { "total_percent": 1.5437507174985665, "total_count": 158813, "samples": 55 }, "formatted_data": { "total_percent": "1.5438", "total_count": "158,813", "samples": "55" } } ], "CCTACGGGTGGCTGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": [ { "sample": "CCTACGGGTGGCTGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT", "raw_data": { "total_percent": 1.6292818929267108, "total_count": 167612, "samples": 55 }, "formatted_data": { "total_percent": "1.6293", "total_count": "167,612", "samples": "55" } } ], "CCTACGGGTGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": [ { "sample": "CCTACGGGTGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT", "raw_data": { "total_percent": 1.4788271215575985, "total_count": 152134, "samples": 55 }, "formatted_data": { "total_percent": "1.4788", "total_count": "152,134", "samples": "55" } } ], "CCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": [ { "sample": "CCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT", "raw_data": { "total_percent": 1.5010288722881227, "total_count": 154418, "samples": 55 }, "formatted_data": { "total_percent": "1.5010", "total_count": "154,418", "samples": "55" } } ], "CCTACGGGCGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": [ { "sample": "CCTACGGGCGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT", "raw_data": { "total_percent": 1.2953418996708328, "total_count": 133258, "samples": 55 }, "formatted_data": { "total_percent": "1.2953", "total_count": "133,258", "samples": "55" } } ], "CCTACGGGCGGCTGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": [ { "sample": "CCTACGGGCGGCTGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT", "raw_data": { "total_percent": 1.417179353110583, "total_count": 145792, "samples": 54 }, "formatted_data": { "total_percent": "1.4172", "total_count": "145,792", "samples": "54" } } ], "CCTACGGGAGGCTGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": [ { "sample": "CCTACGGGAGGCTGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT", "raw_data": { "total_percent": 1.1395213811899654, "total_count": 117228, "samples": 52 }, "formatted_data": { "total_percent": "1.1395", "total_count": "117,228", "samples": "52" } } ], "CCTACGGGGGGCAGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": [ { "sample": "CCTACGGGGGGCAGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT", "raw_data": { "total_percent": 1.5670314499852587, "total_count": 161208, "samples": 50 }, "formatted_data": { "total_percent": "1.5670", "total_count": "161,208", "samples": "50" } } ], "CCTACGGGTGGCTGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": [ { "sample": "CCTACGGGTGGCTGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT", "raw_data": { "total_percent": 1.3077550501449482, "total_count": 134535, "samples": 48 }, "formatted_data": { "total_percent": "1.3078", "total_count": "134,535", "samples": "48" } } ], "CCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": [ { "sample": "CCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT", "raw_data": { "total_percent": 1.2303210981662462, "total_count": 126569, "samples": 47 }, "formatted_data": { "total_percent": "1.2303", "total_count": "126,569", "samples": "47" } } ], "CCTACGGGGGGCTGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": [ { "sample": "CCTACGGGGGGCTGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT", "raw_data": { "total_percent": 1.0683571880646732, "total_count": 109907, "samples": 46 }, "formatted_data": { "total_percent": "1.0684", "total_count": "109,907", "samples": "46" } } ], "CCTACGGGTGGCAGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": [ { "sample": "CCTACGGGTGGCAGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT", "raw_data": { "total_percent": 1.1256112650361212, "total_count": 115797, "samples": 45 }, "formatted_data": { "total_percent": "1.1256", "total_count": "115,797", "samples": "45" } } ], "CCTACGGGCGGCAGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": [ { "sample": "CCTACGGGCGGCAGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT", "raw_data": { "total_percent": 1.052959826787462, "total_count": 108323, "samples": 45 }, "formatted_data": { "total_percent": "1.0530", "total_count": "108,323", "samples": "45" } } ], "CCTACGGGCGGCTGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": [ { "sample": "CCTACGGGCGGCTGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT", "raw_data": { "total_percent": 1.0025684626074984, "total_count": 103139, "samples": 44 }, "formatted_data": { "total_percent": "1.0026", "total_count": "103,139", "samples": "44" } } ], "CCTACGGGGGGCAGCAGTAGGGAATCTTCCACAATGGACGAAAGTCTGAT": [ { "sample": "CCTACGGGGGGCAGCAGTAGGGAATCTTCCACAATGGACGAAAGTCTGAT", "raw_data": { "total_percent": 1.54003746496833, "total_count": 158431, "samples": 43 }, "formatted_data": { "total_percent": "1.5400", "total_count": "158,431", "samples": "43" } } ], "CCTACGGGGGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGAT": [ { "sample": "CCTACGGGGGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGAT", "raw_data": { "total_percent": 1.3569993886742104, "total_count": 139601, "samples": 41 }, "formatted_data": { "total_percent": "1.3570", "total_count": "139,601", "samples": "41" } } ], "CCTACGGGAGGCTGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": [ { "sample": "CCTACGGGAGGCTGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT", "raw_data": { "total_percent": 0.532812855863493, "total_count": 54813, "samples": 41 }, "formatted_data": { "total_percent": "0.5328", "total_count": "54,813", "samples": "41" } } ], "CCTACGGGAGGCAGCAGTAGGGAATCTTCCACAATGGACGAAAGTCTGAT": [ { "sample": "CCTACGGGAGGCAGCAGTAGGGAATCTTCCACAATGGACGAAAGTCTGAT", "raw_data": { "total_percent": 1.2420732508077539, "total_count": 127778, "samples": 41 }, "formatted_data": { "total_percent": "1.2421", "total_count": "127,778", "samples": "41" } } ], "CCTACGGGTGGCTGCAGTAGGGAATCTTCCACAATGGACGAAAGTCTGAT": [ { "sample": "CCTACGGGTGGCTGCAGTAGGGAATCTTCCACAATGGACGAAAGTCTGAT", "raw_data": { "total_percent": 1.2921341160714137, "total_count": 132928, "samples": 41 }, "formatted_data": { "total_percent": "1.2921", "total_count": "132,928", "samples": "41" } } ] } } ], "headers_in_order": { "1000.0": [ [ 0, "samples" ], [ 0, "total_count" ], [ 0, "total_percent" ] ] } } }, "fastqc-status-check-heatmap": { "id": "fastqc-status-check-heatmap", "anchor": "fastqc-status-check-heatmap", "plot_type": "heatmap", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 700, "hoverlabel": { "namelength": -1 }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "white", "plot_bgcolor": "white", "showlegend": false, "title": { "font": { "size": 20 }, "text": "FastQC: Status Checks", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)", "type": "category", "tickmode": "array", "tickvals": [ 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 ], "ticktext": [ "Basic
Statistics", "Per Base
Sequence
Quality", "Per Tile
Sequence
Quality", "Per
Sequence
Quality
Scores", "Per Base
Sequence
Content", "Per
Sequence
GC Content", "Per Base N
Content", "Sequence
Length
Distribution", "Sequence
Duplication
Levels", "Overrepresented
Sequences", "Adapter
Content" ], "tickangle": 0, "showgrid": false }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)", "type": "category", "showgrid": false, "autorange": "reversed", "ticklabelposition": "outside right" } }, "datasets": [ { "plot_id": "fastqc-status-check-heatmap", "label": "1", "uid": "fastqc-status-check-heatmap", "dconfig": { "title": "FastQC: Status Checks
64 samples" }, "layout": { "title": { "text": "FastQC: Status Checks
64 samples" }, "xaxis": { "hoverformat": null, "ticksuffix": "", "title": null, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "yaxis": { "hoverformat": ",.1f", "ticksuffix": "", "title": null, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } } }, "trace_params": { "colorscale": [ [ 0.0, "#ffffff" ], [ 0.25, "#d9534f" ], [ 0.5, "#fee391" ], [ 1.0, "#5cb85c" ] ], "reversescale": false, "showscale": false, "zmin": 0, "zmax": 1, "hovertemplate": "Section Name: %{x}
Sample: %{y}
z: %{z}" }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "n_samples": 64, "rows": [ [ 1, 1, 1, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 1, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 1, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 1, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.5, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 1, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 1, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 1, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 1, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 1, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 1, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 1, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 1, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.5, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.5, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 1, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 1, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 1, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 1, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.5, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ] ], "xcats": [ "Basic Statistics", "Per Base Sequence Quality", "Per Tile Sequence Quality", "Per Sequence Quality Scores", "Per Base Sequence Content", "Per Sequence GC Content", "Per Base N Content", "Sequence Length Distribution", "Sequence Duplication Levels", "Overrepresented Sequences", "Adapter Content" ], "ycats": [ "CAFS1_R1", "CAFS2_R1", "CAMS1_R1", "CAMS2_R1", "CCFS1_R1", "CCFS2_R1", "CCMS1_R1", "CCMS2_R1", "CPFS1_R1", "CPFS2_R1", "CPMS1_R1", "CPMS2_R1", "CVFS1_R1", "CVFS2_R1", "CVMS1_R1", "CVMS2_R1", "DAFS1_R1", "DAFS2_R1", "DAMS1_R1", "DAMS2_R1", "DCFS1_R1", "DCFS2_R1", "DCMS1_R1", "DCMS2_R1", "DPFS1_R1", "DPFS2_R1", "DPMS1_R1", "DPMS2_R1", "DVFS1_R1", "DVFS2_R1", "DVMS1_R1", "DVMS2_R1", "IAFS1_R1", "IAFS2_R1", "IAMS1_R1", "IAMS2_R1", "ICFS1_R1", "ICFS2_R1", "ICMS1_R1", "ICMS2_R1", "IPFS1_R1", "IPFS2_R1", "IPMS1_R1", "IPMS2_R1", "IVFS1_R1", "IVFS2_R1", "IVMS1_R1", "IVMS2_R1", "JAFS1_R1", "JAFS2_R1", "JAMS1_R1", "JAMS2_R1", "JCFS1_R1", "JCFS2_R1", "JCMS1_R1", "JCMS2_R1", "JPFS1_R1", "JPFS2_R1", "JPMS1_R1", "JPMS2_R1", "JVFS1_R1", "JVFS2_R1", "JVMS1_R1", "JVMS2_R1" ] } ], "pconfig": { "id": "fastqc-status-check-heatmap", "title": "FastQC: Status Checks", "anchor": null, "table_title": null, "height": null, "width": null, "square": false, "logswitch": false, "logswitch_active": false, "logswitch_label": "Log10", "cpswitch": true, "cpswitch_c_active": true, "cpswitch_counts_label": "Counts", "cpswitch_percent_label": "Percentages", "xLog": null, "yLog": null, "xlog": false, "ylog": false, "data_labels": [], "xTitle": null, "yTitle": null, "xlab": "Section Name", "ylab": "Sample", "xsuffix": null, "ysuffix": null, "tt_suffix": null, "xLabFormat": null, "yLabFormat": null, "xLabelFormat": null, "yLabelFormat": null, "xlab_format": null, "ylab_format": null, "tt_label": null, "xDecimals": null, "yDecimals": null, "decimalPlaces": 2, "x_decimals": null, "y_decimals": null, "tt_decimals": 1, "xmin": null, "xmax": null, "ymin": null, "ymax": null, "xFloor": null, "xCeiling": null, "yFloor": null, "yCeiling": null, "x_clipmin": null, "x_clipmax": null, "y_clipmin": null, "y_clipmax": null, "save_data_file": true, "showlegend": null, "xMinRange": null, "yMinRange": null, "x_minrange": null, "y_minrange": null, "xPlotBands": null, "yPlotBands": null, "xPlotLines": null, "yPlotLines": null, "x_bands": null, "y_bands": null, "x_lines": null, "y_lines": null, "zlab": "z", "min": 0, "max": 1, "xcats_samples": false, "ycats_samples": true, "colstops": [ [ 0, "#ffffff" ], [ 0.25, "#d9534f" ], [ 0.5, "#fee391" ], [ 1, "#5cb85c" ] ], "reverseColors": false, "reverse_colors": false, "legend": false, "datalabels": null, "display_values": false, "angled_xticks": false }, "add_log_tab": false, "add_pct_tab": false, "l_active": false, "p_active": false, "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [], "square": false, "flat": false, "defer_render": false, "xcats_samples": false, "ycats_samples": true, "min": 0.0, "max": 1.0 }, "general_stats_table": { "id": "general_stats_table", "anchor": "general_stats_table", "plot_type": "violin", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 500, "hoverlabel": { "namelength": -1 }, "margin": { "b": 40, "l": 60, "pad": 0, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "white", "plot_bgcolor": "white", "showlegend": false, "title": { "font": { "size": 20 }, "text": "General Statistics", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": false, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.1)", "tickfont": { "color": "rgba(0,0,0,0.5)", "size": 9 }, "zerolinecolor": "rgba(0,0,0,0.1)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.1)", "tickfont": { "color": "rgba(0,0,0,0.5)", "size": 9 }, "zerolinecolor": "rgba(0,0,0,0.1)" }, "violingap": 0, "grid": { "columns": 1, "roworder": "top to bottom", "ygap": 0.4 } }, "datasets": [ { "plot_id": "general_stats_table", "label": "1", "uid": "general_stats_table", "dconfig": { "ylab": "", "title": "General Statistics
64 samples" }, "layout": { "title": { "text": "General Statistics
64 samples" }, "xaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": null }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "yaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "" }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } } }, "trace_params": { "hovertemplate": "%{text}: %{x}", "orientation": "h", "box": { "visible": true }, "meanline": { "visible": true }, "fillcolor": "#b5b5b5", "line": { "width": 2, "color": "#b5b5b5" }, "opacity": 0.5, "points": false, "hoveron": "points" }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "n_samples": 64, "metrics": [ "fastqc-percent_duplicates", "fastqc-percent_gc", "fastqc-avg_sequence_length", "fastqc-median_sequence_length", "fastqc-percent_fails", "fastqc-total_sequences" ], "header_by_metric": { "fastqc-percent_duplicates": { "title": "Dups", "description": "% duplicate reads", "suffix": "%", "dmin": 0.0, "dmax": 100.0, "hidden": false, "xaxis": { "ticksuffix": "%", "tickvals": null, "range": [ -0.5, 100.5025 ] }, "show_only_outliers": false, "show_points": true, "namespace": "FastQC", "color": null, "hoverformat": ".2f" }, "fastqc-percent_gc": { "title": "GC", "description": "Average % GC content", "suffix": "%", "dmin": 0.0, "dmax": 100.0, "hidden": false, "xaxis": { "ticksuffix": "%", "tickvals": null, "range": [ -0.5, 100.5025 ] }, "show_only_outliers": false, "show_points": true, "namespace": "FastQC", "color": null, "hoverformat": ".2f" }, "fastqc-avg_sequence_length": { "title": "Avg len", "description": "Average read length", "suffix": " bp", "dmin": 0.0, "dmax": 300.9908353631156, "hidden": true, "xaxis": { "ticksuffix": " bp", "tickvals": null, "range": [ -1.504954176815578, 302.50331431081526 ] }, "show_only_outliers": false, "show_points": true, "namespace": "FastQC", "color": null, "hoverformat": ".2f" }, "fastqc-median_sequence_length": { "title": "Median len", "description": "Median read length", "suffix": " bp", "dmin": 0.0, "dmax": 301, "hidden": true, "xaxis": { "ticksuffix": " bp", "tickvals": null, "range": [ -1.5050000000000001, 302.512525 ] }, "show_only_outliers": false, "show_points": true, "namespace": "FastQC", "color": null, "hoverformat": null }, "fastqc-percent_fails": { "title": "Failed", "description": "Percentage of modules failed in FastQC report (includes those not plotted here)", "suffix": "%", "dmin": 0.0, "dmax": 100.0, "hidden": true, "xaxis": { "ticksuffix": "%", "tickvals": null, "range": [ -0.5, 100.5025 ] }, "show_only_outliers": false, "show_points": true, "namespace": "FastQC", "color": null, "hoverformat": ".2f" }, "fastqc-total_sequences": { "title": "Seqs", "description": "Total sequences (millions)", "suffix": "M", "dmin": 0.0, "dmax": 0.347311, "hidden": false, "xaxis": { "ticksuffix": "M", "tickvals": null, "range": [ -0.0017365549999999999, 0.349056237775 ] }, "show_only_outliers": false, "show_points": true, "namespace": "FastQC", "color": null, "hoverformat": ".2f" } }, "violin_value_by_sample_by_metric": { "fastqc-percent_duplicates": { "CAFS1_R1": 95.6209855984775, "CAFS2_R1": 95.38179128918941, "CAMS1_R1": 95.36257126916954, "CAMS2_R1": 95.7225868933606, "CCFS1_R1": 93.88749671184704, "CCFS2_R1": 93.43198734969138, "CCMS1_R1": 93.73970189056621, "CCMS2_R1": 93.68179440695094, "CPFS1_R1": 94.83240036873255, "CPFS2_R1": 93.12022858163311, "CPMS1_R1": 93.68516092483094, "CPMS2_R1": 93.74490299203524, "CVFS1_R1": 93.72293780366633, "CVFS2_R1": 93.75779972719094, "CVMS1_R1": 93.97809820902685, "CVMS2_R1": 94.05224321779686, "DAFS1_R1": 94.36826477162779, "DAFS2_R1": 91.30863539445629, "DAMS1_R1": 95.0696256247446, "DAMS2_R1": 96.35605488808325, "DCFS1_R1": 94.17530308955807, "DCFS2_R1": 91.76124009258609, "DCMS1_R1": 95.2101754806996, "DCMS2_R1": 92.01813144234137, "DPFS1_R1": 94.53711661195565, "DPFS2_R1": 93.55219632570568, "DPMS1_R1": 91.64054973598527, "DPMS2_R1": 91.30775434957944, "DVFS1_R1": 91.57170650361311, "DVFS2_R1": 92.38402112648299, "DVMS1_R1": 92.25305832062173, "DVMS2_R1": 92.79270329506578, "IAFS1_R1": 97.81860629126591, "IAFS2_R1": 97.62100403020699, "IAMS1_R1": 97.57068476899757, "IAMS2_R1": 96.21356470828691, "ICFS1_R1": 93.129820097349, "ICFS2_R1": 92.59269975002314, "ICMS1_R1": 95.9035699441186, "ICMS2_R1": 95.04396610034615, "IPFS1_R1": 95.75862625961408, "IPFS2_R1": 93.79310959416829, "IPMS1_R1": 96.4084810518309, "IPMS2_R1": 95.10096727013507, "IVFS1_R1": 96.65768335349847, "IVFS2_R1": 96.26510751844295, "IVMS1_R1": 94.1352429877209, "IVMS2_R1": 95.14840026609075, "JAFS1_R1": 96.21137720027197, "JAFS2_R1": 95.54718416142795, "JAMS1_R1": 97.99869067503656, "JAMS2_R1": 96.84320958408068, "JCFS1_R1": 97.08729096279298, "JCFS2_R1": 96.70245197235289, "JCMS1_R1": 95.55912186235571, "JCMS2_R1": 94.02598625364843, "JPFS1_R1": 97.49040120193645, "JPFS2_R1": 96.96984715421367, "JPMS1_R1": 95.1160182297459, "JPMS2_R1": 94.45268311585725, "JVFS1_R1": 95.5890523247871, "JVFS2_R1": 95.45566625570623, "JVMS1_R1": 96.57108470506262, "JVMS2_R1": 94.15209164365348 }, "fastqc-percent_gc": { "CAFS1_R1": 54.0, "CAFS2_R1": 53.0, "CAMS1_R1": 53.0, "CAMS2_R1": 53.0, "CCFS1_R1": 53.0, "CCFS2_R1": 53.0, "CCMS1_R1": 53.0, "CCMS2_R1": 53.0, "CPFS1_R1": 53.0, "CPFS2_R1": 53.0, "CPMS1_R1": 53.0, "CPMS2_R1": 53.0, "CVFS1_R1": 53.0, "CVFS2_R1": 53.0, "CVMS1_R1": 52.0, "CVMS2_R1": 52.0, "DAFS1_R1": 54.0, "DAFS2_R1": 53.0, "DAMS1_R1": 50.0, "DAMS2_R1": 50.0, "DCFS1_R1": 51.0, "DCFS2_R1": 51.0, "DCMS1_R1": 52.0, "DCMS2_R1": 51.0, "DPFS1_R1": 52.0, "DPFS2_R1": 51.0, "DPMS1_R1": 52.0, "DPMS2_R1": 51.0, "DVFS1_R1": 51.0, "DVFS2_R1": 51.0, "DVMS1_R1": 52.0, "DVMS2_R1": 52.0, "IAFS1_R1": 54.0, "IAFS2_R1": 54.0, "IAMS1_R1": 54.0, "IAMS2_R1": 54.0, "ICFS1_R1": 52.0, "ICFS2_R1": 53.0, "ICMS1_R1": 53.0, "ICMS2_R1": 54.0, "IPFS1_R1": 52.0, "IPFS2_R1": 53.0, "IPMS1_R1": 54.0, "IPMS2_R1": 53.0, "IVFS1_R1": 54.0, "IVFS2_R1": 51.0, "IVMS1_R1": 52.0, "IVMS2_R1": 51.0, "JAFS1_R1": 53.0, "JAFS2_R1": 53.0, "JAMS1_R1": 50.0, "JAMS2_R1": 50.0, "JCFS1_R1": 51.0, "JCFS2_R1": 51.0, "JCMS1_R1": 52.0, "JCMS2_R1": 52.0, "JPFS1_R1": 51.0, "JPFS2_R1": 51.0, "JPMS1_R1": 51.0, "JPMS2_R1": 51.0, "JVFS1_R1": 51.0, "JVFS2_R1": 54.0, "JVMS1_R1": 52.0, "JVMS2_R1": 52.0 }, "fastqc-avg_sequence_length": { "CAFS1_R1": 300.98912108624444, "CAFS2_R1": 300.49757005889967, "CAMS1_R1": 300.9908353631156, "CAMS2_R1": 300.98940062412566, "CCFS1_R1": 300.96590935312224, "CCFS2_R1": 300.92754644111545, "CCMS1_R1": 300.9813800657174, "CCMS2_R1": 300.973304286447, "CPFS1_R1": 300.8958597747525, "CPFS2_R1": 300.9559969195053, "CPMS1_R1": 300.95744078178666, "CPMS2_R1": 300.96786016007655, "CVFS1_R1": 300.95555874604605, "CVFS2_R1": 300.97790681925915, "CVMS1_R1": 300.9705258393142, "CVMS2_R1": 300.9735849882858, "DAFS1_R1": 300.86233165404417, "DAFS2_R1": 300.6738272921109, "DAMS1_R1": 300.83824222801996, "DAMS2_R1": 300.818681250696, "DCFS1_R1": 300.4278003193847, "DCFS2_R1": 299.3111383881602, "DCMS1_R1": 300.75027826166115, "DCMS2_R1": 299.26231144043055, "DPFS1_R1": 300.6953324222657, "DPFS2_R1": 299.76268479338717, "DPMS1_R1": 300.5020548028731, "DPMS2_R1": 300.60624495909667, "DVFS1_R1": 300.7119302390217, "DVFS2_R1": 300.13608056442393, "DVMS1_R1": 300.6154806190801, "DVMS2_R1": 300.61822065205916, "IAFS1_R1": 300.98650916209675, "IAFS2_R1": 300.98274445357436, "IAMS1_R1": 300.9770711131615, "IAMS2_R1": 300.97739215285515, "ICFS1_R1": 300.8100908447634, "ICFS2_R1": 300.8646797750208, "ICMS1_R1": 300.9421917414574, "ICMS2_R1": 300.95274738391754, "IPFS1_R1": 300.9171978479393, "IPFS2_R1": 300.9690279287789, "IPMS1_R1": 300.95856073160786, "IPMS2_R1": 300.95523354186383, "IVFS1_R1": 300.9764570220535, "IVFS2_R1": 300.85812666771307, "IVMS1_R1": 300.84647928823523, "IVMS2_R1": 300.9528053436854, "JAFS1_R1": 300.9448402205938, "JAFS2_R1": 300.9482346789623, "JAMS1_R1": 300.96827028382984, "JAMS2_R1": 300.94705066161293, "JCFS1_R1": 300.91172892628714, "JCFS2_R1": 300.9076601140574, "JCMS1_R1": 300.9189711686815, "JCMS2_R1": 300.8786602014876, "JPFS1_R1": 300.9633726131417, "JPFS2_R1": 300.9524017207541, "JPMS1_R1": 300.9438105469397, "JPMS2_R1": 300.91419320222667, "JVFS1_R1": 300.854879548249, "JVFS2_R1": 300.97411615740896, "JVMS1_R1": 300.8928481965731, "JVMS2_R1": 300.894054072483 }, "fastqc-median_sequence_length": { "CAFS1_R1": 301, "CAFS2_R1": 300, "CAMS1_R1": 301, "CAMS2_R1": 301, "CCFS1_R1": 301, "CCFS2_R1": 301, "CCMS1_R1": 301, "CCMS2_R1": 301, "CPFS1_R1": 301, "CPFS2_R1": 301, "CPMS1_R1": 301, "CPMS2_R1": 301, "CVFS1_R1": 301, "CVFS2_R1": 301, "CVMS1_R1": 301, "CVMS2_R1": 301, "DAFS1_R1": 301, "DAFS2_R1": 301, "DAMS1_R1": 301, "DAMS2_R1": 301, "DCFS1_R1": 301, "DCFS2_R1": 301, "DCMS1_R1": 301, "DCMS2_R1": 301, "DPFS1_R1": 301, "DPFS2_R1": 301, "DPMS1_R1": 301, "DPMS2_R1": 301, "DVFS1_R1": 301, "DVFS2_R1": 301, "DVMS1_R1": 301, "DVMS2_R1": 301, "IAFS1_R1": 301, "IAFS2_R1": 301, "IAMS1_R1": 301, "IAMS2_R1": 301, "ICFS1_R1": 301, "ICFS2_R1": 301, "ICMS1_R1": 301, "ICMS2_R1": 301, "IPFS1_R1": 301, "IPFS2_R1": 301, "IPMS1_R1": 301, "IPMS2_R1": 301, "IVFS1_R1": 301, "IVFS2_R1": 301, "IVMS1_R1": 301, "IVMS2_R1": 301, "JAFS1_R1": 301, "JAFS2_R1": 301, "JAMS1_R1": 301, "JAMS2_R1": 301, "JCFS1_R1": 301, "JCFS2_R1": 301, "JCMS1_R1": 301, "JCMS2_R1": 301, "JPFS1_R1": 301, "JPFS2_R1": 301, "JPMS1_R1": 301, "JPMS2_R1": 301, "JVFS1_R1": 301, "JVFS2_R1": 301, "JVMS1_R1": 301, "JVMS2_R1": 301 }, "fastqc-percent_fails": { "CAFS1_R1": 36.36363636363637, "CAFS2_R1": 36.36363636363637, "CAMS1_R1": 36.36363636363637, "CAMS2_R1": 36.36363636363637, "CCFS1_R1": 36.36363636363637, "CCFS2_R1": 36.36363636363637, "CCMS1_R1": 36.36363636363637, "CCMS2_R1": 36.36363636363637, "CPFS1_R1": 36.36363636363637, "CPFS2_R1": 27.27272727272727, "CPMS1_R1": 36.36363636363637, "CPMS2_R1": 36.36363636363637, "CVFS1_R1": 36.36363636363637, "CVFS2_R1": 36.36363636363637, "CVMS1_R1": 36.36363636363637, "CVMS2_R1": 36.36363636363637, "DAFS1_R1": 36.36363636363637, "DAFS2_R1": 36.36363636363637, "DAMS1_R1": 36.36363636363637, "DAMS2_R1": 36.36363636363637, "DCFS1_R1": 36.36363636363637, "DCFS2_R1": 36.36363636363637, "DCMS1_R1": 36.36363636363637, "DCMS2_R1": 36.36363636363637, "DPFS1_R1": 36.36363636363637, "DPFS2_R1": 36.36363636363637, "DPMS1_R1": 36.36363636363637, "DPMS2_R1": 36.36363636363637, "DVFS1_R1": 36.36363636363637, "DVFS2_R1": 36.36363636363637, "DVMS1_R1": 36.36363636363637, "DVMS2_R1": 36.36363636363637, "IAFS1_R1": 36.36363636363637, "IAFS2_R1": 36.36363636363637, "IAMS1_R1": 36.36363636363637, "IAMS2_R1": 36.36363636363637, "ICFS1_R1": 36.36363636363637, "ICFS2_R1": 36.36363636363637, "ICMS1_R1": 36.36363636363637, "ICMS2_R1": 36.36363636363637, "IPFS1_R1": 36.36363636363637, "IPFS2_R1": 27.27272727272727, "IPMS1_R1": 36.36363636363637, "IPMS2_R1": 27.27272727272727, "IVFS1_R1": 36.36363636363637, "IVFS2_R1": 36.36363636363637, "IVMS1_R1": 36.36363636363637, "IVMS2_R1": 36.36363636363637, "JAFS1_R1": 36.36363636363637, "JAFS2_R1": 36.36363636363637, "JAMS1_R1": 36.36363636363637, "JAMS2_R1": 36.36363636363637, "JCFS1_R1": 36.36363636363637, "JCFS2_R1": 36.36363636363637, "JCMS1_R1": 36.36363636363637, "JCMS2_R1": 36.36363636363637, "JPFS1_R1": 36.36363636363637, "JPFS2_R1": 36.36363636363637, "JPMS1_R1": 36.36363636363637, "JPMS2_R1": 36.36363636363637, "JVFS1_R1": 36.36363636363637, "JVFS2_R1": 36.36363636363637, "JVMS1_R1": 36.36363636363637, "JVMS2_R1": 36.36363636363637 }, "fastqc-total_sequences": { "CAFS1_R1": 0.163941, "CAFS2_R1": 0.151444, "CAMS1_R1": 0.146978, "CAMS2_R1": 0.167274, "CCFS1_R1": 0.216687, "CCFS2_R1": 0.20299899999999999, "CCMS1_R1": 0.20998999999999998, "CCMS2_R1": 0.196923, "CPFS1_R1": 0.149702, "CPFS2_R1": 0.179192, "CPMS1_R1": 0.22594399999999998, "CPMS2_R1": 0.204777, "CVFS1_R1": 0.21940199999999999, "CVFS2_R1": 0.20673799999999998, "CVMS1_R1": 0.183364, "CVMS2_R1": 0.228355, "DAFS1_R1": 0.089919, "DAFS2_R1": 0.03752, "DAMS1_R1": 0.063626, "DAMS2_R1": 0.080819, "DCFS1_R1": 0.122736, "DCFS2_R1": 0.071285, "DCMS1_R1": 0.24167899999999998, "DCMS2_R1": 0.094201, "DPFS1_R1": 0.141958, "DPFS2_R1": 0.132107, "DPMS1_R1": 0.08200299999999999, "DPMS2_R1": 0.08678999999999999, "DVFS1_R1": 0.07196, "DVFS2_R1": 0.10148399999999999, "DVMS1_R1": 0.16585899999999998, "DVMS2_R1": 0.16105899999999998, "IAFS1_R1": 0.164482, "IAFS2_R1": 0.12778499999999998, "IAMS1_R1": 0.15173, "IAMS2_R1": 0.151673, "ICFS1_R1": 0.139909, "ICFS2_R1": 0.172816, "ICMS1_R1": 0.194877, "ICMS2_R1": 0.125665, "IPFS1_R1": 0.160962, "IPFS2_R1": 0.224428, "IPMS1_R1": 0.345759, "IPMS2_R1": 0.244089, "IVFS1_R1": 0.22894299999999998, "IVFS2_R1": 0.12742, "IVMS1_R1": 0.15611899999999998, "IVMS2_R1": 0.109737, "JAFS1_R1": 0.13237, "JAFS2_R1": 0.084149, "JAMS1_R1": 0.163443, "JAMS2_R1": 0.147745, "JCFS1_R1": 0.188244, "JCFS2_R1": 0.152204, "JCMS1_R1": 0.161387, "JCMS2_R1": 0.12745199999999998, "JPFS1_R1": 0.233623, "JPFS2_R1": 0.20177199999999998, "JPMS1_R1": 0.211303, "JPMS2_R1": 0.134191, "JVFS1_R1": 0.10979499999999999, "JVFS2_R1": 0.150055, "JVMS1_R1": 0.347311, "JVMS2_R1": 0.117324 } }, "scatter_value_by_sample_by_metric": { "fastqc-percent_duplicates": {}, "fastqc-percent_gc": {}, "fastqc-avg_sequence_length": {}, "fastqc-median_sequence_length": {}, "fastqc-percent_fails": {}, "fastqc-total_sequences": {} }, "all_samples": [ "CAFS1_R1", "CAFS2_R1", "CAMS1_R1", "CAMS2_R1", "CCFS1_R1", "CCFS2_R1", "CCMS1_R1", "CCMS2_R1", "CPFS1_R1", "CPFS2_R1", "CPMS1_R1", "CPMS2_R1", "CVFS1_R1", "CVFS2_R1", "CVMS1_R1", "CVMS2_R1", "DAFS1_R1", "DAFS2_R1", "DAMS1_R1", "DAMS2_R1", "DCFS1_R1", "DCFS2_R1", "DCMS1_R1", "DCMS2_R1", "DPFS1_R1", "DPFS2_R1", "DPMS1_R1", "DPMS2_R1", "DVFS1_R1", "DVFS2_R1", "DVMS1_R1", "DVMS2_R1", "IAFS1_R1", "IAFS2_R1", "IAMS1_R1", "IAMS2_R1", "ICFS1_R1", "ICFS2_R1", "ICMS1_R1", "ICMS2_R1", "IPFS1_R1", "IPFS2_R1", "IPMS1_R1", "IPMS2_R1", "IVFS1_R1", "IVFS2_R1", "IVMS1_R1", "IVMS2_R1", "JAFS1_R1", "JAFS2_R1", "JAMS1_R1", "JAMS2_R1", "JCFS1_R1", "JCFS2_R1", "JCMS1_R1", "JCMS2_R1", "JPFS1_R1", "JPFS2_R1", "JPMS1_R1", "JPMS2_R1", "JVFS1_R1", "JVFS2_R1", "JVMS1_R1", "JVMS2_R1" ], "scatter_trace_params": { "mode": "markers", "marker": { "size": 4, "color": "#0b79e6" }, "showlegend": false, "hovertemplate": "%{text}: %{x}", "hoverlabel": { "bgcolor": "white" } } } ], "pconfig": { "id": "general_stats_table", "title": "General Statistics", "anchor": null, "table_title": null, "height": null, "width": null, "square": false, "logswitch": false, "logswitch_active": false, "logswitch_label": "Log10", "cpswitch": true, "cpswitch_c_active": true, "cpswitch_counts_label": "Counts", "cpswitch_percent_label": "Percentages", "xLog": null, "yLog": null, "xlog": false, "ylog": false, "data_labels": [], "xTitle": null, "yTitle": null, "xlab": null, "ylab": null, "xsuffix": null, "ysuffix": null, "tt_suffix": null, "xLabFormat": null, "yLabFormat": null, "xLabelFormat": null, "yLabelFormat": null, "xlab_format": null, "ylab_format": null, "tt_label": null, "xDecimals": null, "yDecimals": null, "decimalPlaces": null, "x_decimals": null, "y_decimals": null, "tt_decimals": null, "xmin": null, "xmax": null, "ymin": null, "ymax": null, "xFloor": null, "xCeiling": null, "yFloor": null, "yCeiling": null, "x_clipmin": null, "x_clipmax": null, "y_clipmin": null, "y_clipmax": null, "save_data_file": true, "showlegend": null, "xMinRange": null, "yMinRange": null, "x_minrange": null, "y_minrange": null, "xPlotBands": null, "yPlotBands": null, "xPlotLines": null, "yPlotLines": null, "x_bands": null, "y_bands": null, "x_lines": null, "y_lines": null, "namespace": "", "save_file": true, "raw_data_fn": "multiqc_general_stats", "defaultsort": null, "sortRows": true, "sort_rows": true, "only_defined_headers": true, "col1_header": "Sample Name", "no_beeswarm": false, "no_violin": false, "scale": "GnBu", "min": null }, "add_log_tab": false, "add_pct_tab": false, "l_active": false, "p_active": false, "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [], "square": false, "flat": false, "defer_render": false, "violin_height": 70, "extra_height": 63, "no_violin": false, "show_table": true, "show_table_by_default": true, "n_samples": 64, "main_table_dt": { "id": "general_stats_table", "anchor": "general_stats_table_table", "pconfig": { "id": "general_stats_table", "title": "General Statistics", "anchor": null, "table_title": null, "height": null, "width": null, "square": false, "logswitch": false, "logswitch_active": false, "logswitch_label": "Log10", "cpswitch": true, "cpswitch_c_active": true, "cpswitch_counts_label": "Counts", "cpswitch_percent_label": "Percentages", "xLog": null, "yLog": null, "xlog": false, "ylog": false, "data_labels": [], "xTitle": null, "yTitle": null, "xlab": null, "ylab": null, "xsuffix": null, "ysuffix": null, "tt_suffix": null, "xLabFormat": null, "yLabFormat": null, "xLabelFormat": null, "yLabelFormat": null, "xlab_format": null, "ylab_format": null, "tt_label": null, "xDecimals": null, "yDecimals": null, "decimalPlaces": null, "x_decimals": null, "y_decimals": null, "tt_decimals": null, "xmin": null, "xmax": null, "ymin": null, "ymax": null, "xFloor": null, "xCeiling": null, "yFloor": null, "yCeiling": null, "x_clipmin": null, "x_clipmax": null, "y_clipmin": null, "y_clipmax": null, "save_data_file": true, "showlegend": null, "xMinRange": null, "yMinRange": null, "x_minrange": null, "y_minrange": null, "xPlotBands": null, "yPlotBands": null, "xPlotLines": null, "yPlotLines": null, "x_bands": null, "y_bands": null, "x_lines": null, "y_lines": null, "namespace": "", "save_file": true, "raw_data_fn": "multiqc_general_stats", "defaultsort": null, "sortRows": true, "sort_rows": true, "only_defined_headers": true, "col1_header": "Sample Name", "no_beeswarm": false, "no_violin": false, "scale": "GnBu", "min": null }, "sections": [ { "column_by_key": { "percent_duplicates": { "rid": "fastqc-percent_duplicates", "title": "Dups", "description": "% duplicate reads", "scale": "RdYlGn-rev", "hidden": false, "placement": 1000.0, "namespace": "FastQC", "colour": null, "color": null, "max": 100.0, "dmax": 100.0, "min": 0.0, "dmin": 0.0, "ceiling": null, "floor": null, "minRange": null, "minrange": null, "shared_key": null, "tt_decimals": null, "suffix": "%", "cond_formatting_colours": [ { "blue": "#337ab7" }, { "lbue": "#5bc0de" }, { "pass": "#5cb85c" }, { "warn": "#f0ad4e" }, { "fail": "#d9534f" } ], "cond_formatting_rules": {}, "bgcols": {}, "bars_zero_centrepoint": false }, "percent_gc": { "rid": "fastqc-percent_gc", "title": "GC", "description": "Average % GC content", "scale": "PuRd", "hidden": false, "placement": 1000.0, "namespace": "FastQC", "colour": null, "color": null, "max": 100.0, "dmax": 100.0, "min": 0.0, "dmin": 0.0, "ceiling": null, "floor": null, "minRange": null, "minrange": null, "shared_key": null, "tt_decimals": null, "suffix": "%", "cond_formatting_colours": [ { "blue": "#337ab7" }, { "lbue": "#5bc0de" }, { "pass": "#5cb85c" }, { "warn": "#f0ad4e" }, { "fail": "#d9534f" } ], "cond_formatting_rules": {}, "bgcols": {}, "bars_zero_centrepoint": false }, "avg_sequence_length": { "rid": "fastqc-avg_sequence_length", "title": "Avg len", "description": "Average read length", "scale": "RdYlGn", "hidden": true, "placement": 1000.0, "namespace": "FastQC", "colour": null, "color": null, "max": null, "dmax": 300.9908353631156, "min": 0.0, "dmin": 0.0, "ceiling": null, "floor": null, "minRange": null, "minrange": null, "shared_key": null, "tt_decimals": null, "suffix": " bp", "cond_formatting_colours": [ { "blue": "#337ab7" }, { "lbue": "#5bc0de" }, { "pass": "#5cb85c" }, { "warn": "#f0ad4e" }, { "fail": "#d9534f" } ], "cond_formatting_rules": {}, "bgcols": {}, "bars_zero_centrepoint": false }, "median_sequence_length": { "rid": "fastqc-median_sequence_length", "title": "Median len", "description": "Median read length", "scale": "RdYlGn", "hidden": true, "placement": 1000.0, "namespace": "FastQC", "colour": null, "color": null, "max": null, "dmax": 301, "min": 0.0, "dmin": 0.0, "ceiling": null, "floor": null, "minRange": null, "minrange": null, "shared_key": null, "tt_decimals": null, "suffix": " bp", "cond_formatting_colours": [ { "blue": "#337ab7" }, { "lbue": "#5bc0de" }, { "pass": "#5cb85c" }, { "warn": "#f0ad4e" }, { "fail": "#d9534f" } ], "cond_formatting_rules": {}, "bgcols": {}, "bars_zero_centrepoint": false }, "percent_fails": { "rid": "fastqc-percent_fails", "title": "Failed", "description": "Percentage of modules failed in FastQC report (includes those not plotted here)", "scale": "Reds", "hidden": true, "placement": 1000.0, "namespace": "FastQC", "colour": null, "color": null, "max": 100.0, "dmax": 100.0, "min": 0.0, "dmin": 0.0, "ceiling": null, "floor": null, "minRange": null, "minrange": null, "shared_key": null, "tt_decimals": null, "suffix": "%", "cond_formatting_colours": [ { "blue": "#337ab7" }, { "lbue": "#5bc0de" }, { "pass": "#5cb85c" }, { "warn": "#f0ad4e" }, { "fail": "#d9534f" } ], "cond_formatting_rules": {}, "bgcols": {}, "bars_zero_centrepoint": false }, "total_sequences": { "rid": "fastqc-total_sequences", "title": "Seqs", "description": "Total sequences (millions)", "scale": "Blues", "hidden": false, "placement": 1000.0, "namespace": "FastQC", "colour": null, "color": null, "max": null, "dmax": 0.347311, "min": 0.0, "dmin": 0.0, "ceiling": null, "floor": null, "minRange": null, "minrange": null, "shared_key": null, "tt_decimals": null, "suffix": "M", "cond_formatting_colours": [ { "blue": "#337ab7" }, { "lbue": "#5bc0de" }, { "pass": "#5cb85c" }, { "warn": "#f0ad4e" }, { "fail": "#d9534f" } ], "cond_formatting_rules": {}, "bgcols": {}, "bars_zero_centrepoint": false } }, "rows_by_sgroup": { "CAFS1_R1": [ { "sample": "CAFS1_R1", "raw_data": { "total_sequences": 0.163941, "percent_gc": 54.0, "avg_sequence_length": 300.98912108624444, "median_sequence_length": 301, "percent_duplicates": 95.6209855984775, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "54.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "95.6", "percent_fails": "36" } } ], "CAFS2_R1": [ { "sample": "CAFS2_R1", "raw_data": { "total_sequences": 0.151444, "percent_gc": 53.0, "avg_sequence_length": 300.49757005889967, "median_sequence_length": 300, "percent_duplicates": 95.38179128918941, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "53.0", "avg_sequence_length": "300", "median_sequence_length": "300", "percent_duplicates": "95.4", "percent_fails": "36" } } ], "CAMS1_R1": [ { "sample": "CAMS1_R1", "raw_data": { "total_sequences": 0.146978, "percent_gc": 53.0, "avg_sequence_length": 300.9908353631156, "median_sequence_length": 301, "percent_duplicates": 95.36257126916954, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "53.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "95.4", "percent_fails": "36" } } ], "CAMS2_R1": [ { "sample": "CAMS2_R1", "raw_data": { "total_sequences": 0.167274, "percent_gc": 53.0, "avg_sequence_length": 300.98940062412566, "median_sequence_length": 301, "percent_duplicates": 95.7225868933606, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "53.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "95.7", "percent_fails": "36" } } ], "CCFS1_R1": [ { "sample": "CCFS1_R1", "raw_data": { "total_sequences": 0.216687, "percent_gc": 53.0, "avg_sequence_length": 300.96590935312224, "median_sequence_length": 301, "percent_duplicates": 93.88749671184704, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "53.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "93.9", "percent_fails": "36" } } ], "CCFS2_R1": [ { "sample": "CCFS2_R1", "raw_data": { "total_sequences": 0.20299899999999999, "percent_gc": 53.0, "avg_sequence_length": 300.92754644111545, "median_sequence_length": 301, "percent_duplicates": 93.43198734969138, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "53.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "93.4", "percent_fails": "36" } } ], "CCMS1_R1": [ { "sample": "CCMS1_R1", "raw_data": { "total_sequences": 0.20998999999999998, "percent_gc": 53.0, "avg_sequence_length": 300.9813800657174, "median_sequence_length": 301, "percent_duplicates": 93.73970189056621, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "53.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "93.7", "percent_fails": "36" } } ], "CCMS2_R1": [ { "sample": "CCMS2_R1", "raw_data": { "total_sequences": 0.196923, "percent_gc": 53.0, "avg_sequence_length": 300.973304286447, "median_sequence_length": 301, "percent_duplicates": 93.68179440695094, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "53.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "93.7", "percent_fails": "36" } } ], "CPFS1_R1": [ { "sample": "CPFS1_R1", "raw_data": { "total_sequences": 0.149702, "percent_gc": 53.0, "avg_sequence_length": 300.8958597747525, "median_sequence_length": 301, "percent_duplicates": 94.83240036873255, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "53.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "94.8", "percent_fails": "36" } } ], "CPFS2_R1": [ { "sample": "CPFS2_R1", "raw_data": { "total_sequences": 0.179192, "percent_gc": 53.0, "avg_sequence_length": 300.9559969195053, "median_sequence_length": 301, "percent_duplicates": 93.12022858163311, "percent_fails": 27.27272727272727 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "53.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "93.1", "percent_fails": "27" } } ], "CPMS1_R1": [ { "sample": "CPMS1_R1", "raw_data": { "total_sequences": 0.22594399999999998, "percent_gc": 53.0, "avg_sequence_length": 300.95744078178666, "median_sequence_length": 301, "percent_duplicates": 93.68516092483094, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "53.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "93.7", "percent_fails": "36" } } ], "CPMS2_R1": [ { "sample": "CPMS2_R1", "raw_data": { "total_sequences": 0.204777, "percent_gc": 53.0, "avg_sequence_length": 300.96786016007655, "median_sequence_length": 301, "percent_duplicates": 93.74490299203524, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "53.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "93.7", "percent_fails": "36" } } ], "CVFS1_R1": [ { "sample": "CVFS1_R1", "raw_data": { "total_sequences": 0.21940199999999999, "percent_gc": 53.0, "avg_sequence_length": 300.95555874604605, "median_sequence_length": 301, "percent_duplicates": 93.72293780366633, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "53.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "93.7", "percent_fails": "36" } } ], "CVFS2_R1": [ { "sample": "CVFS2_R1", "raw_data": { "total_sequences": 0.20673799999999998, "percent_gc": 53.0, "avg_sequence_length": 300.97790681925915, "median_sequence_length": 301, "percent_duplicates": 93.75779972719094, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "53.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "93.8", "percent_fails": "36" } } ], "CVMS1_R1": [ { "sample": "CVMS1_R1", "raw_data": { "total_sequences": 0.183364, "percent_gc": 52.0, "avg_sequence_length": 300.9705258393142, "median_sequence_length": 301, "percent_duplicates": 93.97809820902685, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "52.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "94.0", "percent_fails": "36" } } ], "CVMS2_R1": [ { "sample": "CVMS2_R1", "raw_data": { "total_sequences": 0.228355, "percent_gc": 52.0, "avg_sequence_length": 300.9735849882858, "median_sequence_length": 301, "percent_duplicates": 94.05224321779686, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "52.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "94.1", "percent_fails": "36" } } ], "DAFS1_R1": [ { "sample": "DAFS1_R1", "raw_data": { "total_sequences": 0.089919, "percent_gc": 54.0, "avg_sequence_length": 300.86233165404417, "median_sequence_length": 301, "percent_duplicates": 94.36826477162779, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "54.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "94.4", "percent_fails": "36" } } ], "DAFS2_R1": [ { "sample": "DAFS2_R1", "raw_data": { "total_sequences": 0.03752, "percent_gc": 53.0, "avg_sequence_length": 300.6738272921109, "median_sequence_length": 301, "percent_duplicates": 91.30863539445629, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.0", "percent_gc": "53.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "91.3", "percent_fails": "36" } } ], "DAMS1_R1": [ { "sample": "DAMS1_R1", "raw_data": { "total_sequences": 0.063626, "percent_gc": 50.0, "avg_sequence_length": 300.83824222801996, "median_sequence_length": 301, "percent_duplicates": 95.0696256247446, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "50.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "95.1", "percent_fails": "36" } } ], "DAMS2_R1": [ { "sample": "DAMS2_R1", "raw_data": { "total_sequences": 0.080819, "percent_gc": 50.0, "avg_sequence_length": 300.818681250696, "median_sequence_length": 301, "percent_duplicates": 96.35605488808325, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "50.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "96.4", "percent_fails": "36" } } ], "DCFS1_R1": [ { "sample": "DCFS1_R1", "raw_data": { "total_sequences": 0.122736, "percent_gc": 51.0, "avg_sequence_length": 300.4278003193847, "median_sequence_length": 301, "percent_duplicates": 94.17530308955807, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "51.0", "avg_sequence_length": "300", "median_sequence_length": "301", "percent_duplicates": "94.2", "percent_fails": "36" } } ], "DCFS2_R1": [ { "sample": "DCFS2_R1", "raw_data": { "total_sequences": 0.071285, "percent_gc": 51.0, "avg_sequence_length": 299.3111383881602, "median_sequence_length": 301, "percent_duplicates": 91.76124009258609, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "51.0", "avg_sequence_length": "299", "median_sequence_length": "301", "percent_duplicates": "91.8", "percent_fails": "36" } } ], "DCMS1_R1": [ { "sample": "DCMS1_R1", "raw_data": { "total_sequences": 0.24167899999999998, "percent_gc": 52.0, "avg_sequence_length": 300.75027826166115, "median_sequence_length": 301, "percent_duplicates": 95.2101754806996, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "52.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "95.2", "percent_fails": "36" } } ], "DCMS2_R1": [ { "sample": "DCMS2_R1", "raw_data": { "total_sequences": 0.094201, "percent_gc": 51.0, "avg_sequence_length": 299.26231144043055, "median_sequence_length": 301, "percent_duplicates": 92.01813144234137, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "51.0", "avg_sequence_length": "299", "median_sequence_length": "301", "percent_duplicates": "92.0", "percent_fails": "36" } } ], "DPFS1_R1": [ { "sample": "DPFS1_R1", "raw_data": { "total_sequences": 0.141958, "percent_gc": 52.0, "avg_sequence_length": 300.6953324222657, "median_sequence_length": 301, "percent_duplicates": 94.53711661195565, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "52.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "94.5", "percent_fails": "36" } } ], "DPFS2_R1": [ { "sample": "DPFS2_R1", "raw_data": { "total_sequences": 0.132107, "percent_gc": 51.0, "avg_sequence_length": 299.76268479338717, "median_sequence_length": 301, "percent_duplicates": 93.55219632570568, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "51.0", "avg_sequence_length": "300", "median_sequence_length": "301", "percent_duplicates": "93.6", "percent_fails": "36" } } ], "DPMS1_R1": [ { "sample": "DPMS1_R1", "raw_data": { "total_sequences": 0.08200299999999999, "percent_gc": 52.0, "avg_sequence_length": 300.5020548028731, "median_sequence_length": 301, "percent_duplicates": 91.64054973598527, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "52.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "91.6", "percent_fails": "36" } } ], "DPMS2_R1": [ { "sample": "DPMS2_R1", "raw_data": { "total_sequences": 0.08678999999999999, "percent_gc": 51.0, "avg_sequence_length": 300.60624495909667, "median_sequence_length": 301, "percent_duplicates": 91.30775434957944, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "51.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "91.3", "percent_fails": "36" } } ], "DVFS1_R1": [ { "sample": "DVFS1_R1", "raw_data": { "total_sequences": 0.07196, "percent_gc": 51.0, "avg_sequence_length": 300.7119302390217, "median_sequence_length": 301, "percent_duplicates": 91.57170650361311, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "51.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "91.6", "percent_fails": "36" } } ], "DVFS2_R1": [ { "sample": "DVFS2_R1", "raw_data": { "total_sequences": 0.10148399999999999, "percent_gc": 51.0, "avg_sequence_length": 300.13608056442393, "median_sequence_length": 301, "percent_duplicates": 92.38402112648299, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "51.0", "avg_sequence_length": "300", "median_sequence_length": "301", "percent_duplicates": "92.4", "percent_fails": "36" } } ], "DVMS1_R1": [ { "sample": "DVMS1_R1", "raw_data": { "total_sequences": 0.16585899999999998, "percent_gc": 52.0, "avg_sequence_length": 300.6154806190801, "median_sequence_length": 301, "percent_duplicates": 92.25305832062173, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "52.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "92.3", "percent_fails": "36" } } ], "DVMS2_R1": [ { "sample": "DVMS2_R1", "raw_data": { "total_sequences": 0.16105899999999998, "percent_gc": 52.0, "avg_sequence_length": 300.61822065205916, "median_sequence_length": 301, "percent_duplicates": 92.79270329506578, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "52.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "92.8", "percent_fails": "36" } } ], "IAFS1_R1": [ { "sample": "IAFS1_R1", "raw_data": { "total_sequences": 0.164482, "percent_gc": 54.0, "avg_sequence_length": 300.98650916209675, "median_sequence_length": 301, "percent_duplicates": 97.81860629126591, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "54.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "97.8", "percent_fails": "36" } } ], "IAFS2_R1": [ { "sample": "IAFS2_R1", "raw_data": { "total_sequences": 0.12778499999999998, "percent_gc": 54.0, "avg_sequence_length": 300.98274445357436, "median_sequence_length": 301, "percent_duplicates": 97.62100403020699, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "54.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "97.6", "percent_fails": "36" } } ], "IAMS1_R1": [ { "sample": "IAMS1_R1", "raw_data": { "total_sequences": 0.15173, "percent_gc": 54.0, "avg_sequence_length": 300.9770711131615, "median_sequence_length": 301, "percent_duplicates": 97.57068476899757, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "54.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "97.6", "percent_fails": "36" } } ], "IAMS2_R1": [ { "sample": "IAMS2_R1", "raw_data": { "total_sequences": 0.151673, "percent_gc": 54.0, "avg_sequence_length": 300.97739215285515, "median_sequence_length": 301, "percent_duplicates": 96.21356470828691, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "54.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "96.2", "percent_fails": "36" } } ], "ICFS1_R1": [ { "sample": "ICFS1_R1", "raw_data": { "total_sequences": 0.139909, "percent_gc": 52.0, "avg_sequence_length": 300.8100908447634, "median_sequence_length": 301, "percent_duplicates": 93.129820097349, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "52.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "93.1", "percent_fails": "36" } } ], "ICFS2_R1": [ { "sample": "ICFS2_R1", "raw_data": { "total_sequences": 0.172816, "percent_gc": 53.0, "avg_sequence_length": 300.8646797750208, "median_sequence_length": 301, "percent_duplicates": 92.59269975002314, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "53.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "92.6", "percent_fails": "36" } } ], "ICMS1_R1": [ { "sample": "ICMS1_R1", "raw_data": { "total_sequences": 0.194877, "percent_gc": 53.0, "avg_sequence_length": 300.9421917414574, "median_sequence_length": 301, "percent_duplicates": 95.9035699441186, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "53.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "95.9", "percent_fails": "36" } } ], "ICMS2_R1": [ { "sample": "ICMS2_R1", "raw_data": { "total_sequences": 0.125665, "percent_gc": 54.0, "avg_sequence_length": 300.95274738391754, "median_sequence_length": 301, "percent_duplicates": 95.04396610034615, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "54.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "95.0", "percent_fails": "36" } } ], "IPFS1_R1": [ { "sample": "IPFS1_R1", "raw_data": { "total_sequences": 0.160962, "percent_gc": 52.0, "avg_sequence_length": 300.9171978479393, "median_sequence_length": 301, "percent_duplicates": 95.75862625961408, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "52.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "95.8", "percent_fails": "36" } } ], "IPFS2_R1": [ { "sample": "IPFS2_R1", "raw_data": { "total_sequences": 0.224428, "percent_gc": 53.0, "avg_sequence_length": 300.9690279287789, "median_sequence_length": 301, "percent_duplicates": 93.79310959416829, "percent_fails": 27.27272727272727 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "53.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "93.8", "percent_fails": "27" } } ], "IPMS1_R1": [ { "sample": "IPMS1_R1", "raw_data": { "total_sequences": 0.345759, "percent_gc": 54.0, "avg_sequence_length": 300.95856073160786, "median_sequence_length": 301, "percent_duplicates": 96.4084810518309, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.3", "percent_gc": "54.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "96.4", "percent_fails": "36" } } ], "IPMS2_R1": [ { "sample": "IPMS2_R1", "raw_data": { "total_sequences": 0.244089, "percent_gc": 53.0, "avg_sequence_length": 300.95523354186383, "median_sequence_length": 301, "percent_duplicates": 95.10096727013507, "percent_fails": 27.27272727272727 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "53.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "95.1", "percent_fails": "27" } } ], "IVFS1_R1": [ { "sample": "IVFS1_R1", "raw_data": { "total_sequences": 0.22894299999999998, "percent_gc": 54.0, "avg_sequence_length": 300.9764570220535, "median_sequence_length": 301, "percent_duplicates": 96.65768335349847, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "54.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "96.7", "percent_fails": "36" } } ], "IVFS2_R1": [ { "sample": "IVFS2_R1", "raw_data": { "total_sequences": 0.12742, "percent_gc": 51.0, "avg_sequence_length": 300.85812666771307, "median_sequence_length": 301, "percent_duplicates": 96.26510751844295, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "51.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "96.3", "percent_fails": "36" } } ], "IVMS1_R1": [ { "sample": "IVMS1_R1", "raw_data": { "total_sequences": 0.15611899999999998, "percent_gc": 52.0, "avg_sequence_length": 300.84647928823523, "median_sequence_length": 301, "percent_duplicates": 94.1352429877209, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "52.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "94.1", "percent_fails": "36" } } ], "IVMS2_R1": [ { "sample": "IVMS2_R1", "raw_data": { "total_sequences": 0.109737, "percent_gc": 51.0, "avg_sequence_length": 300.9528053436854, "median_sequence_length": 301, "percent_duplicates": 95.14840026609075, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "51.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "95.1", "percent_fails": "36" } } ], "JAFS1_R1": [ { "sample": "JAFS1_R1", "raw_data": { "total_sequences": 0.13237, "percent_gc": 53.0, "avg_sequence_length": 300.9448402205938, "median_sequence_length": 301, "percent_duplicates": 96.21137720027197, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "53.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "96.2", "percent_fails": "36" } } ], "JAFS2_R1": [ { "sample": "JAFS2_R1", "raw_data": { "total_sequences": 0.084149, "percent_gc": 53.0, "avg_sequence_length": 300.9482346789623, "median_sequence_length": 301, "percent_duplicates": 95.54718416142795, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "53.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "95.5", "percent_fails": "36" } } ], "JAMS1_R1": [ { "sample": "JAMS1_R1", "raw_data": { "total_sequences": 0.163443, "percent_gc": 50.0, "avg_sequence_length": 300.96827028382984, "median_sequence_length": 301, "percent_duplicates": 97.99869067503656, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "50.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "98.0", "percent_fails": "36" } } ], "JAMS2_R1": [ { "sample": "JAMS2_R1", "raw_data": { "total_sequences": 0.147745, "percent_gc": 50.0, "avg_sequence_length": 300.94705066161293, "median_sequence_length": 301, "percent_duplicates": 96.84320958408068, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "50.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "96.8", "percent_fails": "36" } } ], "JCFS1_R1": [ { "sample": "JCFS1_R1", "raw_data": { "total_sequences": 0.188244, "percent_gc": 51.0, "avg_sequence_length": 300.91172892628714, "median_sequence_length": 301, "percent_duplicates": 97.08729096279298, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "51.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "97.1", "percent_fails": "36" } } ], "JCFS2_R1": [ { "sample": "JCFS2_R1", "raw_data": { "total_sequences": 0.152204, "percent_gc": 51.0, "avg_sequence_length": 300.9076601140574, "median_sequence_length": 301, "percent_duplicates": 96.70245197235289, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "51.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "96.7", "percent_fails": "36" } } ], "JCMS1_R1": [ { "sample": "JCMS1_R1", "raw_data": { "total_sequences": 0.161387, "percent_gc": 52.0, "avg_sequence_length": 300.9189711686815, "median_sequence_length": 301, "percent_duplicates": 95.55912186235571, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "52.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "95.6", "percent_fails": "36" } } ], "JCMS2_R1": [ { "sample": "JCMS2_R1", "raw_data": { "total_sequences": 0.12745199999999998, "percent_gc": 52.0, "avg_sequence_length": 300.8786602014876, "median_sequence_length": 301, "percent_duplicates": 94.02598625364843, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "52.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "94.0", "percent_fails": "36" } } ], "JPFS1_R1": [ { "sample": "JPFS1_R1", "raw_data": { "total_sequences": 0.233623, "percent_gc": 51.0, "avg_sequence_length": 300.9633726131417, "median_sequence_length": 301, "percent_duplicates": 97.49040120193645, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "51.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "97.5", "percent_fails": "36" } } ], "JPFS2_R1": [ { "sample": "JPFS2_R1", "raw_data": { "total_sequences": 0.20177199999999998, "percent_gc": 51.0, "avg_sequence_length": 300.9524017207541, "median_sequence_length": 301, "percent_duplicates": 96.96984715421367, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "51.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "97.0", "percent_fails": "36" } } ], "JPMS1_R1": [ { "sample": "JPMS1_R1", "raw_data": { "total_sequences": 0.211303, "percent_gc": 51.0, "avg_sequence_length": 300.9438105469397, "median_sequence_length": 301, "percent_duplicates": 95.1160182297459, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "51.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "95.1", "percent_fails": "36" } } ], "JPMS2_R1": [ { "sample": "JPMS2_R1", "raw_data": { "total_sequences": 0.134191, "percent_gc": 51.0, "avg_sequence_length": 300.91419320222667, "median_sequence_length": 301, "percent_duplicates": 94.45268311585725, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "51.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "94.5", "percent_fails": "36" } } ], "JVFS1_R1": [ { "sample": "JVFS1_R1", "raw_data": { "total_sequences": 0.10979499999999999, "percent_gc": 51.0, "avg_sequence_length": 300.854879548249, "median_sequence_length": 301, "percent_duplicates": 95.5890523247871, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "51.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "95.6", "percent_fails": "36" } } ], "JVFS2_R1": [ { "sample": "JVFS2_R1", "raw_data": { "total_sequences": 0.150055, "percent_gc": 54.0, "avg_sequence_length": 300.97411615740896, "median_sequence_length": 301, "percent_duplicates": 95.45566625570623, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "54.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "95.5", "percent_fails": "36" } } ], "JVMS1_R1": [ { "sample": "JVMS1_R1", "raw_data": { "total_sequences": 0.347311, "percent_gc": 52.0, "avg_sequence_length": 300.8928481965731, "median_sequence_length": 301, "percent_duplicates": 96.57108470506262, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.3", "percent_gc": "52.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "96.6", "percent_fails": "36" } } ], "JVMS2_R1": [ { "sample": "JVMS2_R1", "raw_data": { "total_sequences": 0.117324, "percent_gc": 52.0, "avg_sequence_length": 300.894054072483, "median_sequence_length": 301, "percent_duplicates": 94.15209164365348, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "52.0", "avg_sequence_length": "301", "median_sequence_length": "301", "percent_duplicates": "94.2", "percent_fails": "36" } } ] } } ], "headers_in_order": { "1000.0": [ [ 0, "percent_duplicates" ], [ 0, "percent_gc" ], [ 0, "avg_sequence_length" ], [ 0, "median_sequence_length" ], [ 0, "percent_fails" ], [ 0, "total_sequences" ] ] } } } }, "report_saved_raw_data": { "multiqc_fastqc": { "CAFS1_R1": { "Filename": "CAFS1_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 163941.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "38-301", "%GC": 54.0, "total_deduplicated_percentage": 4.379014401522499, "avg_sequence_length": 300.98912108624444, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "CAFS2_R1": { "Filename": "CAFS2_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 151444.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "225-301", "%GC": 53.0, "total_deduplicated_percentage": 4.618208710810596, "avg_sequence_length": 300.49757005889967, "median_sequence_length": 300, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "CAMS1_R1": { "Filename": "CAMS1_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 146978.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "100-301", "%GC": 53.0, "total_deduplicated_percentage": 4.6374287308304645, "avg_sequence_length": 300.9908353631156, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "CAMS2_R1": { "Filename": "CAMS2_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 167274.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "69-301", "%GC": 53.0, "total_deduplicated_percentage": 4.277413106639406, "avg_sequence_length": 300.98940062412566, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "CCFS1_R1": { "Filename": "CCFS1_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 216687.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "41-301", "%GC": 53.0, "total_deduplicated_percentage": 6.112503288152958, "avg_sequence_length": 300.96590935312224, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "CCFS2_R1": { "Filename": "CCFS2_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 202999.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "42-301", "%GC": 53.0, "total_deduplicated_percentage": 6.568012650308622, "avg_sequence_length": 300.92754644111545, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "CCMS1_R1": { "Filename": "CCMS1_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 209990.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "99-301", "%GC": 53.0, "total_deduplicated_percentage": 6.2602981094337835, "avg_sequence_length": 300.9813800657174, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "CCMS2_R1": { "Filename": "CCMS2_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 196923.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "51-301", "%GC": 53.0, "total_deduplicated_percentage": 6.31820559304906, "avg_sequence_length": 300.973304286447, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "CPFS1_R1": { "Filename": "CPFS1_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 149702.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "37-301", "%GC": 53.0, "total_deduplicated_percentage": 5.167599631267452, "avg_sequence_length": 300.8958597747525, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "CPFS2_R1": { "Filename": "CPFS2_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 179192.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "35-301", "%GC": 53.0, "total_deduplicated_percentage": 6.879771418366891, "avg_sequence_length": 300.9559969195053, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "warn", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "CPMS1_R1": { "Filename": "CPMS1_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 225944.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "51-301", "%GC": 53.0, "total_deduplicated_percentage": 6.314839075169068, "avg_sequence_length": 300.95744078178666, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "CPMS2_R1": { "Filename": "CPMS2_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 204777.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "37-301", "%GC": 53.0, "total_deduplicated_percentage": 6.255097007964762, "avg_sequence_length": 300.96786016007655, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "CVFS1_R1": { "Filename": "CVFS1_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 219402.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "35-301", "%GC": 53.0, "total_deduplicated_percentage": 6.27706219633367, "avg_sequence_length": 300.95555874604605, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "CVFS2_R1": { "Filename": "CVFS2_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 206738.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "42-301", "%GC": 53.0, "total_deduplicated_percentage": 6.242200272809063, "avg_sequence_length": 300.97790681925915, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "CVMS1_R1": { "Filename": "CVMS1_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 183364.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "36-301", "%GC": 52.0, "total_deduplicated_percentage": 6.021901790973146, "avg_sequence_length": 300.9705258393142, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "CVMS2_R1": { "Filename": "CVMS2_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 228355.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "51-301", "%GC": 52.0, "total_deduplicated_percentage": 5.9477567822031485, "avg_sequence_length": 300.9735849882858, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "DAFS1_R1": { "Filename": "DAFS1_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 89919.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "76-301", "%GC": 54.0, "total_deduplicated_percentage": 5.631735228372202, "avg_sequence_length": 300.86233165404417, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "DAFS2_R1": { "Filename": "DAFS2_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 37520.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "37-301", "%GC": 53.0, "total_deduplicated_percentage": 8.69136460554371, "avg_sequence_length": 300.6738272921109, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "DAMS1_R1": { "Filename": "DAMS1_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 63626.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "76-301", "%GC": 50.0, "total_deduplicated_percentage": 4.930374375255399, "avg_sequence_length": 300.83824222801996, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "DAMS2_R1": { "Filename": "DAMS2_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 80819.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "44-301", "%GC": 50.0, "total_deduplicated_percentage": 3.643945111916752, "avg_sequence_length": 300.818681250696, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "DCFS1_R1": { "Filename": "DCFS1_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 122736.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "35-301", "%GC": 51.0, "total_deduplicated_percentage": 5.824696910441924, "avg_sequence_length": 300.4278003193847, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "DCFS2_R1": { "Filename": "DCFS2_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 71285.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "42-301", "%GC": 51.0, "total_deduplicated_percentage": 8.238759907413902, "avg_sequence_length": 299.3111383881602, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "DCMS1_R1": { "Filename": "DCMS1_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 241679.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "37-301", "%GC": 52.0, "total_deduplicated_percentage": 4.789824519300394, "avg_sequence_length": 300.75027826166115, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "DCMS2_R1": { "Filename": "DCMS2_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 94201.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "37-301", "%GC": 51.0, "total_deduplicated_percentage": 7.981868557658624, "avg_sequence_length": 299.26231144043055, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "DPFS1_R1": { "Filename": "DPFS1_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 141958.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "41-301", "%GC": 52.0, "total_deduplicated_percentage": 5.462883388044351, "avg_sequence_length": 300.6953324222657, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "DPFS2_R1": { "Filename": "DPFS2_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 132107.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "38-301", "%GC": 51.0, "total_deduplicated_percentage": 6.447803674294322, "avg_sequence_length": 299.76268479338717, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "DPMS1_R1": { "Filename": "DPMS1_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 82003.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "37-301", "%GC": 52.0, "total_deduplicated_percentage": 8.35945026401473, "avg_sequence_length": 300.5020548028731, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "DPMS2_R1": { "Filename": "DPMS2_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 86790.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "42-301", "%GC": 51.0, "total_deduplicated_percentage": 8.692245650420555, "avg_sequence_length": 300.60624495909667, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "DVFS1_R1": { "Filename": "DVFS1_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 71960.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "42-301", "%GC": 51.0, "total_deduplicated_percentage": 8.428293496386882, "avg_sequence_length": 300.7119302390217, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "DVFS2_R1": { "Filename": "DVFS2_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 101484.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "37-301", "%GC": 51.0, "total_deduplicated_percentage": 7.615978873517007, "avg_sequence_length": 300.13608056442393, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "DVMS1_R1": { "Filename": "DVMS1_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 165859.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "38-301", "%GC": 52.0, "total_deduplicated_percentage": 7.746941679378268, "avg_sequence_length": 300.6154806190801, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "DVMS2_R1": { "Filename": "DVMS2_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 161059.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "35-301", "%GC": 52.0, "total_deduplicated_percentage": 7.207296704934217, "avg_sequence_length": 300.61822065205916, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "IAFS1_R1": { "Filename": "IAFS1_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 164482.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "51-301", "%GC": 54.0, "total_deduplicated_percentage": 2.1813937087340864, "avg_sequence_length": 300.98650916209675, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "IAFS2_R1": { "Filename": "IAFS2_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 127785.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "51-301", "%GC": 54.0, "total_deduplicated_percentage": 2.3789959697930114, "avg_sequence_length": 300.98274445357436, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "IAMS1_R1": { "Filename": "IAMS1_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 151730.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "51-301", "%GC": 54.0, "total_deduplicated_percentage": 2.429315231002439, "avg_sequence_length": 300.9770711131615, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "IAMS2_R1": { "Filename": "IAMS2_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 151673.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "51-301", "%GC": 54.0, "total_deduplicated_percentage": 3.7864352917130932, "avg_sequence_length": 300.97739215285515, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "ICFS1_R1": { "Filename": "ICFS1_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 139909.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "37-301", "%GC": 52.0, "total_deduplicated_percentage": 6.870179902651009, "avg_sequence_length": 300.8100908447634, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "ICFS2_R1": { "Filename": "ICFS2_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 172816.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "37-301", "%GC": 53.0, "total_deduplicated_percentage": 7.4073002499768545, "avg_sequence_length": 300.8646797750208, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "ICMS1_R1": { "Filename": "ICMS1_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 194877.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "35-301", "%GC": 53.0, "total_deduplicated_percentage": 4.0964300558814015, "avg_sequence_length": 300.9421917414574, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "ICMS2_R1": { "Filename": "ICMS2_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 125665.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "35-301", "%GC": 54.0, "total_deduplicated_percentage": 4.956033899653842, "avg_sequence_length": 300.95274738391754, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "IPFS1_R1": { "Filename": "IPFS1_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 160962.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "42-301", "%GC": 52.0, "total_deduplicated_percentage": 4.24137374038593, "avg_sequence_length": 300.9171978479393, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "IPFS2_R1": { "Filename": "IPFS2_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 224428.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "42-301", "%GC": 53.0, "total_deduplicated_percentage": 6.2068904058317145, "avg_sequence_length": 300.9690279287789, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "warn", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "IPMS1_R1": { "Filename": "IPMS1_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 345759.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "40-301", "%GC": 54.0, "total_deduplicated_percentage": 3.5915189481691008, "avg_sequence_length": 300.95856073160786, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "IPMS2_R1": { "Filename": "IPMS2_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 244089.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "35-301", "%GC": 53.0, "total_deduplicated_percentage": 4.899032729864927, "avg_sequence_length": 300.95523354186383, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "warn", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "IVFS1_R1": { "Filename": "IVFS1_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 228943.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "51-301", "%GC": 54.0, "total_deduplicated_percentage": 3.342316646501531, "avg_sequence_length": 300.9764570220535, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "IVFS2_R1": { "Filename": "IVFS2_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 127420.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "41-301", "%GC": 51.0, "total_deduplicated_percentage": 3.7348924815570554, "avg_sequence_length": 300.85812666771307, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "IVMS1_R1": { "Filename": "IVMS1_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 156119.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "37-301", "%GC": 52.0, "total_deduplicated_percentage": 5.864757012279095, "avg_sequence_length": 300.84647928823523, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "IVMS2_R1": { "Filename": "IVMS2_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 109737.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "82-301", "%GC": 51.0, "total_deduplicated_percentage": 4.851599733909255, "avg_sequence_length": 300.9528053436854, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "JAFS1_R1": { "Filename": "JAFS1_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 132370.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "38-301", "%GC": 53.0, "total_deduplicated_percentage": 3.788622799728035, "avg_sequence_length": 300.9448402205938, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "JAFS2_R1": { "Filename": "JAFS2_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 84149.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "76-301", "%GC": 53.0, "total_deduplicated_percentage": 4.452815838572056, "avg_sequence_length": 300.9482346789623, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "JAMS1_R1": { "Filename": "JAMS1_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 163443.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "86-301", "%GC": 50.0, "total_deduplicated_percentage": 2.001309324963443, "avg_sequence_length": 300.96827028382984, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "JAMS2_R1": { "Filename": "JAMS2_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 147745.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "80-301", "%GC": 50.0, "total_deduplicated_percentage": 3.1567904159193203, "avg_sequence_length": 300.94705066161293, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "JCFS1_R1": { "Filename": "JCFS1_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 188244.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "41-301", "%GC": 51.0, "total_deduplicated_percentage": 2.9127090372070294, "avg_sequence_length": 300.91172892628714, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "JCFS2_R1": { "Filename": "JCFS2_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 152204.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "38-301", "%GC": 51.0, "total_deduplicated_percentage": 3.297548027647105, "avg_sequence_length": 300.9076601140574, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "JCMS1_R1": { "Filename": "JCMS1_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 161387.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "35-301", "%GC": 52.0, "total_deduplicated_percentage": 4.4408781376442965, "avg_sequence_length": 300.9189711686815, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "JCMS2_R1": { "Filename": "JCMS2_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 127452.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "39-301", "%GC": 52.0, "total_deduplicated_percentage": 5.9740137463515675, "avg_sequence_length": 300.8786602014876, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "JPFS1_R1": { "Filename": "JPFS1_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 233623.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "111-301", "%GC": 51.0, "total_deduplicated_percentage": 2.509598798063547, "avg_sequence_length": 300.9633726131417, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "JPFS2_R1": { "Filename": "JPFS2_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 201772.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "72-301", "%GC": 51.0, "total_deduplicated_percentage": 3.030152845786333, "avg_sequence_length": 300.9524017207541, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "JPMS1_R1": { "Filename": "JPMS1_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 211303.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "71-301", "%GC": 51.0, "total_deduplicated_percentage": 4.88398177025409, "avg_sequence_length": 300.9438105469397, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "JPMS2_R1": { "Filename": "JPMS2_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 134191.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "41-301", "%GC": 51.0, "total_deduplicated_percentage": 5.547316884142751, "avg_sequence_length": 300.91419320222667, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "JVFS1_R1": { "Filename": "JVFS1_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 109795.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "37-301", "%GC": 51.0, "total_deduplicated_percentage": 4.410947675212896, "avg_sequence_length": 300.854879548249, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "JVFS2_R1": { "Filename": "JVFS2_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 150055.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "82-301", "%GC": 54.0, "total_deduplicated_percentage": 4.544333744293759, "avg_sequence_length": 300.97411615740896, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "JVMS1_R1": { "Filename": "JVMS1_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 347311.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "37-301", "%GC": 52.0, "total_deduplicated_percentage": 3.42891529493739, "avg_sequence_length": 300.8928481965731, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "JVMS2_R1": { "Filename": "JVMS2_R1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 117324.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "37-301", "%GC": 52.0, "total_deduplicated_percentage": 5.847908356346528, "avg_sequence_length": 300.894054072483, "median_sequence_length": 301, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "warn", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" } }, "multiqc_general_stats": { "CAFS1_R1": { "fastqc-percent_duplicates": 95.6209855984775, "fastqc-percent_gc": 54.0, "fastqc-avg_sequence_length": 300.98912108624444, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.163941 }, "CAFS2_R1": { "fastqc-percent_duplicates": 95.38179128918941, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 300.49757005889967, "fastqc-median_sequence_length": 300, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.151444 }, "CAMS1_R1": { "fastqc-percent_duplicates": 95.36257126916954, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 300.9908353631156, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.146978 }, "CAMS2_R1": { "fastqc-percent_duplicates": 95.7225868933606, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 300.98940062412566, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.167274 }, "CCFS1_R1": { "fastqc-percent_duplicates": 93.88749671184704, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 300.96590935312224, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.216687 }, "CCFS2_R1": { "fastqc-percent_duplicates": 93.43198734969138, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 300.92754644111545, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.20299899999999999 }, "CCMS1_R1": { "fastqc-percent_duplicates": 93.73970189056621, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 300.9813800657174, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.20998999999999998 }, "CCMS2_R1": { "fastqc-percent_duplicates": 93.68179440695094, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 300.973304286447, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.196923 }, "CPFS1_R1": { "fastqc-percent_duplicates": 94.83240036873255, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 300.8958597747525, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.149702 }, "CPFS2_R1": { "fastqc-percent_duplicates": 93.12022858163311, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 300.9559969195053, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 27.27272727272727, "fastqc-total_sequences": 0.179192 }, "CPMS1_R1": { "fastqc-percent_duplicates": 93.68516092483094, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 300.95744078178666, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.22594399999999998 }, "CPMS2_R1": { "fastqc-percent_duplicates": 93.74490299203524, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 300.96786016007655, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.204777 }, "CVFS1_R1": { "fastqc-percent_duplicates": 93.72293780366633, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 300.95555874604605, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.21940199999999999 }, "CVFS2_R1": { "fastqc-percent_duplicates": 93.75779972719094, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 300.97790681925915, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.20673799999999998 }, "CVMS1_R1": { "fastqc-percent_duplicates": 93.97809820902685, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 300.9705258393142, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.183364 }, "CVMS2_R1": { "fastqc-percent_duplicates": 94.05224321779686, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 300.9735849882858, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.228355 }, "DAFS1_R1": { "fastqc-percent_duplicates": 94.36826477162779, "fastqc-percent_gc": 54.0, "fastqc-avg_sequence_length": 300.86233165404417, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.089919 }, "DAFS2_R1": { "fastqc-percent_duplicates": 91.30863539445629, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 300.6738272921109, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.03752 }, "DAMS1_R1": { "fastqc-percent_duplicates": 95.0696256247446, "fastqc-percent_gc": 50.0, "fastqc-avg_sequence_length": 300.83824222801996, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.063626 }, "DAMS2_R1": { "fastqc-percent_duplicates": 96.35605488808325, "fastqc-percent_gc": 50.0, "fastqc-avg_sequence_length": 300.818681250696, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.080819 }, "DCFS1_R1": { "fastqc-percent_duplicates": 94.17530308955807, "fastqc-percent_gc": 51.0, "fastqc-avg_sequence_length": 300.4278003193847, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.122736 }, "DCFS2_R1": { "fastqc-percent_duplicates": 91.76124009258609, "fastqc-percent_gc": 51.0, "fastqc-avg_sequence_length": 299.3111383881602, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.071285 }, "DCMS1_R1": { "fastqc-percent_duplicates": 95.2101754806996, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 300.75027826166115, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.24167899999999998 }, "DCMS2_R1": { "fastqc-percent_duplicates": 92.01813144234137, "fastqc-percent_gc": 51.0, "fastqc-avg_sequence_length": 299.26231144043055, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.094201 }, "DPFS1_R1": { "fastqc-percent_duplicates": 94.53711661195565, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 300.6953324222657, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.141958 }, "DPFS2_R1": { "fastqc-percent_duplicates": 93.55219632570568, "fastqc-percent_gc": 51.0, "fastqc-avg_sequence_length": 299.76268479338717, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.132107 }, "DPMS1_R1": { "fastqc-percent_duplicates": 91.64054973598527, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 300.5020548028731, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.08200299999999999 }, "DPMS2_R1": { "fastqc-percent_duplicates": 91.30775434957944, "fastqc-percent_gc": 51.0, "fastqc-avg_sequence_length": 300.60624495909667, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.08678999999999999 }, "DVFS1_R1": { "fastqc-percent_duplicates": 91.57170650361311, "fastqc-percent_gc": 51.0, "fastqc-avg_sequence_length": 300.7119302390217, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.07196 }, "DVFS2_R1": { "fastqc-percent_duplicates": 92.38402112648299, "fastqc-percent_gc": 51.0, "fastqc-avg_sequence_length": 300.13608056442393, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.10148399999999999 }, "DVMS1_R1": { "fastqc-percent_duplicates": 92.25305832062173, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 300.6154806190801, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.16585899999999998 }, "DVMS2_R1": { "fastqc-percent_duplicates": 92.79270329506578, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 300.61822065205916, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.16105899999999998 }, "IAFS1_R1": { "fastqc-percent_duplicates": 97.81860629126591, "fastqc-percent_gc": 54.0, "fastqc-avg_sequence_length": 300.98650916209675, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.164482 }, "IAFS2_R1": { "fastqc-percent_duplicates": 97.62100403020699, "fastqc-percent_gc": 54.0, "fastqc-avg_sequence_length": 300.98274445357436, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.12778499999999998 }, "IAMS1_R1": { "fastqc-percent_duplicates": 97.57068476899757, "fastqc-percent_gc": 54.0, "fastqc-avg_sequence_length": 300.9770711131615, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.15173 }, "IAMS2_R1": { "fastqc-percent_duplicates": 96.21356470828691, "fastqc-percent_gc": 54.0, "fastqc-avg_sequence_length": 300.97739215285515, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.151673 }, "ICFS1_R1": { "fastqc-percent_duplicates": 93.129820097349, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 300.8100908447634, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.139909 }, "ICFS2_R1": { "fastqc-percent_duplicates": 92.59269975002314, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 300.8646797750208, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.172816 }, "ICMS1_R1": { "fastqc-percent_duplicates": 95.9035699441186, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 300.9421917414574, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.194877 }, "ICMS2_R1": { "fastqc-percent_duplicates": 95.04396610034615, "fastqc-percent_gc": 54.0, "fastqc-avg_sequence_length": 300.95274738391754, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.125665 }, "IPFS1_R1": { "fastqc-percent_duplicates": 95.75862625961408, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 300.9171978479393, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.160962 }, "IPFS2_R1": { "fastqc-percent_duplicates": 93.79310959416829, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 300.9690279287789, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 27.27272727272727, "fastqc-total_sequences": 0.224428 }, "IPMS1_R1": { "fastqc-percent_duplicates": 96.4084810518309, "fastqc-percent_gc": 54.0, "fastqc-avg_sequence_length": 300.95856073160786, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.345759 }, "IPMS2_R1": { "fastqc-percent_duplicates": 95.10096727013507, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 300.95523354186383, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 27.27272727272727, "fastqc-total_sequences": 0.244089 }, "IVFS1_R1": { "fastqc-percent_duplicates": 96.65768335349847, "fastqc-percent_gc": 54.0, "fastqc-avg_sequence_length": 300.9764570220535, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.22894299999999998 }, "IVFS2_R1": { "fastqc-percent_duplicates": 96.26510751844295, "fastqc-percent_gc": 51.0, "fastqc-avg_sequence_length": 300.85812666771307, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.12742 }, "IVMS1_R1": { "fastqc-percent_duplicates": 94.1352429877209, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 300.84647928823523, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.15611899999999998 }, "IVMS2_R1": { "fastqc-percent_duplicates": 95.14840026609075, "fastqc-percent_gc": 51.0, "fastqc-avg_sequence_length": 300.9528053436854, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.109737 }, "JAFS1_R1": { "fastqc-percent_duplicates": 96.21137720027197, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 300.9448402205938, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.13237 }, "JAFS2_R1": { "fastqc-percent_duplicates": 95.54718416142795, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 300.9482346789623, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.084149 }, "JAMS1_R1": { "fastqc-percent_duplicates": 97.99869067503656, "fastqc-percent_gc": 50.0, "fastqc-avg_sequence_length": 300.96827028382984, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.163443 }, "JAMS2_R1": { "fastqc-percent_duplicates": 96.84320958408068, "fastqc-percent_gc": 50.0, "fastqc-avg_sequence_length": 300.94705066161293, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.147745 }, "JCFS1_R1": { "fastqc-percent_duplicates": 97.08729096279298, "fastqc-percent_gc": 51.0, "fastqc-avg_sequence_length": 300.91172892628714, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.188244 }, "JCFS2_R1": { "fastqc-percent_duplicates": 96.70245197235289, "fastqc-percent_gc": 51.0, "fastqc-avg_sequence_length": 300.9076601140574, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.152204 }, "JCMS1_R1": { "fastqc-percent_duplicates": 95.55912186235571, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 300.9189711686815, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.161387 }, "JCMS2_R1": { "fastqc-percent_duplicates": 94.02598625364843, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 300.8786602014876, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.12745199999999998 }, "JPFS1_R1": { "fastqc-percent_duplicates": 97.49040120193645, "fastqc-percent_gc": 51.0, "fastqc-avg_sequence_length": 300.9633726131417, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.233623 }, "JPFS2_R1": { "fastqc-percent_duplicates": 96.96984715421367, "fastqc-percent_gc": 51.0, "fastqc-avg_sequence_length": 300.9524017207541, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.20177199999999998 }, "JPMS1_R1": { "fastqc-percent_duplicates": 95.1160182297459, "fastqc-percent_gc": 51.0, "fastqc-avg_sequence_length": 300.9438105469397, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.211303 }, "JPMS2_R1": { "fastqc-percent_duplicates": 94.45268311585725, "fastqc-percent_gc": 51.0, "fastqc-avg_sequence_length": 300.91419320222667, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.134191 }, "JVFS1_R1": { "fastqc-percent_duplicates": 95.5890523247871, "fastqc-percent_gc": 51.0, "fastqc-avg_sequence_length": 300.854879548249, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.10979499999999999 }, "JVFS2_R1": { "fastqc-percent_duplicates": 95.45566625570623, "fastqc-percent_gc": 54.0, "fastqc-avg_sequence_length": 300.97411615740896, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.150055 }, "JVMS1_R1": { "fastqc-percent_duplicates": 96.57108470506262, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 300.8928481965731, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.347311 }, "JVMS2_R1": { "fastqc-percent_duplicates": 94.15209164365348, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 300.894054072483, "fastqc-median_sequence_length": 301, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.117324 } } }, "config_analysis_dir_abs": [ "/data/MicrobiomaFrangos/output/fastqc/pre/R1.txt" ], "config_analysis_dir": [ "/data/MicrobiomaFrangos/output/fastqc/pre/R1.txt" ], "config_creation_date": "2024-11-01, 18:47 -03", "config_git_hash": null, "config_intro_text": null, "config_report_comment": null, "config_report_header_info": null, "config_script_path": "/usr/local/bioinfo/anaconda3/lib/python3.9/site-packages/multiqc", "config_short_version": "1.25.1", "config_subtitle": null, "config_title": "Pre-processing reads (R1)", "config_version": "1.25.1", "config_output_dir": "/srv/data/MicrobiomaFrangos/output/fastqc/pre" }