{ "report_data_sources": { "FastQC": { "all_sections": { "CVFS2": "/data/MicrobiomaFrangos/output/fastqc/pos/CVFS2_fastqc.zip", "JPFS1": "/data/MicrobiomaFrangos/output/fastqc/pos/JPFS1_fastqc.zip", "CCMS1": "/data/MicrobiomaFrangos/output/fastqc/pos/CCMS1_fastqc.zip", "ICFS1": "/data/MicrobiomaFrangos/output/fastqc/pos/ICFS1_fastqc.zip", "CCFS2": "/data/MicrobiomaFrangos/output/fastqc/pos/CCFS2_fastqc.zip", "IAFS2": "/data/MicrobiomaFrangos/output/fastqc/pos/IAFS2_fastqc.zip", "DVMS1": "/data/MicrobiomaFrangos/output/fastqc/pos/DVMS1_fastqc.zip", "DVMS2": "/data/MicrobiomaFrangos/output/fastqc/pos/DVMS2_fastqc.zip", "DCMS2": "/data/MicrobiomaFrangos/output/fastqc/pos/DCMS2_fastqc.zip", "JCMS1": "/data/MicrobiomaFrangos/output/fastqc/pos/JCMS1_fastqc.zip", "JCFS1": "/data/MicrobiomaFrangos/output/fastqc/pos/JCFS1_fastqc.zip", "DPMS1": "/data/MicrobiomaFrangos/output/fastqc/pos/DPMS1_fastqc.zip", "CAFS2": "/data/MicrobiomaFrangos/output/fastqc/pos/CAFS2_fastqc.zip", "DAMS1": "/data/MicrobiomaFrangos/output/fastqc/pos/DAMS1_fastqc.zip", "JAMS2": "/data/MicrobiomaFrangos/output/fastqc/pos/JAMS2_fastqc.zip", "IPMS1": "/data/MicrobiomaFrangos/output/fastqc/pos/IPMS1_fastqc.zip", "DCMS1": "/data/MicrobiomaFrangos/output/fastqc/pos/DCMS1_fastqc.zip", "CAFS1": "/data/MicrobiomaFrangos/output/fastqc/pos/CAFS1_fastqc.zip", "IPFS1": "/data/MicrobiomaFrangos/output/fastqc/pos/IPFS1_fastqc.zip", "JVFS1": "/data/MicrobiomaFrangos/output/fastqc/pos/JVFS1_fastqc.zip", "IVFS2": "/data/MicrobiomaFrangos/output/fastqc/pos/IVFS2_fastqc.zip", "DVFS1": "/data/MicrobiomaFrangos/output/fastqc/pos/DVFS1_fastqc.zip", "DPFS2": "/data/MicrobiomaFrangos/output/fastqc/pos/DPFS2_fastqc.zip", "CVMS1": "/data/MicrobiomaFrangos/output/fastqc/pos/CVMS1_fastqc.zip", "JVFS2": "/data/MicrobiomaFrangos/output/fastqc/pos/JVFS2_fastqc.zip", "CPMS1": "/data/MicrobiomaFrangos/output/fastqc/pos/CPMS1_fastqc.zip", "ICMS1": "/data/MicrobiomaFrangos/output/fastqc/pos/ICMS1_fastqc.zip", "CVMS2": "/data/MicrobiomaFrangos/output/fastqc/pos/CVMS2_fastqc.zip", "ICMS2": "/data/MicrobiomaFrangos/output/fastqc/pos/ICMS2_fastqc.zip", "DCFS2": "/data/MicrobiomaFrangos/output/fastqc/pos/DCFS2_fastqc.zip", "CCFS1": "/data/MicrobiomaFrangos/output/fastqc/pos/CCFS1_fastqc.zip", "CCMS2": "/data/MicrobiomaFrangos/output/fastqc/pos/CCMS2_fastqc.zip", "JVMS1": "/data/MicrobiomaFrangos/output/fastqc/pos/JVMS1_fastqc.zip", "CPFS2": "/data/MicrobiomaFrangos/output/fastqc/pos/CPFS2_fastqc.zip", "IAFS1": "/data/MicrobiomaFrangos/output/fastqc/pos/IAFS1_fastqc.zip", "CAMS1": "/data/MicrobiomaFrangos/output/fastqc/pos/CAMS1_fastqc.zip", "JPMS2": "/data/MicrobiomaFrangos/output/fastqc/pos/JPMS2_fastqc.zip", "IAMS1": "/data/MicrobiomaFrangos/output/fastqc/pos/IAMS1_fastqc.zip", "DAFS1": "/data/MicrobiomaFrangos/output/fastqc/pos/DAFS1_fastqc.zip", "DAFS2": "/data/MicrobiomaFrangos/output/fastqc/pos/DAFS2_fastqc.zip", "IAMS2": "/data/MicrobiomaFrangos/output/fastqc/pos/IAMS2_fastqc.zip", "JVMS2": "/data/MicrobiomaFrangos/output/fastqc/pos/JVMS2_fastqc.zip", "ICFS2": "/data/MicrobiomaFrangos/output/fastqc/pos/ICFS2_fastqc.zip", "IPMS2": "/data/MicrobiomaFrangos/output/fastqc/pos/IPMS2_fastqc.zip", "DPFS1": "/data/MicrobiomaFrangos/output/fastqc/pos/DPFS1_fastqc.zip", "DCFS1": "/data/MicrobiomaFrangos/output/fastqc/pos/DCFS1_fastqc.zip", "JCMS2": "/data/MicrobiomaFrangos/output/fastqc/pos/JCMS2_fastqc.zip", "JPMS1": "/data/MicrobiomaFrangos/output/fastqc/pos/JPMS1_fastqc.zip", "JAFS1": "/data/MicrobiomaFrangos/output/fastqc/pos/JAFS1_fastqc.zip", "JCFS2": "/data/MicrobiomaFrangos/output/fastqc/pos/JCFS2_fastqc.zip", "DPMS2": "/data/MicrobiomaFrangos/output/fastqc/pos/DPMS2_fastqc.zip", "CAMS2": "/data/MicrobiomaFrangos/output/fastqc/pos/CAMS2_fastqc.zip", "DAMS2": "/data/MicrobiomaFrangos/output/fastqc/pos/DAMS2_fastqc.zip", "IVMS1": "/data/MicrobiomaFrangos/output/fastqc/pos/IVMS1_fastqc.zip", "CPMS2": "/data/MicrobiomaFrangos/output/fastqc/pos/CPMS2_fastqc.zip", "CPFS1": "/data/MicrobiomaFrangos/output/fastqc/pos/CPFS1_fastqc.zip", "IVFS1": "/data/MicrobiomaFrangos/output/fastqc/pos/IVFS1_fastqc.zip", "CVFS1": "/data/MicrobiomaFrangos/output/fastqc/pos/CVFS1_fastqc.zip", "IVMS2": "/data/MicrobiomaFrangos/output/fastqc/pos/IVMS2_fastqc.zip", "IPFS2": "/data/MicrobiomaFrangos/output/fastqc/pos/IPFS2_fastqc.zip", "JAFS2": "/data/MicrobiomaFrangos/output/fastqc/pos/JAFS2_fastqc.zip", "JAMS1": "/data/MicrobiomaFrangos/output/fastqc/pos/JAMS1_fastqc.zip", "DVFS2": "/data/MicrobiomaFrangos/output/fastqc/pos/DVFS2_fastqc.zip", "JPFS2": "/data/MicrobiomaFrangos/output/fastqc/pos/JPFS2_fastqc.zip" } } }, "report_general_stats_data": [ { "CVFS2": { "total_sequences": 200734.0, "percent_gc": 53.0, "avg_sequence_length": 443.6777127940459, "median_sequence_length": 442, "percent_duplicates": 94.45933424332699, "percent_fails": 36.36363636363637 }, "JPFS1": { "total_sequences": 226267.0, "percent_gc": 51.0, "avg_sequence_length": 466.69301091188726, "median_sequence_length": 467, "percent_duplicates": 97.96479380554831, "percent_fails": 45.45454545454545 }, "CCMS1": { "total_sequences": 203959.0, "percent_gc": 53.0, "avg_sequence_length": 443.09737496261505, "median_sequence_length": 442, "percent_duplicates": 94.4140734167161, "percent_fails": 36.36363636363637 }, "ICFS1": { "total_sequences": 134460.0, "percent_gc": 52.0, "avg_sequence_length": 456.80890227576975, "median_sequence_length": 467, "percent_duplicates": 93.99003421091774, "percent_fails": 45.45454545454545 }, "CCFS2": { "total_sequences": 196811.0, "percent_gc": 53.0, "avg_sequence_length": 443.7233716611368, "median_sequence_length": 442, "percent_duplicates": 94.11719873381061, "percent_fails": 45.45454545454545 }, "IAFS2": { "total_sequences": 124952.0, "percent_gc": 54.0, "avg_sequence_length": 464.7821323388181, "median_sequence_length": 467, "percent_duplicates": 97.94080927075997, "percent_fails": 36.36363636363637 }, "DVMS1": { "total_sequences": 157745.0, "percent_gc": 52.0, "avg_sequence_length": 450.1387999619639, "median_sequence_length": 442, "percent_duplicates": 93.29297283590606, "percent_fails": 45.45454545454545 }, "DVMS2": { "total_sequences": 153626.0, "percent_gc": 52.0, "avg_sequence_length": 455.1479274341583, "median_sequence_length": 462, "percent_duplicates": 93.72567143582467, "percent_fails": 45.45454545454545 }, "DCMS2": { "total_sequences": 86114.0, "percent_gc": 52.0, "avg_sequence_length": 463.30315628120866, "median_sequence_length": 467, "percent_duplicates": 93.62473000905776, "percent_fails": 45.45454545454545 }, "JCMS1": { "total_sequences": 155791.0, "percent_gc": 51.0, "avg_sequence_length": 463.42276190537325, "median_sequence_length": 467, "percent_duplicates": 96.14740260990686, "percent_fails": 45.45454545454545 }, "JCFS1": { "total_sequences": 181666.0, "percent_gc": 51.0, "avg_sequence_length": 466.4255336716832, "median_sequence_length": 467, "percent_duplicates": 97.59833981042132, "percent_fails": 45.45454545454545 }, "DPMS1": { "total_sequences": 79297.0, "percent_gc": 52.0, "avg_sequence_length": 456.0338726559643, "median_sequence_length": 467, "percent_duplicates": 93.10692712208532, "percent_fails": 45.45454545454545 }, "CAFS2": { "total_sequences": 148309.0, "percent_gc": 53.0, "avg_sequence_length": 445.95572756879216, "median_sequence_length": 442, "percent_duplicates": 95.8633663499855, "percent_fails": 36.36363636363637 }, "DAMS1": { "total_sequences": 61535.0, "percent_gc": 51.0, "avg_sequence_length": 463.6502559518973, "median_sequence_length": 467, "percent_duplicates": 95.57812626960266, "percent_fails": 36.36363636363637 }, "JAMS2": { "total_sequences": 143943.0, "percent_gc": 50.0, "avg_sequence_length": 466.340468101957, "median_sequence_length": 467, "percent_duplicates": 97.25863709940741, "percent_fails": 45.45454545454545 }, "IPMS1": { "total_sequences": 334078.0, "percent_gc": 53.0, "avg_sequence_length": 439.6916618274774, "median_sequence_length": 437, "percent_duplicates": 96.89802980142362, "percent_fails": 36.36363636363637 }, "DCMS1": { "total_sequences": 231687.0, "percent_gc": 52.0, "avg_sequence_length": 463.4131565430948, "median_sequence_length": 467, "percent_duplicates": 95.98035280356689, "percent_fails": 45.45454545454545 }, "CAFS1": { "total_sequences": 160369.0, "percent_gc": 53.0, "avg_sequence_length": 445.7737561498793, "median_sequence_length": 442, "percent_duplicates": 96.10585586990004, "percent_fails": 36.36363636363637 }, "IPFS1": { "total_sequences": 155183.0, "percent_gc": 51.0, "avg_sequence_length": 465.9449553108266, "median_sequence_length": 467, "percent_duplicates": 96.4267993272459, "percent_fails": 36.36363636363637 }, "JVFS1": { "total_sequences": 105712.0, "percent_gc": 51.0, "avg_sequence_length": 466.0567721734524, "median_sequence_length": 467, "percent_duplicates": 96.30505524443772, "percent_fails": 36.36363636363637 }, "IVFS2": { "total_sequences": 122876.0, "percent_gc": 51.0, "avg_sequence_length": 466.1178505159673, "median_sequence_length": 467, "percent_duplicates": 96.94407370031577, "percent_fails": 45.45454545454545 }, "DVFS1": { "total_sequences": 68891.0, "percent_gc": 51.0, "avg_sequence_length": 458.94500733042054, "median_sequence_length": 467, "percent_duplicates": 92.64925752275333, "percent_fails": 45.45454545454545 }, "DPFS2": { "total_sequences": 123783.0, "percent_gc": 52.0, "avg_sequence_length": 464.8087297932673, "median_sequence_length": 467, "percent_duplicates": 94.82885371981612, "percent_fails": 45.45454545454545 }, "CVMS1": { "total_sequences": 178171.0, "percent_gc": 52.0, "avg_sequence_length": 444.28740086770574, "median_sequence_length": 442, "percent_duplicates": 94.7017191349883, "percent_fails": 36.36363636363637 }, "JVFS2": { "total_sequences": 144540.0, "percent_gc": 53.0, "avg_sequence_length": 443.42470596374704, "median_sequence_length": 437, "percent_duplicates": 96.05783866057838, "percent_fails": 36.36363636363637 }, "CPMS1": { "total_sequences": 219016.0, "percent_gc": 53.0, "avg_sequence_length": 443.2770025934178, "median_sequence_length": 442, "percent_duplicates": 94.4433283413084, "percent_fails": 45.45454545454545 }, "ICMS1": { "total_sequences": 188256.0, "percent_gc": 53.0, "avg_sequence_length": 457.1018241118477, "median_sequence_length": 467, "percent_duplicates": 96.47448155702872, "percent_fails": 45.45454545454545 }, "CVMS2": { "total_sequences": 221590.0, "percent_gc": 52.0, "avg_sequence_length": 444.08152443702335, "median_sequence_length": 442, "percent_duplicates": 94.74163996570242, "percent_fails": 45.45454545454545 }, "ICMS2": { "total_sequences": 121148.0, "percent_gc": 53.0, "avg_sequence_length": 446.28260474791165, "median_sequence_length": 437, "percent_duplicates": 95.67966454254301, "percent_fails": 45.45454545454545 }, "DCFS2": { "total_sequences": 64901.0, "percent_gc": 51.0, "avg_sequence_length": 464.471533566509, "median_sequence_length": 467, "percent_duplicates": 93.4346157994484, "percent_fails": 45.45454545454545 }, "CCFS1": { "total_sequences": 210493.0, "percent_gc": 53.0, "avg_sequence_length": 443.8030528331108, "median_sequence_length": 442, "percent_duplicates": 94.58889369242682, "percent_fails": 45.45454545454545 }, "CCMS2": { "total_sequences": 191306.0, "percent_gc": 53.0, "avg_sequence_length": 443.0256029607017, "median_sequence_length": 442, "percent_duplicates": 94.36975317031353, "percent_fails": 36.36363636363637 }, "JVMS1": { "total_sequences": 335820.0, "percent_gc": 51.0, "avg_sequence_length": 463.6972187481389, "median_sequence_length": 467, "percent_duplicates": 97.08266333154666, "percent_fails": 45.45454545454545 }, "CPFS2": { "total_sequences": 173040.0, "percent_gc": 53.0, "avg_sequence_length": 443.6046000924642, "median_sequence_length": 442, "percent_duplicates": 93.91643550624133, "percent_fails": 27.27272727272727 }, "IAFS1": { "total_sequences": 160629.0, "percent_gc": 54.0, "avg_sequence_length": 452.8225911883906, "median_sequence_length": 467, "percent_duplicates": 98.1584894383953, "percent_fails": 36.36363636363637 }, "CAMS1": { "total_sequences": 143677.0, "percent_gc": 53.0, "avg_sequence_length": 444.7415591917983, "median_sequence_length": 442, "percent_duplicates": 95.84345441511168, "percent_fails": 45.45454545454545 }, "JPMS2": { "total_sequences": 129719.0, "percent_gc": 51.0, "avg_sequence_length": 464.088645456718, "median_sequence_length": 467, "percent_duplicates": 95.07550937025417, "percent_fails": 36.36363636363637 }, "IAMS1": { "total_sequences": 148021.0, "percent_gc": 54.0, "avg_sequence_length": 458.31947156146765, "median_sequence_length": 467, "percent_duplicates": 97.9219164848231, "percent_fails": 36.36363636363637 }, "DAFS1": { "total_sequences": 87320.0, "percent_gc": 54.0, "avg_sequence_length": 456.9547984425103, "median_sequence_length": 467, "percent_duplicates": 94.95648190563445, "percent_fails": 36.36363636363637 }, "DAFS2": { "total_sequences": 36488.0, "percent_gc": 54.0, "avg_sequence_length": 454.6640265292699, "median_sequence_length": 462, "percent_duplicates": 91.96722210041658, "percent_fails": 36.36363636363637 }, "IAMS2": { "total_sequences": 148413.0, "percent_gc": 54.0, "avg_sequence_length": 452.2845404378323, "median_sequence_length": 442, "percent_duplicates": 96.6512367514975, "percent_fails": 36.36363636363637 }, "JVMS2": { "total_sequences": 112887.0, "percent_gc": 52.0, "avg_sequence_length": 461.5294719498259, "median_sequence_length": 467, "percent_duplicates": 94.88337895417541, "percent_fails": 45.45454545454545 }, "ICFS2": { "total_sequences": 167066.0, "percent_gc": 53.0, "avg_sequence_length": 446.1869380963212, "median_sequence_length": 442, "percent_duplicates": 93.34993355919218, "percent_fails": 27.27272727272727 }, "IPMS2": { "total_sequences": 236364.0, "percent_gc": 53.0, "avg_sequence_length": 447.0931825489499, "median_sequence_length": 442, "percent_duplicates": 95.7074681423567, "percent_fails": 36.36363636363637 }, "DPFS1": { "total_sequences": 136277.0, "percent_gc": 52.0, "avg_sequence_length": 465.0538572172854, "median_sequence_length": 467, "percent_duplicates": 95.38660228798696, "percent_fails": 45.45454545454545 }, "DCFS1": { "total_sequences": 116372.0, "percent_gc": 51.0, "avg_sequence_length": 464.4373045062386, "median_sequence_length": 467, "percent_duplicates": 95.22049977657856, "percent_fails": 36.36363636363637 }, "JCMS2": { "total_sequences": 123179.0, "percent_gc": 52.0, "avg_sequence_length": 461.4879281371013, "median_sequence_length": 467, "percent_duplicates": 94.80268552269462, "percent_fails": 36.36363636363637 }, "JPMS1": { "total_sequences": 204563.0, "percent_gc": 51.0, "avg_sequence_length": 462.4688042314593, "median_sequence_length": 467, "percent_duplicates": 95.72063374119465, "percent_fails": 45.45454545454545 }, "JAFS1": { "total_sequences": 129259.0, "percent_gc": 53.0, "avg_sequence_length": 463.53022226692144, "median_sequence_length": 467, "percent_duplicates": 96.61919092674398, "percent_fails": 36.36363636363637 }, "JCFS2": { "total_sequences": 146564.0, "percent_gc": 51.0, "avg_sequence_length": 466.4571654703747, "median_sequence_length": 467, "percent_duplicates": 97.28241587292923, "percent_fails": 36.36363636363637 }, "DPMS2": { "total_sequences": 83113.0, "percent_gc": 52.0, "avg_sequence_length": 458.37495939263414, "median_sequence_length": 467, "percent_duplicates": 92.43800608809693, "percent_fails": 45.45454545454545 }, "CAMS2": { "total_sequences": 163553.0, "percent_gc": 53.0, "avg_sequence_length": 445.3213973452031, "median_sequence_length": 442, "percent_duplicates": 96.1841115723955, "percent_fails": 36.36363636363637 }, "DAMS2": { "total_sequences": 78029.0, "percent_gc": 50.0, "avg_sequence_length": 465.47108126465804, "median_sequence_length": 467, "percent_duplicates": 96.90243371054352, "percent_fails": 36.36363636363637 }, "IVMS1": { "total_sequences": 149786.0, "percent_gc": 52.0, "avg_sequence_length": 448.661433645334, "median_sequence_length": 442, "percent_duplicates": 94.98017171164194, "percent_fails": 36.36363636363637 }, "CPMS2": { "total_sequences": 197896.0, "percent_gc": 53.0, "avg_sequence_length": 443.1454703480616, "median_sequence_length": 442, "percent_duplicates": 94.4743703763593, "percent_fails": 27.27272727272727 }, "CPFS1": { "total_sequences": 143942.0, "percent_gc": 54.0, "avg_sequence_length": 464.0949618596379, "median_sequence_length": 467, "percent_duplicates": 95.57043809312084, "percent_fails": 45.45454545454545 }, "IVFS1": { "total_sequences": 221417.0, "percent_gc": 53.0, "avg_sequence_length": 444.1805913728395, "median_sequence_length": 437, "percent_duplicates": 97.20301512530655, "percent_fails": 45.45454545454545 }, "CVFS1": { "total_sequences": 213019.0, "percent_gc": 53.0, "avg_sequence_length": 443.4191457100071, "median_sequence_length": 442, "percent_duplicates": 94.4122355282862, "percent_fails": 36.36363636363637 }, "IVMS2": { "total_sequences": 105923.0, "percent_gc": 51.0, "avg_sequence_length": 462.34728057173606, "median_sequence_length": 467, "percent_duplicates": 95.85075951398657, "percent_fails": 45.45454545454545 }, "IPFS2": { "total_sequences": 217575.0, "percent_gc": 53.0, "avg_sequence_length": 443.3502654257153, "median_sequence_length": 442, "percent_duplicates": 94.52878317821441, "percent_fails": 27.27272727272727 }, "JAFS2": { "total_sequences": 82285.0, "percent_gc": 54.0, "avg_sequence_length": 462.32100018229323, "median_sequence_length": 467, "percent_duplicates": 96.01628486358389, "percent_fails": 36.36363636363637 }, "JAMS1": { "total_sequences": 159591.0, "percent_gc": 50.0, "avg_sequence_length": 466.6889204278437, "median_sequence_length": 467, "percent_duplicates": 98.31632109580114, "percent_fails": 45.45454545454545 }, "DVFS2": { "total_sequences": 95758.0, "percent_gc": 51.0, "avg_sequence_length": 461.2144781637043, "median_sequence_length": 467, "percent_duplicates": 93.66945842645, "percent_fails": 45.45454545454545 }, "JPFS2": { "total_sequences": 195517.0, "percent_gc": 51.0, "avg_sequence_length": 466.55985924497617, "median_sequence_length": 467, "percent_duplicates": 97.44523494120716, "percent_fails": 45.45454545454545 } } ], "report_general_stats_headers": [ { "percent_duplicates": { "title": "Dups", "description": "% duplicate reads", "max": 100, "min": 0, "suffix": "%", "scale": "RdYlGn-rev", "namespace": "FastQC", "rid": "fastqc-percent_duplicates", "placement": 1000 }, "percent_gc": { "title": "GC", "description": "Average % GC content", "max": 100, "min": 0, "suffix": "%", "scale": "PuRd", "format": "{:,.1f}", "namespace": "FastQC", "rid": "fastqc-percent_gc", "placement": 1000 }, "avg_sequence_length": { "title": "Avg len", "description": "Average read length", "min": 0, "suffix": " bp", "scale": "RdYlGn", "format": "{:,.0f}", "hidden": true, "namespace": "FastQC", "rid": "fastqc-avg_sequence_length", "placement": 1000 }, "median_sequence_length": { "title": "Median len", "description": "Median read length", "min": 0, "suffix": " bp", "scale": "RdYlGn", "format": "{:,.0f}", "hidden": false, "namespace": "FastQC", "rid": "fastqc-median_sequence_length", "placement": 1000 }, "percent_fails": { "title": "Failed", "description": "Percentage of modules failed in FastQC report (includes those not plotted here)", "max": 100, "min": 0, "suffix": "%", "scale": "Reds", "format": "{:,.0f}", "hidden": true, "namespace": "FastQC", "rid": "fastqc-percent_fails", "placement": 1000 }, "total_sequences": { "title": "Seqs", "description": "Total sequences (millions)", "min": 0, "scale": "Blues", "suffix": "M", "modify": null, "namespace": "FastQC", "rid": "fastqc-total_sequences", "placement": 1000 } } ], "report_multiqc_command": "/home/dgpinheiro/.local/bin/multiqc /data/MicrobiomaFrangos/output/fastqc/pos --title Amplicons -o /data/MicrobiomaFrangos/output/fastqc/pos", "report_plot_data": { "fastqc_sequence_counts_plot": { "id": "fastqc_sequence_counts_plot", "anchor": "fastqc_sequence_counts_plot", "plot_type": "bar_graph", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 800, "hoverlabel": { "namelength": -1, "bgcolor": "rgba(255, 255, 255, 0.8)", "font": { "color": "black" } }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "white", "plot_bgcolor": "white", "showlegend": true, "title": { "font": { "size": 20 }, "text": "FastQC: Sequence Counts", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)", "showgrid": false, "categoryorder": "trace", "type": "category" }, "barmode": "relative", "bargroupgap": 0, "bargap": 0.2, "legend": { "tracegroupgap": 0, "traceorder": "normal" }, "hovermode": "y unified" }, "datasets": [ { "plot_id": "fastqc_sequence_counts_plot", "label": "1", "uid": "fastqc_sequence_counts_plot", "dconfig": { "title": "FastQC: Sequence Counts
64 samples" }, "layout": { "title": { "text": "FastQC: Sequence Counts
64 samples" }, "xaxis": { "title": { "text": "Number of reads" }, "hoverformat": ",.2f", "ticksuffix": "", "autorangeoptions": { "minallowed": 0, "maxallowed": 335820.0 } }, "yaxis": { "title": null, "hoverformat": null, "ticksuffix": "" }, "showlegend": true }, "trace_params": { "hovertemplate": "%{meta}: %{x}", "orientation": "h", "marker": { "line": { "width": 0 } }, "textposition": "inside", "insidetextanchor": "start" }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "n_samples": 64, "cats": [ { "name": "Unique Reads", "color": "124,181,236", "data": [ 5776.0, 9797.0, 5698.0, 3906.0, 6388.0, 8754.0, 4995.0, 4605.0, 6402.0, 6002.0, 3983.0, 4363.0, 3946.0, 2687.0, 3278.0, 4370.0, 4395.0, 7519.0, 3755.0, 6193.0, 10146.0, 10363.0, 11904.0, 5545.0, 5234.0, 6637.0, 11110.0, 8082.0, 4970.0, 3076.0, 2574.0, 2958.0, 9639.0, 10580.0, 6062.0, 5065.0, 6285.0, 5466.0, 6402.0, 6287.0, 5490.0, 9313.0, 4261.0, 5562.0, 2417.0, 2722.0, 2931.0, 4404.0, 11652.0, 9440.0, 11122.0, 11903.0, 10935.0, 12170.0, 10527.0, 6376.0, 10771.0, 11393.0, 11578.0, 11390.0, 6241.0, 5972.0, 6135.0, 6245.0 ], "data_pct": [ 5.116621045824585, 2.917336668453338, 3.9421613394216135, 3.694944755562282, 4.9244906297458355, 4.279366258805356, 2.5547650587928414, 2.0352061944516877, 5.197314477305385, 3.8525973900931376, 2.7175841270707677, 2.4016601895786773, 2.7413629005925957, 1.6836789041988585, 3.9837151364161145, 3.3808090732560205, 4.149240486013425, 5.019828288358057, 3.0559262996842347, 2.7969848746934516, 4.292531857643296, 3.1019701985763803, 5.471216821785592, 3.573200672754103, 4.320335457456995, 3.5255184429712734, 6.650066440807824, 6.010709504685408, 3.3487632485024896, 2.0780835151769006, 2.0599910365580385, 1.8415105616046916, 6.2743285641753355, 6.70702716409395, 6.33054157354999, 7.352194045666343, 7.5619939119030715, 6.893072877914676, 5.171954145561183, 4.6133977120130325, 6.37526999094224, 4.019647196433119, 6.565384200551609, 4.779500223421442, 3.097566289456484, 4.423498821808726, 8.032777899583426, 5.0435180943655515, 5.258360034297577, 5.298280865011702, 5.54066575667301, 5.587764471713791, 5.5256296236407, 5.556671658691602, 6.083564493758669, 4.42956190687916, 5.630246829686471, 5.585926583283896, 5.88280126618939, 5.411106307573173, 3.815888427604507, 4.156545584888326, 4.136633650014497, 3.8941441300999573 ] }, { "name": "Duplicate Reads", "color": "67,67,72", "data": [ 107111.0, 326023.0, 138842.0, 101806.0, 123331.0, 195809.0, 190522.0, 221662.0, 116777.0, 149789.0, 142581.0, 177303.0, 139997.0, 156904.0, 79007.0, 124889.0, 101528.0, 142267.0, 119121.0, 215224.0, 226218.0, 323715.0, 205671.0, 149638.0, 115914.0, 181619.0, 155956.0, 126378.0, 143443.0, 144945.0, 122378.0, 157671.0, 143987.0, 147165.0, 89696.0, 63826.0, 76828.0, 73831.0, 117381.0, 129990.0, 80624.0, 222374.0, 60640.0, 110810.0, 75612.0, 58813.0, 33557.0, 82916.0, 209938.0, 168731.0, 189612.0, 201116.0, 186961.0, 206846.0, 162513.0, 137566.0, 180535.0, 192566.0, 185233.0, 199103.0, 157312.0, 137705.0, 142174.0, 154124.0 ], "data_pct": [ 94.88337895417541, 97.08266333154666, 96.05783866057838, 96.30505524443772, 95.07550937025417, 95.72063374119465, 97.44523494120716, 97.96479380554831, 94.80268552269462, 96.14740260990686, 97.28241587292923, 97.59833981042132, 97.25863709940741, 98.31632109580114, 96.01628486358389, 96.61919092674398, 95.85075951398657, 94.98017171164194, 96.94407370031577, 97.20301512530655, 95.7074681423567, 96.89802980142362, 94.52878317821441, 96.42679932724589, 95.67966454254301, 96.47448155702872, 93.34993355919218, 93.98929049531459, 96.65123675149752, 97.9219164848231, 97.94000896344195, 98.1584894383953, 93.72567143582467, 93.29297283590606, 93.66945842645002, 92.64780595433366, 92.43800608809693, 93.10692712208532, 94.82804585443881, 95.38660228798696, 93.62473000905777, 95.98035280356689, 93.4346157994484, 95.22049977657856, 96.9024337105435, 95.57650117819128, 91.96722210041658, 94.95648190563445, 94.74163996570243, 94.7017191349883, 94.45933424332699, 94.41223552828622, 94.47437037635929, 94.4433283413084, 93.91643550624134, 95.57043809312084, 94.36975317031353, 94.4140734167161, 94.11719873381061, 94.58889369242682, 96.1841115723955, 95.84345441511168, 95.8633663499855, 96.10585586990005 ] } ], "samples": [ "JVMS2", "JVMS1", "JVFS2", "JVFS1", "JPMS2", "JPMS1", "JPFS2", "JPFS1", "JCMS2", "JCMS1", "JCFS2", "JCFS1", "JAMS2", "JAMS1", "JAFS2", "JAFS1", "IVMS2", "IVMS1", "IVFS2", "IVFS1", "IPMS2", "IPMS1", "IPFS2", "IPFS1", "ICMS2", "ICMS1", "ICFS2", "ICFS1", "IAMS2", "IAMS1", "IAFS2", "IAFS1", "DVMS2", "DVMS1", "DVFS2", "DVFS1", "DPMS2", "DPMS1", "DPFS2", "DPFS1", "DCMS2", "DCMS1", "DCFS2", "DCFS1", "DAMS2", "DAMS1", "DAFS2", "DAFS1", "CVMS2", "CVMS1", "CVFS2", "CVFS1", "CPMS2", "CPMS1", "CPFS2", "CPFS1", "CCMS2", "CCMS1", "CCFS2", "CCFS1", "CAMS2", "CAMS1", "CAFS2", "CAFS1" ] } ], "pconfig": { "id": "fastqc_sequence_counts_plot", "title": "FastQC: Sequence Counts", "anchor": null, "table_title": null, "height": null, "width": null, "square": false, "logswitch": false, "logswitch_active": false, "logswitch_label": "Log10", "cpswitch": true, "cpswitch_c_active": true, "cpswitch_counts_label": "Number of reads", "cpswitch_percent_label": "Percentages", "xLog": null, "yLog": null, "xlog": false, "ylog": false, "data_labels": [], "xTitle": null, "yTitle": null, "xlab": null, "ylab": "Number of reads", "xsuffix": null, "ysuffix": null, "tt_suffix": null, "xLabFormat": null, "yLabFormat": null, "xLabelFormat": null, "yLabelFormat": null, "xlab_format": null, "ylab_format": null, "tt_label": null, "xDecimals": null, "yDecimals": null, "decimalPlaces": null, "x_decimals": null, "y_decimals": null, "tt_decimals": null, "xmin": null, "xmax": null, "ymin": null, "ymax": null, "xFloor": null, "xCeiling": null, "yFloor": null, "yCeiling": null, "x_clipmin": null, "x_clipmax": null, "y_clipmin": null, "y_clipmax": null, "save_data_file": true, "showlegend": null, "xMinRange": null, "yMinRange": null, "x_minrange": null, "y_minrange": null, "xPlotBands": null, "yPlotBands": null, "xPlotLines": null, "yPlotLines": null, "x_bands": null, "y_bands": null, "x_lines": null, "y_lines": null, "stacking": "relative", "hide_zero_cats": true, "sort_samples": true, "use_legend": true, "suffix": null, "lab_format": null }, "add_log_tab": false, "add_pct_tab": true, "l_active": false, "p_active": false, "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "xaxis" ], "square": false, "flat": false, "defer_render": false }, "fastqc_per_base_sequence_quality_plot": { "id": "fastqc_per_base_sequence_quality_plot", "anchor": "fastqc_per_base_sequence_quality_plot", "plot_type": "xy_line", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 500, "hoverlabel": { "namelength": -1 }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "white", "plot_bgcolor": "white", "showlegend": false, "title": { "font": { "size": 20 }, "text": "FastQC: Mean Quality Scores", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "shapes": [ { "fillcolor": "#c3e6c3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 28, "y1": 100 }, { "fillcolor": "#e6dcc3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 20, "y1": 28 }, { "fillcolor": "#e6c3c3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 0, "y1": 20 }, { "fillcolor": "#c3e6c3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 28, "y1": 100 }, { "fillcolor": "#e6dcc3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 20, "y1": 28 }, { "fillcolor": "#e6c3c3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 0, "y1": 20 } ], "hoverdistance": -1 }, "datasets": [ { "plot_id": "fastqc_per_base_sequence_quality_plot", "label": "1", "uid": "fastqc_per_base_sequence_quality_plot", "dconfig": { "title": "FastQC: Mean Quality Scores
64 samples" }, "layout": { "title": { "text": "FastQC: Mean Quality Scores
64 samples" }, "xaxis": { "hoverformat": ",.0f", "ticksuffix": " bp", "title": { "text": "Position (bp)" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": null } }, "yaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "Phred Score" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": null }, "range": [ 0, 42.0 ] } }, "trace_params": { "hovertemplate": "%{text}
Base %{x}: %{y:.2f}", "mode": "lines", "line": { "width": 2 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "n_samples": 64, "lines": [ { "name": "CAFS1", "pairs": [ [ 1, 39.60191807643622 ], [ 2, 38.64370296004839 ], [ 3, 39.22216887303656 ], [ 4, 39.212840386857806 ], [ 5, 38.89659472840761 ], [ 6, 39.36683523623643 ], [ 7, 39.38629036783917 ], [ 8, 39.45982078830697 ], [ 9, 38.910662285104976 ], [ 10, 39.557966938747505 ], [ 20, 39.52390299870923 ], [ 30, 39.5762248314824 ], [ 40, 39.61224675591916 ], [ 50, 39.385424863907616 ], [ 60, 39.49639144722483 ], [ 70, 39.490936527633146 ], [ 80, 39.55933752782645 ], [ 90, 39.50634723668539 ], [ 100, 39.38559322562341 ], [ 110, 39.373549750887015 ], [ 120, 39.31872119923427 ], [ 130, 39.25645355399111 ], [ 140, 39.47247161234403 ], [ 150, 39.64123739625489 ], [ 160, 39.663868952228924 ], [ 170, 39.66226016250023 ], [ 180, 39.70890134627017 ], [ 190, 39.65931445603577 ], [ 200, 39.72313975893097 ], [ 210, 39.71772599442536 ], [ 220, 39.711707374866705 ], [ 230, 39.70244623337428 ], [ 240, 39.75759030735367 ], [ 250, 39.75198822715113 ], [ 260, 39.72443801482831 ], [ 270, 39.72731512948263 ], [ 280, 39.70768415342117 ], [ 290, 39.70084742063616 ], [ 300, 38.944186764122655 ], [ 310, 39.09466595163563 ], [ 320, 38.895788384071444 ], [ 330, 39.166369378616864 ], [ 340, 38.82021512631354 ], [ 350, 39.191742753080874 ], [ 360, 39.106543604441676 ], [ 370, 39.020155541557784 ], [ 380, 39.1297348455803 ], [ 390, 39.09639700883752 ], [ 400, 39.341433814183915 ], [ 410, 39.25974976585003 ], [ 420, 39.21749018145909 ], [ 430, 39.18716576036603 ], [ 440, 39.05855545051948 ], [ 450, 39.274959276923155 ], [ 460, 39.25259085593682 ], [ 470, 38.4 ], [ 480, 40.0 ], [ 490, 40.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAFS2", "pairs": [ [ 1, 39.35912183346931 ], [ 2, 38.80135392997053 ], [ 3, 39.207600347922245 ], [ 4, 38.67786850427149 ], [ 5, 38.8073009729686 ], [ 6, 39.229419657606755 ], [ 7, 39.40227497994053 ], [ 8, 39.47204822364118 ], [ 9, 38.94876238124456 ], [ 10, 39.501945262930775 ], [ 20, 39.47366107249055 ], [ 30, 39.55023093676042 ], [ 40, 39.589036403724656 ], [ 50, 39.389690443600855 ], [ 60, 39.51743184837063 ], [ 70, 39.4568475277967 ], [ 80, 39.5289267677619 ], [ 90, 39.46692918164103 ], [ 100, 39.34291782696937 ], [ 110, 39.33597691306664 ], [ 120, 39.286387205092076 ], [ 130, 39.23955929849166 ], [ 140, 39.45141023134132 ], [ 150, 39.64398114746914 ], [ 160, 39.66976919809317 ], [ 170, 39.675037927570145 ], [ 180, 39.731463363652914 ], [ 190, 39.673724453674424 ], [ 200, 39.73487111368832 ], [ 210, 39.73201761187791 ], [ 220, 39.72427971330128 ], [ 230, 39.71807644849605 ], [ 240, 39.771959894544494 ], [ 250, 39.760810200325004 ], [ 260, 39.73913113836652 ], [ 270, 39.735392997053445 ], [ 280, 39.720266470679455 ], [ 290, 39.70744189496254 ], [ 300, 38.95357091444146 ], [ 310, 39.122956280173696 ], [ 320, 38.84844782479705 ], [ 330, 39.23124039161745 ], [ 340, 38.82912699662107 ], [ 350, 39.23629946751134 ], [ 360, 39.0963680529426 ], [ 370, 39.014471823178255 ], [ 380, 39.177085939542074 ], [ 390, 39.112949062927825 ], [ 400, 39.34607606424943 ], [ 410, 39.31113927611294 ], [ 420, 39.163970161736344 ], [ 430, 39.13461399153549 ], [ 440, 39.013596528334 ], [ 450, 39.15799558783932 ], [ 460, 39.35401450323356 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAMS1", "pairs": [ [ 1, 39.64498145145013 ], [ 2, 39.079685683860326 ], [ 3, 39.25524614238883 ], [ 4, 39.09416260083381 ], [ 5, 38.83221392428851 ], [ 6, 39.3723421285244 ], [ 7, 39.374736387870016 ], [ 8, 39.502328138811365 ], [ 9, 38.972500817806605 ], [ 10, 39.54061680018374 ], [ 20, 39.509861703682574 ], [ 30, 39.563462488776906 ], [ 40, 39.60211585709612 ], [ 50, 39.41856246998476 ], [ 60, 39.50539334757825 ], [ 70, 39.45772531442054 ], [ 80, 39.522729455654 ], [ 90, 39.469047933907305 ], [ 100, 39.37573306792319 ], [ 110, 39.33171767227879 ], [ 120, 39.30230725864265 ], [ 130, 39.18863422816456 ], [ 140, 39.50575527050258 ], [ 150, 39.64303820374868 ], [ 160, 39.66253471328048 ], [ 170, 39.64288508251147 ], [ 180, 39.70053522832465 ], [ 190, 39.642159844651545 ], [ 200, 39.71865503873271 ], [ 210, 39.714111514021035 ], [ 220, 39.694534267836886 ], [ 230, 39.689532771424794 ], [ 240, 39.74244172692916 ], [ 250, 39.74665116894144 ], [ 260, 39.71627609151083 ], [ 270, 39.7238500247082 ], [ 280, 39.69783751052708 ], [ 290, 39.67935438518343 ], [ 300, 38.912794671380944 ], [ 310, 39.04355285352837 ], [ 320, 38.84612322169326 ], [ 330, 39.21032601130321 ], [ 340, 38.73863590040979 ], [ 350, 39.18422668567699 ], [ 360, 39.095404115872185 ], [ 370, 39.010916311258924 ], [ 380, 39.135204475708846 ], [ 390, 39.02756680731365 ], [ 400, 39.29308396279926 ], [ 410, 39.19927004569291 ], [ 420, 39.15558063933319 ], [ 430, 39.12139478779048 ], [ 440, 39.05469834317443 ], [ 450, 39.19468731915918 ], [ 460, 38.66347817008025 ], [ 470, 40.0 ], [ 480, 40.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAMS2", "pairs": [ [ 1, 39.5516071242961 ], [ 2, 38.87248781740475 ], [ 3, 39.20698489174763 ], [ 4, 39.193068913440904 ], [ 5, 38.929619144864354 ], [ 6, 39.391438860797415 ], [ 7, 39.34479954510159 ], [ 8, 39.49452471064426 ], [ 9, 38.99736476860712 ], [ 10, 39.55492592615238 ], [ 20, 39.523579512451626 ], [ 30, 39.58393425984237 ], [ 40, 39.61749891472489 ], [ 50, 39.442945100365016 ], [ 60, 39.563987209039276 ], [ 70, 39.48511124834151 ], [ 80, 39.55592132214023 ], [ 90, 39.499089591753126 ], [ 100, 39.39978844778145 ], [ 110, 39.36328774158835 ], [ 120, 39.331247974662645 ], [ 130, 39.23216571998068 ], [ 140, 39.51011965540222 ], [ 150, 39.655580759753725 ], [ 160, 39.68030913526502 ], [ 170, 39.6677578521947 ], [ 180, 39.716560381038555 ], [ 190, 39.657604568549644 ], [ 200, 39.728720353646835 ], [ 210, 39.725088503420906 ], [ 220, 39.713429897342145 ], [ 230, 39.707107787689615 ], [ 240, 39.76182277304605 ], [ 250, 39.75674429695572 ], [ 260, 39.73629343393273 ], [ 270, 39.73797973745514 ], [ 280, 39.716927234596746 ], [ 290, 39.697153827811164 ], [ 300, 38.96983240906617 ], [ 310, 39.08836374357945 ], [ 320, 38.86362991586773 ], [ 330, 39.23818613206048 ], [ 340, 38.808771434815284 ], [ 350, 39.24482592024071 ], [ 360, 39.10909301752429 ], [ 370, 39.095201051891266 ], [ 380, 39.197177759845275 ], [ 390, 39.0820445384987 ], [ 400, 39.334209995168166 ], [ 410, 39.262934131414546 ], [ 420, 39.19677909619499 ], [ 430, 39.15474283913987 ], [ 440, 39.104127673514554 ], [ 450, 39.252742757676664 ], [ 460, 39.28348336688434 ], [ 470, 34.666666666666664 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCFS1", "pairs": [ [ 1, 32.32073275595863 ], [ 2, 33.168395148532255 ], [ 3, 33.66576085665557 ], [ 4, 33.41267880642111 ], [ 5, 33.2887839500601 ], [ 6, 33.196776139824124 ], [ 7, 33.58370112070235 ], [ 8, 33.53184191398289 ], [ 9, 33.4615402887507 ], [ 10, 33.33609953775185 ], [ 20, 33.480458732594435 ], [ 30, 33.526255980008834 ], [ 40, 33.65752115272242 ], [ 50, 33.5169554331973 ], [ 60, 33.47143087893659 ], [ 70, 33.437478205926084 ], [ 80, 33.61787090307041 ], [ 90, 33.38466884884533 ], [ 100, 33.43400160575412 ], [ 110, 33.270979082439794 ], [ 120, 33.29579653480163 ], [ 130, 33.27034960782544 ], [ 140, 33.157241333441014 ], [ 150, 33.10408564655357 ], [ 160, 33.14621388834782 ], [ 170, 33.105255281648326 ], [ 180, 33.210384193298594 ], [ 190, 33.26301587226179 ], [ 200, 33.26206382159977 ], [ 210, 33.260904163083815 ], [ 220, 33.385137748048635 ], [ 230, 33.388777774082754 ], [ 240, 33.42300741592357 ], [ 250, 33.407739924843106 ], [ 260, 33.39732105105633 ], [ 270, 33.35885468875449 ], [ 280, 33.32056267904396 ], [ 290, 33.35934259096502 ], [ 300, 32.03452079626004 ], [ 310, 31.618249372971313 ], [ 320, 32.11542374654128 ], [ 330, 32.35477469596554 ], [ 340, 32.27606434739846 ], [ 350, 32.61158069646607 ], [ 360, 32.55862701926416 ], [ 370, 32.36028683532294 ], [ 380, 32.644422586960225 ], [ 390, 32.76880290665601 ], [ 400, 32.815735317659 ], [ 410, 32.961306248811475 ], [ 420, 32.97152700096187 ], [ 430, 32.91295022406437 ], [ 440, 32.59172336950496 ], [ 450, 32.92712330026599 ], [ 460, 32.48519959039317 ], [ 470, 30.5 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCFS2", "pairs": [ [ 1, 32.31117671268374 ], [ 2, 33.17426363363836 ], [ 3, 33.65219423711073 ], [ 4, 33.38959712617689 ], [ 5, 33.25466564368862 ], [ 6, 33.201574099008695 ], [ 7, 33.578478845186496 ], [ 8, 33.5275314896017 ], [ 9, 33.43608843001662 ], [ 10, 33.321154305399595 ], [ 20, 33.46745811971891 ], [ 30, 33.51556518690521 ], [ 40, 33.65146663550309 ], [ 50, 33.50269090650421 ], [ 60, 33.48250758341759 ], [ 70, 33.44256367784321 ], [ 80, 33.60851070316192 ], [ 90, 33.38363709345514 ], [ 100, 33.41821951008836 ], [ 110, 33.25316725183044 ], [ 120, 33.28730914430596 ], [ 130, 33.249705555075685 ], [ 140, 33.16220688884259 ], [ 150, 33.1094842259833 ], [ 160, 33.15220033433091 ], [ 170, 33.120703111106586 ], [ 180, 33.22535274959225 ], [ 190, 33.28743972643805 ], [ 200, 33.28757081667183 ], [ 210, 33.28635848606023 ], [ 220, 33.40328589357303 ], [ 230, 33.4093973405958 ], [ 240, 33.43937737219972 ], [ 250, 33.430217315089095 ], [ 260, 33.413341733947796 ], [ 270, 33.382611744262256 ], [ 280, 33.3433766405333 ], [ 290, 33.387852813104956 ], [ 300, 32.146179230195784 ], [ 310, 31.719108153105623 ], [ 320, 32.206898949638116 ], [ 330, 32.43020752836865 ], [ 340, 32.36041454891374 ], [ 350, 32.68242612350817 ], [ 360, 32.62628054893939 ], [ 370, 32.41651066911115 ], [ 380, 32.705285643080614 ], [ 390, 32.815885176830044 ], [ 400, 32.87744375153977 ], [ 410, 33.019368722664396 ], [ 420, 33.030888120944596 ], [ 430, 32.97002684877821 ], [ 440, 32.661104549362264 ], [ 450, 32.97933777123836 ], [ 460, 32.576355304446444 ], [ 470, 34.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCMS1", "pairs": [ [ 1, 32.255580778489794 ], [ 2, 33.141111694016935 ], [ 3, 33.650277751901115 ], [ 4, 33.41964316357699 ], [ 5, 33.23048749993871 ], [ 6, 33.1791144298609 ], [ 7, 33.573757470864244 ], [ 8, 33.51901117381435 ], [ 9, 33.400276526164575 ], [ 10, 33.32266926195951 ], [ 20, 33.391135473305916 ], [ 30, 33.503963051397584 ], [ 40, 33.63486583087778 ], [ 50, 33.48618202677989 ], [ 60, 33.459788486901786 ], [ 70, 33.48046421094436 ], [ 80, 33.62753249427581 ], [ 90, 33.45080530891012 ], [ 100, 33.462581695340724 ], [ 110, 33.26008364426183 ], [ 120, 33.21396359072166 ], [ 130, 33.29721757804265 ], [ 140, 33.14946778519212 ], [ 150, 33.100665329796676 ], [ 160, 33.120420280546575 ], [ 170, 33.089391005054935 ], [ 180, 33.21235052142832 ], [ 190, 33.26845934722174 ], [ 200, 33.26118876833089 ], [ 210, 33.25925259488427 ], [ 220, 33.385461783986 ], [ 230, 33.393286886089854 ], [ 240, 33.43667501801833 ], [ 250, 33.4329227933065 ], [ 260, 33.39821777906344 ], [ 270, 33.36600395177462 ], [ 280, 33.3147093288357 ], [ 290, 33.354677165508754 ], [ 300, 32.023010507013666 ], [ 310, 31.758939790413347 ], [ 320, 32.19908152381549 ], [ 330, 32.350970335866634 ], [ 340, 32.29185967468716 ], [ 350, 32.63174910753272 ], [ 360, 32.607413044141175 ], [ 370, 32.3895786854689 ], [ 380, 32.701949574695874 ], [ 390, 32.81169782585396 ], [ 400, 32.789828442438996 ], [ 410, 32.98215191782939 ], [ 420, 32.95809259781468 ], [ 430, 32.902773741384785 ], [ 440, 32.56478295478082 ], [ 450, 32.88885280399201 ], [ 460, 32.26495101340796 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCMS2", "pairs": [ [ 1, 32.22807962113055 ], [ 2, 33.12880411487355 ], [ 3, 33.63342498405696 ], [ 4, 33.38776619656467 ], [ 5, 33.18857223505797 ], [ 6, 33.173476001798164 ], [ 7, 33.55400771538791 ], [ 8, 33.50968082548378 ], [ 9, 33.37723333298485 ], [ 10, 33.29961632149541 ], [ 20, 33.39386428026303 ], [ 30, 33.500879742402226 ], [ 40, 33.62977794737228 ], [ 50, 33.482854170804885 ], [ 60, 33.458566903285835 ], [ 70, 33.48008060384932 ], [ 80, 33.615427116765815 ], [ 90, 33.4425496325259 ], [ 100, 33.45228377573103 ], [ 110, 33.2482185608397 ], [ 120, 33.21817402486069 ], [ 130, 33.290504218372654 ], [ 140, 33.15493763917493 ], [ 150, 33.10767461553742 ], [ 160, 33.1217118124889 ], [ 170, 33.10767722915121 ], [ 180, 33.22517537348541 ], [ 190, 33.279955150387345 ], [ 200, 33.278468526862724 ], [ 210, 33.278942636404494 ], [ 220, 33.40090431037187 ], [ 230, 33.40849790388174 ], [ 240, 33.44607801114445 ], [ 250, 33.4419856146697 ], [ 260, 33.41380928982887 ], [ 270, 33.37737446812959 ], [ 280, 33.33437163497224 ], [ 290, 33.38474538174443 ], [ 300, 32.11776002843611 ], [ 310, 31.85304889088845 ], [ 320, 32.2686150275238 ], [ 330, 32.40423547616434 ], [ 340, 32.351841212274344 ], [ 350, 32.67886094539362 ], [ 360, 32.65480414573422 ], [ 370, 32.4206693101104 ], [ 380, 32.73549414666857 ], [ 390, 32.84418782071823 ], [ 400, 32.834690758219125 ], [ 410, 33.025016112474454 ], [ 420, 33.00630587981384 ], [ 430, 32.964539851267524 ], [ 440, 32.63721613813982 ], [ 450, 32.955087534260855 ], [ 460, 32.545148552598256 ], [ 470, 34.0 ], [ 480, 34.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPFS1", "pairs": [ [ 1, 32.28706006585986 ], [ 2, 33.19045170971641 ], [ 3, 33.63966736602242 ], [ 4, 33.51784051909797 ], [ 5, 33.337899987494964 ], [ 6, 33.21373191980103 ], [ 7, 33.597810229120064 ], [ 8, 33.526239735449 ], [ 9, 33.4750663461672 ], [ 10, 33.39031068069083 ], [ 20, 33.6275131650248 ], [ 30, 33.57050617609871 ], [ 40, 33.57721304414278 ], [ 50, 33.511832543663424 ], [ 60, 33.43099790193272 ], [ 70, 33.35861944394269 ], [ 80, 33.594645760097826 ], [ 90, 33.371566325325475 ], [ 100, 33.312089591641076 ], [ 110, 33.47481485598365 ], [ 120, 33.19570799349738 ], [ 130, 33.12130441427798 ], [ 140, 33.26954467771742 ], [ 150, 33.067471620513814 ], [ 160, 33.201451973711634 ], [ 170, 33.066906114962975 ], [ 180, 33.12156563060122 ], [ 190, 33.15936557780217 ], [ 200, 33.16557363382473 ], [ 210, 33.18124522377069 ], [ 220, 33.30164510705701 ], [ 230, 33.319949007239025 ], [ 240, 33.26681649553293 ], [ 250, 33.316369787831206 ], [ 260, 33.43281043753735 ], [ 270, 33.34687443553654 ], [ 280, 33.300971224520985 ], [ 290, 33.28405121507274 ], [ 300, 31.977508523059534 ], [ 310, 31.445974392285724 ], [ 320, 31.978449503616066 ], [ 330, 31.957694472040636 ], [ 340, 32.1866096785452 ], [ 350, 32.314050396348456 ], [ 360, 31.97969601514805 ], [ 370, 32.20552210064343 ], [ 380, 32.61612387077282 ], [ 390, 32.5142714217229 ], [ 400, 32.59546901063375 ], [ 410, 32.89251789064129 ], [ 420, 32.87315953527455 ], [ 430, 32.92650091598595 ], [ 440, 32.89349984939379 ], [ 450, 33.03727071204751 ], [ 460, 32.52426264351929 ], [ 470, 32.70315762668704 ], [ 480, 33.8 ], [ 490, 34.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPFS2", "pairs": [ [ 1, 32.24022769301896 ], [ 2, 33.135506241331484 ], [ 3, 33.64074202496533 ], [ 4, 33.35239251040222 ], [ 5, 33.22311604253352 ], [ 6, 33.16920365233472 ], [ 7, 33.57718446601942 ], [ 8, 33.5158922792418 ], [ 9, 33.42417938049006 ], [ 10, 33.32620550161812 ], [ 20, 33.44076629680998 ], [ 30, 33.499110032362466 ], [ 40, 33.64226883957467 ], [ 50, 33.50441863153029 ], [ 60, 33.46542995839112 ], [ 70, 33.48241678224688 ], [ 80, 33.6253294036061 ], [ 90, 33.43635691169671 ], [ 100, 33.420840268146094 ], [ 110, 33.25890083217753 ], [ 120, 33.30940533980582 ], [ 130, 33.292892394822005 ], [ 140, 33.05048081368469 ], [ 150, 32.96907651410079 ], [ 160, 33.01071833102173 ], [ 170, 32.911122283865 ], [ 180, 33.083343157651406 ], [ 190, 33.14372977346278 ], [ 200, 33.1344388580675 ], [ 210, 33.12406148867314 ], [ 220, 33.301260980120205 ], [ 230, 33.289998844197875 ], [ 240, 33.32575531668978 ], [ 250, 33.29582813222377 ], [ 260, 33.27408980582525 ], [ 270, 33.20722318539066 ], [ 280, 33.18161292186777 ], [ 290, 33.21914066111882 ], [ 300, 31.40058888118354 ], [ 310, 30.96713788743018 ], [ 320, 31.41363452476808 ], [ 330, 31.60350437034639 ], [ 340, 31.65772311261526 ], [ 350, 32.020952375797066 ], [ 360, 31.96253914812611 ], [ 370, 31.704006465242156 ], [ 380, 32.14250275354125 ], [ 390, 32.244367199981426 ], [ 400, 32.25091096278645 ], [ 410, 32.444818241480576 ], [ 420, 32.46365731487846 ], [ 430, 32.354891141674 ], [ 440, 31.91905517297378 ], [ 450, 32.35812953736003 ], [ 460, 31.43616581373908 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPMS1", "pairs": [ [ 1, 31.71660974540673 ], [ 2, 32.952049165357785 ], [ 3, 33.51761515140446 ], [ 4, 33.00188570698031 ], [ 5, 33.10896464185265 ], [ 6, 32.96144573912408 ], [ 7, 33.43353910216605 ], [ 8, 33.407723636629285 ], [ 9, 33.35999196405742 ], [ 10, 33.22830706432406 ], [ 20, 33.31677731307301 ], [ 30, 33.3746205756657 ], [ 40, 33.55529504693722 ], [ 50, 33.38340988786207 ], [ 60, 33.356700423713335 ], [ 70, 33.332507670672456 ], [ 80, 33.509903842641634 ], [ 90, 33.32868420572013 ], [ 100, 33.30382437812762 ], [ 110, 33.090916645359236 ], [ 120, 33.126706724622856 ], [ 130, 33.122624831062566 ], [ 140, 33.04017469043358 ], [ 150, 33.006792654417936 ], [ 160, 33.06151924973518 ], [ 170, 32.98596312598168 ], [ 180, 33.12283303502941 ], [ 190, 33.20458140044563 ], [ 200, 33.19211107864266 ], [ 210, 33.209638108631324 ], [ 220, 33.33417330240714 ], [ 230, 33.34389085728897 ], [ 240, 33.38204834350002 ], [ 250, 33.36310908792052 ], [ 260, 33.33651468385871 ], [ 270, 33.2839052854586 ], [ 280, 33.24647423019322 ], [ 290, 33.29837089527706 ], [ 300, 32.056817490671264 ], [ 310, 31.711838428943103 ], [ 320, 32.172627460996104 ], [ 330, 32.405402857349 ], [ 340, 32.30488555596785 ], [ 350, 32.7095180060691 ], [ 360, 32.67682073421785 ], [ 370, 32.38487993879086 ], [ 380, 32.730908578889554 ], [ 390, 32.79756979028647 ], [ 400, 32.85095453263966 ], [ 410, 33.03174456958327 ], [ 420, 32.980276879817616 ], [ 430, 32.92213691367705 ], [ 440, 32.53048552539555 ], [ 450, 32.96216699832369 ], [ 460, 32.72773445525819 ], [ 470, 32.67833333333333 ], [ 480, 34.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPMS2", "pairs": [ [ 1, 32.26950519464769 ], [ 2, 33.15329263855762 ], [ 3, 33.634722278368436 ], [ 4, 33.358915794154505 ], [ 5, 33.334190686016896 ], [ 6, 33.17334862756195 ], [ 7, 33.56785887536888 ], [ 8, 33.52455330072361 ], [ 9, 33.49876702914662 ], [ 10, 33.42420816994785 ], [ 20, 33.43176112705663 ], [ 30, 33.51118617859886 ], [ 40, 33.65381008206331 ], [ 50, 33.513967942757816 ], [ 60, 33.466826009621215 ], [ 70, 33.49110997695759 ], [ 80, 33.62818803816146 ], [ 90, 33.47078768646158 ], [ 100, 33.43447315761814 ], [ 110, 33.2416107450378 ], [ 120, 33.26961181630755 ], [ 130, 33.29269515300967 ], [ 140, 33.03867738610178 ], [ 150, 32.941242875045475 ], [ 160, 32.99954471035291 ], [ 170, 32.901422464324696 ], [ 180, 33.05468528924284 ], [ 190, 33.14465072563367 ], [ 200, 33.1273896390023 ], [ 210, 33.12873630593848 ], [ 220, 33.29741076120791 ], [ 230, 33.273163681933944 ], [ 240, 33.314812325666004 ], [ 250, 33.30345585560092 ], [ 260, 33.27374176335044 ], [ 270, 33.21201237013381 ], [ 280, 33.18726856530703 ], [ 290, 33.22221975178882 ], [ 300, 31.346883716699683 ], [ 310, 30.887264922398163 ], [ 320, 31.428557856543666 ], [ 330, 31.6614833793194 ], [ 340, 31.633464151826598 ], [ 350, 32.08665754443788 ], [ 360, 32.037253226714675 ], [ 370, 31.71652175669982 ], [ 380, 32.16834402486147 ], [ 390, 32.22998306371103 ], [ 400, 32.21588073216791 ], [ 410, 32.430079195487 ], [ 420, 32.470842494567066 ], [ 430, 32.3075969230957 ], [ 440, 31.879211522954535 ], [ 450, 32.36636488776118 ], [ 460, 32.00953691648247 ], [ 470, 34.0 ], [ 480, 34.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVFS1", "pairs": [ [ 1, 32.20383158309822 ], [ 2, 33.100817297987504 ], [ 3, 33.635595885813004 ], [ 4, 33.343129016660484 ], [ 5, 33.15968998070595 ], [ 6, 33.13889371370629 ], [ 7, 33.540214722630374 ], [ 8, 33.506551058825735 ], [ 9, 33.39220445124613 ], [ 10, 33.313883268628615 ], [ 20, 33.45929471080045 ], [ 30, 33.50719137729499 ], [ 40, 33.6387862115586 ], [ 50, 33.48681666893564 ], [ 60, 33.45998432064745 ], [ 70, 33.47033926551153 ], [ 80, 33.62238110215521 ], [ 90, 33.45178270482915 ], [ 100, 33.45496176397411 ], [ 110, 33.23410728620452 ], [ 120, 33.31103939085246 ], [ 130, 33.277289819218005 ], [ 140, 33.15601847722503 ], [ 150, 33.07447410794342 ], [ 160, 33.118154718593175 ], [ 170, 33.0743487670114 ], [ 180, 33.211004652167176 ], [ 190, 33.26715363418286 ], [ 200, 33.25470028495111 ], [ 210, 33.24756946563451 ], [ 220, 33.39020134354213 ], [ 230, 33.389854426130995 ], [ 240, 33.431079387284704 ], [ 250, 33.39222229003046 ], [ 260, 33.38300386350514 ], [ 270, 33.3343626624855 ], [ 280, 33.289121158206534 ], [ 290, 33.335770987564494 ], [ 300, 31.969490045488904 ], [ 310, 31.63879699632535 ], [ 320, 32.041455387890494 ], [ 330, 32.31948522064495 ], [ 340, 32.236042530207406 ], [ 350, 32.58124225714991 ], [ 360, 32.532570031126376 ], [ 370, 32.28748687944082 ], [ 380, 32.686640124355065 ], [ 390, 32.764227065620744 ], [ 400, 32.83469193131107 ], [ 410, 32.98443608102612 ], [ 420, 32.96283947438799 ], [ 430, 32.9139704744123 ], [ 440, 32.55576162536788 ], [ 450, 33.03052183408734 ], [ 460, 32.80484578224825 ], [ 470, 31.45 ], [ 480, 28.7 ], [ 490, 34.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVFS2", "pairs": [ [ 1, 32.26157003796069 ], [ 2, 33.11947153945022 ], [ 3, 33.6300327796985 ], [ 4, 33.37262745723196 ], [ 5, 33.19231918857792 ], [ 6, 33.16299680173762 ], [ 7, 33.56283937947732 ], [ 8, 33.50814012573854 ], [ 9, 33.40233343628882 ], [ 10, 33.32687935277532 ], [ 20, 33.440597507148766 ], [ 30, 33.50615192244463 ], [ 40, 33.63709486185699 ], [ 50, 33.47737403728316 ], [ 60, 33.46604561260175 ], [ 70, 33.479486783504534 ], [ 80, 33.61946605956141 ], [ 90, 33.450430420357286 ], [ 100, 33.46423675112338 ], [ 110, 33.25727978319567 ], [ 120, 33.30711239750117 ], [ 130, 33.28718154373449 ], [ 140, 33.14764165512569 ], [ 150, 33.08309803022906 ], [ 160, 33.12123705998984 ], [ 170, 33.074774577301305 ], [ 180, 33.21090248786952 ], [ 190, 33.26258630824872 ], [ 200, 33.257217511731945 ], [ 210, 33.252944692976776 ], [ 220, 33.38969830721253 ], [ 230, 33.39067073839011 ], [ 240, 33.43544840435601 ], [ 250, 33.40467434515328 ], [ 260, 33.38778482967509 ], [ 270, 33.34422220450945 ], [ 280, 33.306305857502956 ], [ 290, 33.35282812079667 ], [ 300, 32.045987725049066 ], [ 310, 31.690522165210336 ], [ 320, 32.1021903999357 ], [ 330, 32.37604565768692 ], [ 340, 32.27835877429189 ], [ 350, 32.596434277504734 ], [ 360, 32.53791678917233 ], [ 370, 32.33338362482861 ], [ 380, 32.69536626610838 ], [ 390, 32.76705623196496 ], [ 400, 32.8112065671305 ], [ 410, 32.993210560685256 ], [ 420, 32.99888480039082 ], [ 430, 32.9564800776866 ], [ 440, 32.64561366944451 ], [ 450, 33.04718925301986 ], [ 460, 32.43824740535452 ], [ 470, 32.25 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVMS1", "pairs": [ [ 1, 32.22806180579331 ], [ 2, 33.117813785632904 ], [ 3, 33.63570390243081 ], [ 4, 33.29631084744431 ], [ 5, 33.29192741804222 ], [ 6, 33.14624153201138 ], [ 7, 33.553546873509156 ], [ 8, 33.49464278698554 ], [ 9, 33.49683730797941 ], [ 10, 33.39321550645167 ], [ 20, 33.42828687047836 ], [ 30, 33.501714644919765 ], [ 40, 33.62615296540964 ], [ 50, 33.4905158527482 ], [ 60, 33.44656088813555 ], [ 70, 33.47897244781698 ], [ 80, 33.623191203955756 ], [ 90, 33.48143693418121 ], [ 100, 33.47835899220412 ], [ 110, 33.23888006465698 ], [ 120, 33.255261518428924 ], [ 130, 33.3083431085867 ], [ 140, 33.12147712029455 ], [ 150, 33.035660685521215 ], [ 160, 33.05451672831157 ], [ 170, 33.03870831953572 ], [ 180, 33.11617827817098 ], [ 190, 33.14939973396344 ], [ 200, 33.1827177262293 ], [ 210, 33.1808723080636 ], [ 220, 33.34075635204382 ], [ 230, 33.32355658328236 ], [ 240, 33.38559922770821 ], [ 250, 33.36681221972151 ], [ 260, 33.3381307844711 ], [ 270, 33.29886625769626 ], [ 280, 33.27925812842718 ], [ 290, 33.32555578629518 ], [ 300, 31.95450438062311 ], [ 310, 31.61932359404424 ], [ 320, 32.04849265551944 ], [ 330, 32.31343625779523 ], [ 340, 32.0783154285971 ], [ 350, 32.49222179178386 ], [ 360, 32.585603521360035 ], [ 370, 32.36568848389618 ], [ 380, 32.66261445773235 ], [ 390, 32.7270276829694 ], [ 400, 32.70470145644289 ], [ 410, 32.92284724579969 ], [ 420, 32.93462014844034 ], [ 430, 32.87306076053501 ], [ 440, 32.52864830710335 ], [ 450, 32.75172885879046 ], [ 460, 32.51978775783465 ], [ 470, 34.0 ], [ 480, 34.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVMS2", "pairs": [ [ 1, 32.28747687169999 ], [ 2, 33.15006092332686 ], [ 3, 33.645114851753235 ], [ 4, 33.35805316124374 ], [ 5, 33.305478586578815 ], [ 6, 33.164623854867095 ], [ 7, 33.5675120718444 ], [ 8, 33.50917008890293 ], [ 9, 33.49756757976443 ], [ 10, 33.41678369962544 ], [ 20, 33.44394422130963 ], [ 30, 33.50845345006543 ], [ 40, 33.6401331287513 ], [ 50, 33.493396813935654 ], [ 60, 33.46678008935421 ], [ 70, 33.487758472855276 ], [ 80, 33.62579809558193 ], [ 90, 33.48581298795072 ], [ 100, 33.48981497359989 ], [ 110, 33.273196443882846 ], [ 120, 33.26708154700122 ], [ 130, 33.309015749808204 ], [ 140, 33.12683288957082 ], [ 150, 33.047971027573446 ], [ 160, 33.075677151496 ], [ 170, 33.06222528092423 ], [ 180, 33.151608375829234 ], [ 190, 33.182379168735054 ], [ 200, 33.21221038855545 ], [ 210, 33.20814522315989 ], [ 220, 33.349635813890515 ], [ 230, 33.34465454217248 ], [ 240, 33.395978157859105 ], [ 250, 33.38582607518389 ], [ 260, 33.35311882305158 ], [ 270, 33.31677061239226 ], [ 280, 33.29768987770206 ], [ 290, 33.34584863937903 ], [ 300, 32.01227266573402 ], [ 310, 31.67192537278445 ], [ 320, 32.096831070542414 ], [ 330, 32.36086238486253 ], [ 340, 32.130794291962516 ], [ 350, 32.533575817480155 ], [ 360, 32.577563799783775 ], [ 370, 32.3680756987139 ], [ 380, 32.649732639990404 ], [ 390, 32.73298782893378 ], [ 400, 32.698822733460744 ], [ 410, 32.930638308895055 ], [ 420, 32.95715197439959 ], [ 430, 32.91046838823424 ], [ 440, 32.63679083247936 ], [ 450, 32.87333012146849 ], [ 460, 32.199804016321664 ], [ 470, 30.875 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAFS1", "pairs": [ [ 1, 39.67256069628951 ], [ 2, 39.1430600091617 ], [ 3, 39.20403114979386 ], [ 4, 39.22143838754008 ], [ 5, 39.30004580852039 ], [ 6, 39.39331195602382 ], [ 7, 39.32959230416858 ], [ 8, 39.41232249198351 ], [ 9, 39.077508016491066 ], [ 10, 39.554851122308754 ], [ 20, 39.54857993586807 ], [ 30, 39.57590929912964 ], [ 40, 39.55754008245534 ], [ 50, 39.49245991754466 ], [ 60, 39.49985799358681 ], [ 70, 39.45279202931745 ], [ 80, 39.5262620247366 ], [ 90, 39.421103985341276 ], [ 100, 39.35539624370133 ], [ 110, 39.379106733852495 ], [ 120, 39.329372423270726 ], [ 130, 39.284839670178656 ], [ 140, 39.389711406321574 ], [ 150, 39.44947091158956 ], [ 160, 39.591362803481445 ], [ 170, 39.71204306000916 ], [ 180, 39.73984883188274 ], [ 190, 39.69821117727897 ], [ 200, 39.75615208428768 ], [ 210, 39.69350206138343 ], [ 220, 39.72105359596885 ], [ 230, 39.727329363261575 ], [ 240, 39.755700870361885 ], [ 250, 39.724956481905636 ], [ 260, 39.74009619789281 ], [ 270, 39.70183921209345 ], [ 280, 39.71796152084287 ], [ 290, 39.72772789738891 ], [ 300, 38.86646816307833 ], [ 310, 39.049857616282154 ], [ 320, 38.72231864898705 ], [ 330, 38.99367133547877 ], [ 340, 38.98668905787114 ], [ 350, 39.14695621299064 ], [ 360, 38.87174610077015 ], [ 370, 38.754524426519005 ], [ 380, 39.13714322799295 ], [ 390, 39.13154353075218 ], [ 400, 39.22389489755291 ], [ 410, 39.27119507158436 ], [ 420, 39.333726054131944 ], [ 430, 39.25704247339836 ], [ 440, 39.131064862078475 ], [ 450, 39.207823054222416 ], [ 460, 38.80595666295457 ], [ 470, 39.238095238095234 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAFS2", "pairs": [ [ 1, 39.65753124314843 ], [ 2, 39.04807059855295 ], [ 3, 39.193488270116205 ], [ 4, 39.06314404735804 ], [ 5, 39.21760578820434 ], [ 6, 39.310348607761455 ], [ 7, 39.336110502082875 ], [ 8, 39.43926770445078 ], [ 9, 38.99912299934225 ], [ 10, 39.556807717605786 ], [ 20, 39.53783161587371 ], [ 30, 39.57412848059637 ], [ 40, 39.558068406051305 ], [ 50, 39.47854637140978 ], [ 60, 39.49015566761675 ], [ 70, 39.44791712343785 ], [ 80, 39.512628809471614 ], [ 90, 39.44302236351676 ], [ 100, 39.35302565226923 ], [ 110, 39.36915698311773 ], [ 120, 39.308112256084186 ], [ 130, 39.27309252356939 ], [ 140, 39.42667178250384 ], [ 150, 39.48268471826354 ], [ 160, 39.622133304099975 ], [ 170, 39.71755097566323 ], [ 180, 39.75428085946065 ], [ 190, 39.70339837754878 ], [ 200, 39.76108309581232 ], [ 210, 39.71012935759702 ], [ 220, 39.72404626178469 ], [ 230, 39.735441789081335 ], [ 240, 39.77191953518965 ], [ 250, 39.74883797412848 ], [ 260, 39.751754001315504 ], [ 270, 39.7138785354089 ], [ 280, 39.72931374698531 ], [ 290, 39.72363516772637 ], [ 300, 39.00283380837536 ], [ 310, 39.04405832054375 ], [ 320, 38.77901131101185 ], [ 330, 39.08347630662975 ], [ 340, 38.931640360835274 ], [ 350, 39.204331021627695 ], [ 360, 38.866931899242275 ], [ 370, 38.800690922051935 ], [ 380, 39.09015762894213 ], [ 390, 39.11446354637932 ], [ 400, 39.24198238298899 ], [ 410, 39.243785295695055 ], [ 420, 39.30955060449029 ], [ 430, 39.15600179608097 ], [ 440, 39.13029752735625 ], [ 450, 39.25311700509377 ], [ 460, 38.78518468707742 ], [ 470, 40.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAMS1", "pairs": [ [ 1, 39.56226537742748 ], [ 2, 39.02917039083449 ], [ 3, 39.08624360120257 ], [ 4, 38.92867473795401 ], [ 5, 39.01766474364183 ], [ 6, 39.24244738766556 ], [ 7, 39.31167628179085 ], [ 8, 39.4525392053303 ], [ 9, 38.8924677013082 ], [ 10, 39.56089380027627 ], [ 20, 39.622354757455106 ], [ 30, 39.533819777362474 ], [ 40, 39.49187291785163 ], [ 50, 39.50983992849598 ], [ 60, 39.52411473145365 ], [ 70, 39.319954497440484 ], [ 80, 39.63397741122938 ], [ 90, 39.35969123263184 ], [ 100, 39.29220118631673 ], [ 110, 39.145952709839925 ], [ 120, 39.13642642398635 ], [ 130, 39.221688469976435 ], [ 140, 39.29235069472658 ], [ 150, 39.19018444787518 ], [ 160, 39.52580807670431 ], [ 170, 39.74108718615422 ], [ 180, 39.749254895587875 ], [ 190, 39.71531648655237 ], [ 200, 39.71900219387341 ], [ 210, 39.67656455675632 ], [ 220, 39.744265864954905 ], [ 230, 39.76183635329487 ], [ 240, 39.79723409441782 ], [ 250, 39.75388965629317 ], [ 260, 39.80676038027139 ], [ 270, 39.77407329162265 ], [ 280, 39.74338831559275 ], [ 290, 39.78981067685057 ], [ 300, 39.04670837734623 ], [ 310, 38.91124075729259 ], [ 320, 39.038621922483145 ], [ 330, 39.01400503778338 ], [ 340, 38.89047175138315 ], [ 350, 39.27243884599756 ], [ 360, 39.072914535606756 ], [ 370, 39.041469321406296 ], [ 380, 39.06306652266178 ], [ 390, 38.75612779906493 ], [ 400, 39.03118192163876 ], [ 410, 39.20319805617914 ], [ 420, 39.319427220752424 ], [ 430, 38.977904797714906 ], [ 440, 39.28592496268048 ], [ 450, 39.18813362898689 ], [ 460, 39.18112040362973 ], [ 470, 36.42666666666666 ], [ 480, 35.4 ], [ 490, 40.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAMS2", "pairs": [ [ 1, 39.634802445244716 ], [ 2, 38.67510797267683 ], [ 3, 39.14964948929244 ], [ 4, 38.90866216406721 ], [ 5, 39.25294441810096 ], [ 6, 39.26658037396353 ], [ 7, 39.31604916120929 ], [ 8, 39.39514795781056 ], [ 9, 39.003139858257825 ], [ 10, 39.5988414563816 ], [ 20, 39.636540260672305 ], [ 30, 39.47454920606442 ], [ 40, 39.489466736726094 ], [ 50, 39.54444116930885 ], [ 60, 39.5463840367043 ], [ 70, 39.312040395237666 ], [ 80, 39.684958156582816 ], [ 90, 39.34343897781594 ], [ 100, 39.29693831780492 ], [ 110, 39.126122339130326 ], [ 120, 39.14353381435107 ], [ 130, 39.204659805969584 ], [ 140, 39.26635225364929 ], [ 150, 39.1275987132989 ], [ 160, 39.49444693639545 ], [ 170, 39.74876776583066 ], [ 180, 39.745025567417244 ], [ 190, 39.71883530482256 ], [ 200, 39.70060618487999 ], [ 210, 39.67291904291994 ], [ 220, 39.740040241448696 ], [ 230, 39.76008407130682 ], [ 240, 39.800138410078304 ], [ 250, 39.74724525496931 ], [ 260, 39.80545438234502 ], [ 270, 39.77654205487703 ], [ 280, 39.73668507862461 ], [ 290, 39.79125965987005 ], [ 300, 39.012080124056446 ], [ 310, 38.88812108318702 ], [ 320, 38.9992818176893 ], [ 330, 38.969021376941605 ], [ 340, 38.87559039856079 ], [ 350, 39.268530124187784 ], [ 360, 39.03433138888096 ], [ 370, 39.02951721803219 ], [ 380, 39.05204571908909 ], [ 390, 38.655088359158825 ], [ 400, 38.951827465320584 ], [ 410, 39.21312921506783 ], [ 420, 39.32320723128113 ], [ 430, 38.92573371553825 ], [ 440, 39.25366769797441 ], [ 450, 39.178736988962825 ], [ 460, 38.900813646478596 ], [ 470, 40.0 ], [ 480, 40.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCFS1", "pairs": [ [ 1, 32.307771628914175 ], [ 2, 33.131010896091844 ], [ 3, 33.60558381741313 ], [ 4, 33.45332210497371 ], [ 5, 33.284226446224174 ], [ 6, 33.129928161413396 ], [ 7, 33.56090812222872 ], [ 8, 33.49657993331729 ], [ 9, 33.47033650706356 ], [ 10, 33.41566785824769 ], [ 20, 33.72013284982641 ], [ 30, 33.635613377788474 ], [ 40, 33.57010707042931 ], [ 50, 33.53669439384045 ], [ 60, 33.48849465507166 ], [ 70, 33.536443474375275 ], [ 80, 33.6587280445468 ], [ 90, 33.29371326435913 ], [ 100, 33.44056302203279 ], [ 110, 33.256938095074425 ], [ 120, 33.37765098133572 ], [ 130, 33.23416457567112 ], [ 140, 33.39463101089609 ], [ 150, 33.181156979342106 ], [ 160, 33.21312257244011 ], [ 170, 33.02161688378648 ], [ 180, 33.011360120991306 ], [ 190, 33.07620905372427 ], [ 200, 33.171573918124636 ], [ 210, 33.21679441790121 ], [ 220, 33.25767882308459 ], [ 230, 33.324664867837626 ], [ 240, 33.31205444608669 ], [ 250, 33.23410786099749 ], [ 260, 33.39321572199498 ], [ 270, 33.358737496992404 ], [ 280, 33.31651342247276 ], [ 290, 33.264171793902314 ], [ 300, 31.581513834562326 ], [ 310, 31.18204887856168 ], [ 320, 31.598810386921578 ], [ 330, 31.842078139839963 ], [ 340, 31.89754459650328 ], [ 350, 32.13382398045202 ], [ 360, 31.921159276061918 ], [ 370, 32.1639559624186 ], [ 380, 32.432967507722914 ], [ 390, 32.193640313740744 ], [ 400, 32.566650269460204 ], [ 410, 32.89425359389311 ], [ 420, 32.81640829284315 ], [ 430, 32.77242155989792 ], [ 440, 33.01500782151823 ], [ 450, 32.988963305261315 ], [ 460, 32.324440398832856 ], [ 470, 31.54083333333333 ], [ 480, 31.776190476190475 ], [ 490, 27.75 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCFS2", "pairs": [ [ 1, 32.26065854147085 ], [ 2, 33.1275635198225 ], [ 3, 33.588604181753745 ], [ 4, 33.434908553026915 ], [ 5, 33.28044252014607 ], [ 6, 33.080168256267235 ], [ 7, 33.5128426372475 ], [ 8, 33.500223417204666 ], [ 9, 33.44637216683872 ], [ 10, 33.41191507064606 ], [ 20, 33.71595352922143 ], [ 30, 33.619471194588684 ], [ 40, 33.53476833947089 ], [ 50, 33.51948043943854 ], [ 60, 33.46966148441472 ], [ 70, 33.53242014760943 ], [ 80, 33.65129042695798 ], [ 90, 33.26130105853531 ], [ 100, 33.426922543566356 ], [ 110, 33.258302645567866 ], [ 120, 33.39541763609189 ], [ 130, 33.23796859832668 ], [ 140, 33.40724025823947 ], [ 150, 33.16700050846674 ], [ 160, 33.2355017642255 ], [ 170, 33.04613488235928 ], [ 180, 33.059230212169304 ], [ 190, 33.09484445540131 ], [ 200, 33.18962265604536 ], [ 210, 33.24046624859402 ], [ 220, 33.267478159042234 ], [ 230, 33.33770666091432 ], [ 240, 33.323737692793635 ], [ 250, 33.24727508050724 ], [ 260, 33.39361951279641 ], [ 270, 33.362515215482034 ], [ 280, 33.33516432720605 ], [ 290, 33.27265373414893 ], [ 300, 31.71652516896238 ], [ 310, 31.305639323191635 ], [ 320, 31.76157226658854 ], [ 330, 31.947838401062047 ], [ 340, 31.972732818468785 ], [ 350, 32.18718716069293 ], [ 360, 31.978128929025097 ], [ 370, 32.22839788869961 ], [ 380, 32.492484303701715 ], [ 390, 32.251878962443385 ], [ 400, 32.63933529581819 ], [ 410, 32.94139426279601 ], [ 420, 32.85593403014012 ], [ 430, 32.839707165985814 ], [ 440, 32.998993416634065 ], [ 450, 32.989010184365554 ], [ 460, 32.34470424508398 ], [ 470, 32.46241471571906 ], [ 480, 32.77970760233918 ], [ 490, 33.160000000000004 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCMS1", "pairs": [ [ 1, 32.269397937734965 ], [ 2, 33.09393276273593 ], [ 3, 33.60264063154169 ], [ 4, 33.45202795150354 ], [ 5, 33.252724581007996 ], [ 6, 33.10188314406937 ], [ 7, 33.534617824910335 ], [ 8, 33.47260744021028 ], [ 9, 33.43243686525355 ], [ 10, 33.38698157427909 ], [ 20, 33.69148247420011 ], [ 30, 33.613150932076465 ], [ 40, 33.57121418120137 ], [ 50, 33.51469353049588 ], [ 60, 33.47808595216823 ], [ 70, 33.51830616305619 ], [ 80, 33.64515574891987 ], [ 90, 33.32015089323095 ], [ 100, 33.40589933833145 ], [ 110, 33.216514953363806 ], [ 120, 33.323341404567365 ], [ 130, 33.18008002175348 ], [ 140, 33.363198194115334 ], [ 150, 33.15186307388848 ], [ 160, 33.19063607366835 ], [ 170, 33.012400350472845 ], [ 180, 33.002075213542405 ], [ 190, 33.03692093211963 ], [ 200, 33.14194063542625 ], [ 210, 33.179066585522705 ], [ 220, 33.207965919538 ], [ 230, 33.30889432726048 ], [ 240, 33.309942724451524 ], [ 250, 33.24305550160346 ], [ 260, 33.38795918631602 ], [ 270, 33.347475257567325 ], [ 280, 33.308553349993744 ], [ 290, 33.25014480743416 ], [ 300, 31.60064850532393 ], [ 310, 31.216469373473917 ], [ 320, 31.665253406888457 ], [ 330, 31.8123187561242 ], [ 340, 31.934809840779913 ], [ 350, 32.16688135651753 ], [ 360, 32.02194625175012 ], [ 370, 32.30440113104104 ], [ 380, 32.4952581223567 ], [ 390, 32.278778459864796 ], [ 400, 32.55697793535525 ], [ 410, 32.884156832394254 ], [ 420, 32.7541374903945 ], [ 430, 32.723545212640275 ], [ 440, 32.97339641364528 ], [ 450, 32.987786253088245 ], [ 460, 32.20295550602807 ], [ 470, 31.27182908736617 ], [ 480, 32.25 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCMS2", "pairs": [ [ 1, 32.185753768260675 ], [ 2, 33.08607195113454 ], [ 3, 33.59980955477623 ], [ 4, 33.43617762500871 ], [ 5, 33.26611236268202 ], [ 6, 33.073193673502566 ], [ 7, 33.525292054718165 ], [ 8, 33.47913231298047 ], [ 9, 33.432809996051745 ], [ 10, 33.39483823768493 ], [ 20, 33.69018045846204 ], [ 30, 33.610018115521285 ], [ 40, 33.56056506491395 ], [ 50, 33.52017790370903 ], [ 60, 33.47265253036672 ], [ 70, 33.52209629096315 ], [ 80, 33.64426457951089 ], [ 90, 33.31725967903013 ], [ 100, 33.40231321271802 ], [ 110, 33.22525953967995 ], [ 120, 33.33027382307174 ], [ 130, 33.183948022388925 ], [ 140, 33.37654388368907 ], [ 150, 33.14102120444991 ], [ 160, 33.20854564879114 ], [ 170, 33.04111758831316 ], [ 180, 33.06370857235757 ], [ 190, 33.082179436560835 ], [ 200, 33.17640801727942 ], [ 210, 33.208299463501874 ], [ 220, 33.24198155932833 ], [ 230, 33.332930766193655 ], [ 240, 33.333877186055695 ], [ 250, 33.27415635088371 ], [ 260, 33.41116543186938 ], [ 270, 33.374618528926774 ], [ 280, 33.343420349768905 ], [ 290, 33.286123046194575 ], [ 300, 31.780085417502715 ], [ 310, 31.381340034882122 ], [ 320, 31.86409245373115 ], [ 330, 31.94920288415774 ], [ 340, 32.06038448194837 ], [ 350, 32.25675347269304 ], [ 360, 32.13068947307765 ], [ 370, 32.40202659048261 ], [ 380, 32.58667533060891 ], [ 390, 32.36366509827327 ], [ 400, 32.64141801896121 ], [ 410, 32.9590235735727 ], [ 420, 32.83155578161485 ], [ 430, 32.82096393572023 ], [ 440, 32.97853164683327 ], [ 450, 33.00976619790869 ], [ 460, 31.90736746641794 ], [ 470, 31.11252114449018 ], [ 480, 32.60444444444445 ], [ 490, 33.09222222222222 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPFS1", "pairs": [ [ 1, 32.23921865024913 ], [ 2, 33.09909962796363 ], [ 3, 33.628411250614555 ], [ 4, 33.408183332477236 ], [ 5, 33.228754668799574 ], [ 6, 33.104683842467914 ], [ 7, 33.52909148278873 ], [ 8, 33.47838593453041 ], [ 9, 33.43476888983467 ], [ 10, 33.410436097067006 ], [ 20, 33.69580413422661 ], [ 30, 33.607269752049135 ], [ 40, 33.54153378779985 ], [ 50, 33.54332352487947 ], [ 60, 33.479903431980446 ], [ 70, 33.49737226384496 ], [ 80, 33.636188058146274 ], [ 90, 33.28761493135305 ], [ 100, 33.43055467907277 ], [ 110, 33.265363927882184 ], [ 120, 33.32679909302377 ], [ 130, 33.19290489224154 ], [ 140, 33.37082779926179 ], [ 150, 33.14177080505148 ], [ 160, 33.21400162903498 ], [ 170, 33.02279768412865 ], [ 180, 33.070105006714265 ], [ 190, 33.0883758814767 ], [ 200, 33.177787887904785 ], [ 210, 33.22271843377826 ], [ 220, 33.269675000183454 ], [ 230, 33.32835915084716 ], [ 240, 33.31678713209126 ], [ 250, 33.27140970229753 ], [ 260, 33.42817643476155 ], [ 270, 33.37193583656817 ], [ 280, 33.33760062226201 ], [ 290, 33.296214328169825 ], [ 300, 31.71393760295735 ], [ 310, 31.30646111281637 ], [ 320, 31.75875105485232 ], [ 330, 31.92228519413795 ], [ 340, 31.982560014334656 ], [ 350, 32.20354218034519 ], [ 360, 31.953728740096004 ], [ 370, 32.18762448378588 ], [ 380, 32.52656044738329 ], [ 390, 32.30092617735342 ], [ 400, 32.63094988220961 ], [ 410, 32.92281463976691 ], [ 420, 32.856393879704186 ], [ 430, 32.82651019731329 ], [ 440, 33.06153382367787 ], [ 450, 33.028922331878 ], [ 460, 32.521572559116635 ], [ 470, 31.917676767676767 ], [ 480, 33.5 ], [ 490, 34.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPFS2", "pairs": [ [ 1, 32.175557225144004 ], [ 2, 33.053860384705494 ], [ 3, 33.580313936485624 ], [ 4, 33.37370236623769 ], [ 5, 33.1787159787693 ], [ 6, 33.063918308653044 ], [ 7, 33.50725867041516 ], [ 8, 33.4557653312652 ], [ 9, 33.40938577995363 ], [ 10, 33.3848549477715 ], [ 20, 33.68860344312224 ], [ 30, 33.5965496069735 ], [ 40, 33.53671667353352 ], [ 50, 33.538689480784925 ], [ 60, 33.47573737912314 ], [ 70, 33.47754538183757 ], [ 80, 33.62966077732807 ], [ 90, 33.26537004273608 ], [ 100, 33.42128644482683 ], [ 110, 33.242087362561904 ], [ 120, 33.33027071568794 ], [ 130, 33.181073329940304 ], [ 140, 33.371417722950646 ], [ 150, 33.13502500343342 ], [ 160, 33.20358369081376 ], [ 170, 32.99176865967055 ], [ 180, 33.02736805538725 ], [ 190, 33.05154827399562 ], [ 200, 33.141436223067785 ], [ 210, 33.18686895615715 ], [ 220, 33.24564762527973 ], [ 230, 33.29732273413958 ], [ 240, 33.29783815225031 ], [ 250, 33.24518956561079 ], [ 260, 33.411881276104154 ], [ 270, 33.34943166670705 ], [ 280, 33.31998093437709 ], [ 290, 33.272408973768606 ], [ 300, 31.629388975316733 ], [ 310, 31.216831402927255 ], [ 320, 31.664183288729465 ], [ 330, 31.849195352792606 ], [ 340, 31.90872621590006 ], [ 350, 32.12397188619709 ], [ 360, 31.871170323892063 ], [ 370, 32.13205894988833 ], [ 380, 32.4493585281454 ], [ 390, 32.226693579824186 ], [ 400, 32.55465933208647 ], [ 410, 32.851078310273586 ], [ 420, 32.782268324657934 ], [ 430, 32.76134837602342 ], [ 440, 33.006267812446055 ], [ 450, 32.96072395528494 ], [ 460, 32.65253888696903 ], [ 470, 32.94742807340972 ], [ 480, 32.01937399556965 ], [ 490, 32.179487179487175 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPMS1", "pairs": [ [ 1, 32.652105375991525 ], [ 2, 33.4668146335927 ], [ 3, 33.64347957678096 ], [ 4, 32.6981600817181 ], [ 5, 32.832641840170496 ], [ 6, 33.42500977338361 ], [ 7, 32.57502805906907 ], [ 8, 33.572934663354225 ], [ 9, 33.68652029711086 ], [ 10, 33.40324854660328 ], [ 20, 33.55979923578447 ], [ 30, 33.63398489224057 ], [ 40, 33.71003316645018 ], [ 50, 33.65485453421945 ], [ 60, 33.5812111429184 ], [ 70, 33.646710468239654 ], [ 80, 33.7859011059687 ], [ 90, 33.352000706205786 ], [ 100, 33.648840435325425 ], [ 110, 33.4665170182983 ], [ 120, 33.62861142287855 ], [ 130, 33.437350719447146 ], [ 140, 33.5935558722272 ], [ 150, 33.370478076093676 ], [ 160, 33.52863160018664 ], [ 170, 33.45608787217675 ], [ 180, 33.52683329760268 ], [ 190, 33.556644009231114 ], [ 200, 33.563548431844836 ], [ 210, 33.63361161204081 ], [ 220, 33.592587361438646 ], [ 230, 33.66851078855443 ], [ 240, 33.71862491645334 ], [ 250, 33.721124380493585 ], [ 260, 33.70786284474823 ], [ 270, 33.69174748098919 ], [ 280, 33.67429663165063 ], [ 290, 33.66077279090003 ], [ 300, 32.44180359912733 ], [ 310, 31.971014251195044 ], [ 320, 32.56668841192942 ], [ 330, 32.530544447014975 ], [ 340, 32.65405760568927 ], [ 350, 32.60752279922804 ], [ 360, 32.536285559767336 ], [ 370, 32.655678467012976 ], [ 380, 32.85211974032108 ], [ 390, 32.55639576581831 ], [ 400, 32.81596268499342 ], [ 410, 33.00628559745449 ], [ 420, 33.09065526692492 ], [ 430, 32.86372141439061 ], [ 440, 33.075638719448186 ], [ 450, 33.307501945367065 ], [ 460, 32.92624843628745 ], [ 470, 32.30654761904762 ], [ 480, 31.4 ], [ 490, 34.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPMS2", "pairs": [ [ 1, 32.10388266576829 ], [ 2, 33.07196226823722 ], [ 3, 33.56061025351028 ], [ 4, 33.328781297751256 ], [ 5, 33.249359306005076 ], [ 6, 33.04208727876505 ], [ 7, 33.49694993562981 ], [ 8, 33.45054323631682 ], [ 9, 33.45707651029321 ], [ 10, 33.3889656251128 ], [ 20, 33.60434709371579 ], [ 30, 33.5476844777592 ], [ 40, 33.559405869117946 ], [ 50, 33.512048656648176 ], [ 60, 33.461180561404355 ], [ 70, 33.46513662122652 ], [ 80, 33.61253474185748 ], [ 90, 33.320724796361574 ], [ 100, 33.41814998856977 ], [ 110, 33.185887887574744 ], [ 120, 33.28643653820702 ], [ 130, 33.190111053625785 ], [ 140, 33.249459170045604 ], [ 150, 33.08663145356322 ], [ 160, 33.11622008590714 ], [ 170, 32.96390095412271 ], [ 180, 33.01985128680231 ], [ 190, 33.04536594756537 ], [ 200, 33.11122447751856 ], [ 210, 33.15565074055804 ], [ 220, 33.234202832288574 ], [ 230, 33.288783944749916 ], [ 240, 33.30004090816117 ], [ 250, 33.257095761192595 ], [ 260, 33.35843249551815 ], [ 270, 33.31309301793944 ], [ 280, 33.27540938240709 ], [ 290, 33.26829858144935 ], [ 300, 31.60168344380626 ], [ 310, 31.276830733088378 ], [ 320, 31.68579995653195 ], [ 330, 31.875118218243507 ], [ 340, 31.92771765102048 ], [ 350, 32.19875919316483 ], [ 360, 32.076270659218586 ], [ 370, 32.214631475062575 ], [ 380, 32.488511250941784 ], [ 390, 32.324292924836705 ], [ 400, 32.55468581482346 ], [ 410, 32.82674609107767 ], [ 420, 32.804439244856695 ], [ 430, 32.76537478813517 ], [ 440, 32.88177036168008 ], [ 450, 32.913071649944854 ], [ 460, 32.633253457825255 ], [ 470, 33.8 ], [ 480, 33.53333333333334 ], [ 490, 27.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVFS1", "pairs": [ [ 1, 32.306324483604534 ], [ 2, 33.165899754684936 ], [ 3, 33.639270732025956 ], [ 4, 33.439113962636625 ], [ 5, 33.29719411824476 ], [ 6, 33.16108054753161 ], [ 7, 33.55873771610225 ], [ 8, 33.53591906054492 ], [ 9, 33.46540186671699 ], [ 10, 33.39678477595042 ], [ 20, 33.65551523421057 ], [ 30, 33.609394550812155 ], [ 40, 33.62632129015402 ], [ 50, 33.54459363342092 ], [ 60, 33.50282475214469 ], [ 70, 33.52889637253052 ], [ 80, 33.64458637557881 ], [ 90, 33.32704562279543 ], [ 100, 33.46419561336024 ], [ 110, 33.231480164317546 ], [ 120, 33.38936145505218 ], [ 130, 33.241851620676144 ], [ 140, 33.31896183826625 ], [ 150, 33.20322393346011 ], [ 160, 33.19521708205717 ], [ 170, 33.05976978124865 ], [ 180, 33.0649301069806 ], [ 190, 33.14191839282345 ], [ 200, 33.17666603765369 ], [ 210, 33.253076599265505 ], [ 220, 33.30230218751361 ], [ 230, 33.35781016388207 ], [ 240, 33.358083058744974 ], [ 250, 33.31157335501008 ], [ 260, 33.424653438039805 ], [ 270, 33.390091593967284 ], [ 280, 33.34586665892497 ], [ 290, 33.356492139757 ], [ 300, 31.650162985763625 ], [ 310, 31.33005340832394 ], [ 320, 31.73276483894823 ], [ 330, 31.975350100039627 ], [ 340, 31.990592108665016 ], [ 350, 32.265804681147635 ], [ 360, 32.08111375498968 ], [ 370, 32.18367493771588 ], [ 380, 32.4945108930699 ], [ 390, 32.25331958343621 ], [ 400, 32.60906935799363 ], [ 410, 32.90713632172432 ], [ 420, 32.8650816205181 ], [ 430, 32.780043283941396 ], [ 440, 32.979263081778754 ], [ 450, 32.99061578321168 ], [ 460, 32.006334399827004 ], [ 470, 32.03333333333334 ], [ 480, 34.0 ], [ 490, 34.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVFS2", "pairs": [ [ 1, 32.30785939555964 ], [ 2, 33.13371206583262 ], [ 3, 33.616689989348146 ], [ 4, 33.440642035130224 ], [ 5, 33.25781657929364 ], [ 6, 33.13788926251593 ], [ 7, 33.55999498736398 ], [ 8, 33.49623007999332 ], [ 9, 33.46568432924664 ], [ 10, 33.420127822218504 ], [ 20, 33.686576578458194 ], [ 30, 33.61642369305959 ], [ 40, 33.59013346143403 ], [ 50, 33.5299003738591 ], [ 60, 33.4864763257378 ], [ 70, 33.52355730069551 ], [ 80, 33.64614235886296 ], [ 90, 33.30880135341173 ], [ 100, 33.4411151026546 ], [ 110, 33.24577163265732 ], [ 120, 33.39919066814261 ], [ 130, 33.25434846174733 ], [ 140, 33.34124981724766 ], [ 150, 33.19607030222018 ], [ 160, 33.20242172977714 ], [ 170, 33.0448380291986 ], [ 180, 33.06776144029741 ], [ 190, 33.127024373942646 ], [ 200, 33.173363061049734 ], [ 210, 33.24712713298105 ], [ 220, 33.28938156603103 ], [ 230, 33.3444192652311 ], [ 240, 33.345718373399606 ], [ 250, 33.29210196537104 ], [ 260, 33.421050982685514 ], [ 270, 33.38376010359448 ], [ 280, 33.34529856513294 ], [ 290, 33.32517805300863 ], [ 300, 31.652607441791474 ], [ 310, 31.30795904471416 ], [ 320, 31.732944842839082 ], [ 330, 31.9333178673617 ], [ 340, 31.972455114660523 ], [ 350, 32.22035423773633 ], [ 360, 32.02711692049685 ], [ 370, 32.167787580700804 ], [ 380, 32.45234264700808 ], [ 390, 32.26437049691462 ], [ 400, 32.65035088636721 ], [ 410, 32.933300745831765 ], [ 420, 32.874093258178235 ], [ 430, 32.837172867520074 ], [ 440, 33.02938852115253 ], [ 450, 33.01701273668466 ], [ 460, 32.2889450035979 ], [ 470, 32.63040293040293 ], [ 480, 32.09444444444445 ], [ 490, 31.3 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVMS1", "pairs": [ [ 1, 32.269244667025895 ], [ 2, 33.13225775777362 ], [ 3, 33.62880598434182 ], [ 4, 33.420843766838885 ], [ 5, 33.250885923484105 ], [ 6, 33.15173222606105 ], [ 7, 33.54820121081492 ], [ 8, 33.51294177311484 ], [ 9, 33.43077752068211 ], [ 10, 33.3589819011696 ], [ 20, 33.52395892104346 ], [ 30, 33.55513899014232 ], [ 40, 33.63010364829313 ], [ 50, 33.48631145202701 ], [ 60, 33.47475355795746 ], [ 70, 33.49516117785033 ], [ 80, 33.63217154267964 ], [ 90, 33.40873308187265 ], [ 100, 33.465756759326766 ], [ 110, 33.23605629338489 ], [ 120, 33.3023373165552 ], [ 130, 33.275224571301784 ], [ 140, 33.20945957082633 ], [ 150, 33.11366826206853 ], [ 160, 33.12321024438175 ], [ 170, 33.05940790516339 ], [ 180, 33.1323135440109 ], [ 190, 33.19656914640718 ], [ 200, 33.20330977210054 ], [ 210, 33.248767314336426 ], [ 220, 33.327420837427496 ], [ 230, 33.36163555104757 ], [ 240, 33.39084725347872 ], [ 250, 33.358562870455486 ], [ 260, 33.380251038067776 ], [ 270, 33.34548670322356 ], [ 280, 33.304148467463314 ], [ 290, 33.33125360550255 ], [ 300, 31.781579328579692 ], [ 310, 31.447612388037346 ], [ 320, 31.895762859847604 ], [ 330, 32.050464314486575 ], [ 340, 32.046200537213004 ], [ 350, 32.36764753324597 ], [ 360, 32.30151254756259 ], [ 370, 32.231702447556025 ], [ 380, 32.54344138658738 ], [ 390, 32.47476304670549 ], [ 400, 32.619615072487946 ], [ 410, 32.86333667044278 ], [ 420, 32.811797542645756 ], [ 430, 32.75274237810923 ], [ 440, 32.77671561716035 ], [ 450, 32.976071069865604 ], [ 460, 32.33197073436067 ], [ 470, 32.83555555555556 ], [ 480, 21.5 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVMS2", "pairs": [ [ 1, 32.30393292802 ], [ 2, 33.13569968625102 ], [ 3, 33.63059638342468 ], [ 4, 33.445731842266284 ], [ 5, 33.267506802233996 ], [ 6, 33.14662231653496 ], [ 7, 33.57189538229206 ], [ 8, 33.51059716454246 ], [ 9, 33.44636324580475 ], [ 10, 33.39328238709594 ], [ 20, 33.59661059976826 ], [ 30, 33.58388033275617 ], [ 40, 33.62625011391301 ], [ 50, 33.50002929191673 ], [ 60, 33.487962975017254 ], [ 70, 33.50245010610183 ], [ 80, 33.637776808613125 ], [ 90, 33.38071875854347 ], [ 100, 33.45482795880905 ], [ 110, 33.22797703513727 ], [ 120, 33.36921875203416 ], [ 130, 33.25138778592166 ], [ 140, 33.274096181635926 ], [ 150, 33.18362256388893 ], [ 160, 33.19541353677112 ], [ 170, 33.08692408837045 ], [ 180, 33.11938213583638 ], [ 190, 33.18534753231875 ], [ 200, 33.207733066017475 ], [ 210, 33.275304310468286 ], [ 220, 33.31367802325128 ], [ 230, 33.37261791623814 ], [ 240, 33.381952273703675 ], [ 250, 33.347616288909435 ], [ 260, 33.41841615351568 ], [ 270, 33.382767239920334 ], [ 280, 33.339109265358736 ], [ 290, 33.343270019397764 ], [ 300, 31.813619116225293 ], [ 310, 31.494608097454478 ], [ 320, 31.907103103050975 ], [ 330, 32.05379756992658 ], [ 340, 32.10648406101721 ], [ 350, 32.3973370488772 ], [ 360, 32.28061845554343 ], [ 370, 32.34246480799031 ], [ 380, 32.5804082007035 ], [ 390, 32.44924210042636 ], [ 400, 32.68132934683027 ], [ 410, 32.94046485760603 ], [ 420, 32.86432712761001 ], [ 430, 32.83306871191143 ], [ 440, 32.931871566722144 ], [ 450, 33.04021361392593 ], [ 460, 32.43635875521887 ], [ 470, 31.117171717171722 ], [ 480, 32.6 ], [ 490, 34.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAFS1", "pairs": [ [ 1, 39.791444882306436 ], [ 2, 39.33004625565745 ], [ 3, 39.38862845438869 ], [ 4, 39.2632712648401 ], [ 5, 39.31646215814081 ], [ 6, 39.36492165175653 ], [ 7, 39.422171587944895 ], [ 8, 39.5256149263209 ], [ 9, 39.07356703957567 ], [ 10, 39.57105877519003 ], [ 20, 39.58186877836506 ], [ 30, 39.61432368999371 ], [ 40, 39.558147034470736 ], [ 50, 39.57000790641789 ], [ 60, 39.42702251772719 ], [ 70, 39.50632824707868 ], [ 80, 39.60535146206476 ], [ 90, 39.4927528652983 ], [ 100, 39.39516401147988 ], [ 110, 39.40503645045415 ], [ 120, 39.34922834606453 ], [ 130, 39.291255003766445 ], [ 140, 39.404052817361745 ], [ 150, 39.484845202298466 ], [ 160, 39.600728386530456 ], [ 170, 39.690267635358495 ], [ 180, 39.745278872432756 ], [ 190, 39.68326889914026 ], [ 200, 39.75179201763069 ], [ 210, 39.69710201769294 ], [ 220, 39.70885456548942 ], [ 230, 39.69542486101513 ], [ 240, 39.764021440711204 ], [ 250, 39.741744018826 ], [ 260, 39.739890057212584 ], [ 270, 39.70400612591749 ], [ 280, 39.731661157076246 ], [ 290, 39.727832458646944 ], [ 300, 38.8324212937888 ], [ 310, 38.83157586737139 ], [ 320, 38.80521201028457 ], [ 330, 39.02281904263863 ], [ 340, 38.952239010390414 ], [ 350, 39.2092073376205 ], [ 360, 38.37210209184467 ], [ 370, 38.845450244048216 ], [ 380, 39.115685661006935 ], [ 390, 39.16250824918131 ], [ 400, 39.252496248933824 ], [ 410, 39.278863909451445 ], [ 420, 39.3306412841993 ], [ 430, 39.211657075058966 ], [ 440, 39.19132129875713 ], [ 450, 39.2624216381332 ], [ 460, 38.779341854465784 ], [ 470, 36.22222222222222 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAFS2", "pairs": [ [ 1, 39.72069274601447 ], [ 2, 39.31512900953966 ], [ 3, 39.23849158076701 ], [ 4, 38.99673474614252 ], [ 5, 39.30626160445611 ], [ 6, 39.3416992124976 ], [ 7, 39.3859402010372 ], [ 8, 39.42797234137909 ], [ 9, 39.048754721813175 ], [ 10, 39.570327805877454 ], [ 20, 39.565039375120044 ], [ 30, 39.589000576221274 ], [ 40, 39.539157436455596 ], [ 50, 39.53083744157756 ], [ 60, 39.45171906011909 ], [ 70, 39.445390229848265 ], [ 80, 39.57353223637877 ], [ 90, 39.38715026570203 ], [ 100, 39.42768263012998 ], [ 110, 39.42038542800435 ], [ 120, 39.3609802164031 ], [ 130, 39.3030747807158 ], [ 140, 39.292669184967025 ], [ 150, 39.35837121454639 ], [ 160, 39.553298866764834 ], [ 170, 39.75448972405404 ], [ 180, 39.77783788974966 ], [ 190, 39.73473493821628 ], [ 200, 39.79450028811063 ], [ 210, 39.6955118765606 ], [ 220, 39.744516294257 ], [ 230, 39.769727575388956 ], [ 240, 39.78888693258211 ], [ 250, 39.73508707343619 ], [ 260, 39.76728023561048 ], [ 270, 39.6904683398425 ], [ 280, 39.741164607209164 ], [ 290, 39.76076733465651 ], [ 300, 39.00181349638261 ], [ 310, 39.01657116332672 ], [ 320, 38.483383360917344 ], [ 330, 38.91460492513066 ], [ 340, 39.114107129994956 ], [ 350, 39.20419684516331 ], [ 360, 38.45139903372002 ], [ 370, 38.61521420739662 ], [ 380, 38.96567409654635 ], [ 390, 39.27872578837842 ], [ 400, 39.18969001753091 ], [ 410, 39.29745633834382 ], [ 420, 39.49079063215355 ], [ 430, 39.341940610431294 ], [ 440, 39.151925971226795 ], [ 450, 39.24578403862181 ], [ 460, 38.66356336901304 ], [ 470, 40.0 ], [ 480, 40.0 ], [ 490, 40.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAMS1", "pairs": [ [ 1, 39.75849372724141 ], [ 2, 39.08496767350579 ], [ 3, 39.21297653711298 ], [ 4, 39.0988035481452 ], [ 5, 39.20151870342722 ], [ 6, 39.39303206977388 ], [ 7, 39.35255132717655 ], [ 8, 39.46721073361212 ], [ 9, 39.03446132643341 ], [ 10, 39.543999837860845 ], [ 20, 39.54170286648516 ], [ 30, 39.59006357206072 ], [ 40, 39.53103951466346 ], [ 50, 39.5262023631782 ], [ 60, 39.43609622958905 ], [ 70, 39.450350963714605 ], [ 80, 39.56233237175806 ], [ 90, 39.42131184088744 ], [ 100, 39.37685328433128 ], [ 110, 39.38713831145581 ], [ 120, 39.32409320299146 ], [ 130, 39.26240600995805 ], [ 140, 39.32532275825728 ], [ 150, 39.411726714452676 ], [ 160, 39.574354990170306 ], [ 170, 39.70920342383852 ], [ 180, 39.752590510805895 ], [ 190, 39.69132623073753 ], [ 200, 39.76451719688423 ], [ 210, 39.68645394910182 ], [ 220, 39.72139763952413 ], [ 230, 39.71656319035813 ], [ 240, 39.766983063214006 ], [ 250, 39.724456664932674 ], [ 260, 39.74326210470135 ], [ 270, 39.68505685004155 ], [ 280, 39.727661615581574 ], [ 290, 39.74145695543199 ], [ 300, 38.902334128265586 ], [ 310, 38.90473649009262 ], [ 320, 38.54870088269674 ], [ 330, 38.93837319281179 ], [ 340, 38.92461289014998 ], [ 350, 39.108626703314016 ], [ 360, 38.237858653280995 ], [ 370, 38.647253393145476 ], [ 380, 39.065048318303674 ], [ 390, 39.16224031348174 ], [ 400, 39.14035149473662 ], [ 410, 39.21583904225275 ], [ 420, 39.31743572097725 ], [ 430, 39.18774748631874 ], [ 440, 39.02913211773446 ], [ 450, 39.13935270157528 ], [ 460, 39.19057228412275 ], [ 470, 40.0 ], [ 480, 40.0 ], [ 490, 40.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAMS2", "pairs": [ [ 1, 39.71088786022788 ], [ 2, 39.33891235942943 ], [ 3, 39.360675951567586 ], [ 4, 39.061888109532184 ], [ 5, 39.219717949236255 ], [ 6, 39.42603410752427 ], [ 7, 39.39929790517003 ], [ 8, 39.45988558953731 ], [ 9, 39.08862431188643 ], [ 10, 39.56913747448 ], [ 20, 39.556812408616494 ], [ 30, 39.59327013132273 ], [ 40, 39.5752770983674 ], [ 50, 39.50946884706865 ], [ 60, 39.4630281713866 ], [ 70, 39.4930268911753 ], [ 80, 39.55622485900831 ], [ 90, 39.477552505508285 ], [ 100, 39.39861332902104 ], [ 110, 39.40335280602103 ], [ 120, 39.37209678397444 ], [ 130, 39.32489337187444 ], [ 140, 39.4635887691779 ], [ 150, 39.55324668324204 ], [ 160, 39.639854999225136 ], [ 170, 39.70379009925006 ], [ 180, 39.74795604158665 ], [ 190, 39.69260374765013 ], [ 200, 39.75832575313483 ], [ 210, 39.71705578352301 ], [ 220, 39.71987090079709 ], [ 230, 39.71569067399756 ], [ 240, 39.76373767796621 ], [ 250, 39.74686449300263 ], [ 260, 39.7429632175079 ], [ 270, 39.71466515736492 ], [ 280, 39.72233564445163 ], [ 290, 39.715616556501125 ], [ 300, 38.916838821397036 ], [ 310, 38.96325524044389 ], [ 320, 38.68118022006159 ], [ 330, 39.07756867659841 ], [ 340, 38.84180439727773 ], [ 350, 39.17782820806451 ], [ 360, 38.605986222859386 ], [ 370, 38.75221051638256 ], [ 380, 39.01372892607179 ], [ 390, 39.09117331841436 ], [ 400, 39.22670366351257 ], [ 410, 39.21577479209092 ], [ 420, 39.2725214858562 ], [ 430, 39.1829180319857 ], [ 440, 39.13215948312589 ], [ 450, 39.20638100163309 ], [ 460, 39.02427580336901 ], [ 470, 35.4 ], [ 480, 40.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICFS1", "pairs": [ [ 1, 32.24209430313848 ], [ 2, 33.13456790123457 ], [ 3, 33.62008775844117 ], [ 4, 33.440807675145024 ], [ 5, 33.291960434329916 ], [ 6, 33.14556745500521 ], [ 7, 33.54294957608211 ], [ 8, 33.50212702662502 ], [ 9, 33.444117209579055 ], [ 10, 33.41085081065 ], [ 20, 33.63785884277852 ], [ 30, 33.57913357132232 ], [ 40, 33.54185333928306 ], [ 50, 33.50334077048936 ], [ 60, 33.445879071842924 ], [ 70, 33.509756804997764 ], [ 80, 33.64049010858248 ], [ 90, 33.342780752640195 ], [ 100, 33.42581659973227 ], [ 110, 33.336636174326934 ], [ 120, 33.37505949724825 ], [ 130, 33.335831474044326 ], [ 140, 33.29340770489365 ], [ 150, 33.13244013089394 ], [ 160, 33.21854231741782 ], [ 170, 33.05395284843076 ], [ 180, 33.11778075264019 ], [ 190, 33.170060984679466 ], [ 200, 33.218091625762305 ], [ 210, 33.24760300461104 ], [ 220, 33.316214487579956 ], [ 230, 33.3633006098468 ], [ 240, 33.3585393425554 ], [ 250, 33.313836085081064 ], [ 260, 33.408420348058904 ], [ 270, 33.36484976944816 ], [ 280, 33.325293023947644 ], [ 290, 33.27002751747732 ], [ 300, 31.81357057861074 ], [ 310, 31.27829689126878 ], [ 320, 31.824969879010116 ], [ 330, 31.957756440768726 ], [ 340, 32.031072681520286 ], [ 350, 32.29871558995558 ], [ 360, 32.0997630510842 ], [ 370, 32.120509959685215 ], [ 380, 32.50565930233236 ], [ 390, 32.39885448202504 ], [ 400, 32.65245472324396 ], [ 410, 32.91361615089468 ], [ 420, 32.85345368147198 ], [ 430, 32.80769535919645 ], [ 440, 32.93766985006458 ], [ 450, 32.99077003882982 ], [ 460, 32.0832684196247 ], [ 470, 33.25 ], [ 480, 34.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICFS2", "pairs": [ [ 1, 32.24523840877258 ], [ 2, 33.14725318137742 ], [ 3, 33.64137526486538 ], [ 4, 33.41315408281757 ], [ 5, 33.24774041396813 ], [ 6, 33.17840853315456 ], [ 7, 33.55411035159757 ], [ 8, 33.51534722804161 ], [ 9, 33.43333173715777 ], [ 10, 33.325193037482194 ], [ 20, 33.42065650700921 ], [ 30, 33.498091173548175 ], [ 40, 33.619170268037784 ], [ 50, 33.485351896855136 ], [ 60, 33.45995414985694 ], [ 70, 33.475329510492855 ], [ 80, 33.61423150132283 ], [ 90, 33.41328038020902 ], [ 100, 33.42398872301965 ], [ 110, 33.2914267415273 ], [ 120, 33.316292962062896 ], [ 130, 33.29970969556942 ], [ 140, 33.15087869464762 ], [ 150, 33.06700046688135 ], [ 160, 33.140853914022 ], [ 170, 33.05362790753354 ], [ 180, 33.1359720110615 ], [ 190, 33.21998192331175 ], [ 200, 33.22953204122922 ], [ 210, 33.24555505009995 ], [ 220, 33.35864628350471 ], [ 230, 33.37673075311554 ], [ 240, 33.40038368070104 ], [ 250, 33.380724384375036 ], [ 260, 33.37927166509044 ], [ 270, 33.33732716411478 ], [ 280, 33.30735397986425 ], [ 290, 33.331838315396304 ], [ 300, 31.90041121472951 ], [ 310, 31.382316343730896 ], [ 320, 31.886451170664213 ], [ 330, 32.09379010631166 ], [ 340, 32.11066947684551 ], [ 350, 32.455414703082056 ], [ 360, 32.34895402132773 ], [ 370, 32.13886494257346 ], [ 380, 32.52282654117805 ], [ 390, 32.52262165690537 ], [ 400, 32.62330064064439 ], [ 410, 32.80381943327706 ], [ 420, 32.78213856542026 ], [ 430, 32.71706578202293 ], [ 440, 32.574227020003306 ], [ 450, 32.87015433149567 ], [ 460, 32.31436233221964 ], [ 470, 34.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICMS1", "pairs": [ [ 1, 32.257760708822026 ], [ 2, 33.174273329933705 ], [ 3, 33.630837795342515 ], [ 4, 33.500669301376846 ], [ 5, 33.34111528981812 ], [ 6, 33.183245155532894 ], [ 7, 33.5756735509094 ], [ 8, 33.51452808941016 ], [ 9, 33.48626338602754 ], [ 10, 33.381814125446205 ], [ 20, 33.632279980452154 ], [ 30, 33.563951746557876 ], [ 40, 33.52782700152983 ], [ 50, 33.50502879058303 ], [ 60, 33.41464123321434 ], [ 70, 33.431303119156894 ], [ 80, 33.605346974332825 ], [ 90, 33.350994921808606 ], [ 100, 33.41566855770865 ], [ 110, 33.42347388662247 ], [ 120, 33.254946987081425 ], [ 130, 33.304669705082446 ], [ 140, 33.23929702107768 ], [ 150, 33.0659787735849 ], [ 160, 33.21170533741288 ], [ 170, 33.069282785143635 ], [ 180, 33.10842682304947 ], [ 190, 33.198568438721736 ], [ 200, 33.18237028301887 ], [ 210, 33.232386749957506 ], [ 220, 33.342482045724964 ], [ 230, 33.35387557368689 ], [ 240, 33.33430806986231 ], [ 250, 33.34758945266021 ], [ 260, 33.435972293047755 ], [ 270, 33.38163936342003 ], [ 280, 33.3387376763556 ], [ 290, 33.27878633350331 ], [ 300, 31.752516785653576 ], [ 310, 31.075909399966008 ], [ 320, 31.970271893901298 ], [ 330, 31.765871291599165 ], [ 340, 32.22196230662428 ], [ 350, 32.40269367202124 ], [ 360, 32.18182196824908 ], [ 370, 32.27019522430874 ], [ 380, 32.652686574212794 ], [ 390, 32.54862329272892 ], [ 400, 32.64099140976535 ], [ 410, 32.857953965614406 ], [ 420, 32.81787715434584 ], [ 430, 32.77193169813553 ], [ 440, 32.87384511731675 ], [ 450, 32.967671473065295 ], [ 460, 31.53789477688942 ], [ 470, 31.581111111111113 ], [ 480, 30.0 ], [ 490, 34.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICMS2", "pairs": [ [ 1, 32.347252946808865 ], [ 2, 33.20096906263414 ], [ 3, 33.66163700597616 ], [ 4, 33.48221184006339 ], [ 5, 33.38594941724172 ], [ 6, 33.228513883844556 ], [ 7, 33.58574635982435 ], [ 8, 33.54177534915971 ], [ 9, 33.51574933139631 ], [ 10, 33.36903622016045 ], [ 20, 33.60897827450721 ], [ 30, 33.56230560966752 ], [ 40, 33.64831445834846 ], [ 50, 33.573880707894475 ], [ 60, 33.45558572985108 ], [ 70, 33.49782167266484 ], [ 80, 33.62335242843464 ], [ 90, 33.4875590187209 ], [ 100, 33.39396358173474 ], [ 110, 33.44447865420807 ], [ 120, 33.26467874005349 ], [ 130, 33.40011473569519 ], [ 140, 33.12764717535576 ], [ 150, 33.070451018588834 ], [ 160, 33.20241852940206 ], [ 170, 33.03281523425891 ], [ 180, 33.05009492521544 ], [ 190, 33.21726565853337 ], [ 200, 33.15559150790769 ], [ 210, 33.23754003367782 ], [ 220, 33.39199574074685 ], [ 230, 33.37083649750718 ], [ 240, 33.37075312840492 ], [ 250, 33.40386304355003 ], [ 260, 33.42369003202693 ], [ 270, 33.391762967609864 ], [ 280, 33.314501271172446 ], [ 290, 33.25093769604121 ], [ 300, 31.311555287747222 ], [ 310, 30.612246178228286 ], [ 320, 31.88895813385281 ], [ 330, 31.671827021494373 ], [ 340, 32.12691583847855 ], [ 350, 32.36769323472117 ], [ 360, 32.23522112079472 ], [ 370, 31.97879053027802 ], [ 380, 32.5711716121238 ], [ 390, 32.59303615651312 ], [ 400, 32.586705025756174 ], [ 410, 32.73456997622405 ], [ 420, 32.74186344891754 ], [ 430, 32.58418136475457 ], [ 440, 32.61610111751576 ], [ 450, 32.83529595551358 ], [ 460, 32.41823808044009 ], [ 470, 31.269166666666667 ], [ 480, 29.833333333333332 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPFS1", "pairs": [ [ 1, 32.22061050501666 ], [ 2, 33.09477197888944 ], [ 3, 33.5908185819323 ], [ 4, 33.40190613662579 ], [ 5, 33.20662057055219 ], [ 6, 33.067771598693156 ], [ 7, 33.51288478763782 ], [ 8, 33.45604222111958 ], [ 9, 33.45261401055528 ], [ 10, 33.43862472049129 ], [ 20, 33.71674539092555 ], [ 30, 33.61719260486008 ], [ 40, 33.47898738908257 ], [ 50, 33.52317264133315 ], [ 60, 33.45867524148908 ], [ 70, 33.52441182346005 ], [ 80, 33.663867176172644 ], [ 90, 33.177674745300706 ], [ 100, 33.41370446505094 ], [ 110, 33.29725743154856 ], [ 120, 33.44118750120825 ], [ 130, 33.35102556336712 ], [ 140, 33.42185935315079 ], [ 150, 33.14004046835028 ], [ 160, 33.213997022869776 ], [ 170, 32.9865810043626 ], [ 180, 33.030657997332185 ], [ 190, 33.05417474852271 ], [ 200, 33.19041260962864 ], [ 210, 33.26634747362792 ], [ 220, 33.29054471172745 ], [ 230, 33.31401635488423 ], [ 240, 33.29414046641707 ], [ 250, 33.20067662050611 ], [ 260, 33.373254157994104 ], [ 270, 33.32592809779422 ], [ 280, 33.30662637015652 ], [ 290, 33.209637653608965 ], [ 300, 31.654065200440773 ], [ 310, 31.04978174251765 ], [ 320, 31.568902321145494 ], [ 330, 31.76039231354152 ], [ 340, 31.844030737427595 ], [ 350, 32.077713122096135 ], [ 360, 31.818192598951544 ], [ 370, 32.10910942131718 ], [ 380, 32.40382717910826 ], [ 390, 32.071079018933105 ], [ 400, 32.50218909897022 ], [ 410, 32.86933585946461 ], [ 420, 32.76063902607016 ], [ 430, 32.757048386853434 ], [ 440, 32.99876728095157 ], [ 450, 32.95940102461393 ], [ 460, 32.20589136135375 ], [ 470, 33.535000000000004 ], [ 480, 34.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPFS2", "pairs": [ [ 1, 32.30019073882569 ], [ 2, 33.148790072388834 ], [ 3, 33.65344823624038 ], [ 4, 33.43202573825118 ], [ 5, 33.231074342180854 ], [ 6, 33.174597265310815 ], [ 7, 33.584782258991154 ], [ 8, 33.52893025393542 ], [ 9, 33.426400091922325 ], [ 10, 33.33753694128462 ], [ 20, 33.45173618292543 ], [ 30, 33.51182488796967 ], [ 40, 33.64861404113525 ], [ 50, 33.50478915316558 ], [ 60, 33.475936113983686 ], [ 70, 33.46428725726761 ], [ 80, 33.62182281971734 ], [ 90, 33.43008755601517 ], [ 100, 33.42432540503275 ], [ 110, 33.26915362518672 ], [ 120, 33.30658209812709 ], [ 130, 33.284723888314375 ], [ 140, 33.151703550499825 ], [ 150, 33.08844168677468 ], [ 160, 33.13799793174767 ], [ 170, 33.07137998391359 ], [ 180, 33.2058025968057 ], [ 190, 33.26365988739515 ], [ 200, 33.26565230380329 ], [ 210, 33.25956474778812 ], [ 220, 33.393327358382166 ], [ 230, 33.39227576697691 ], [ 240, 33.43794369757555 ], [ 250, 33.40126393197748 ], [ 260, 33.38770722739285 ], [ 270, 33.34807951281167 ], [ 280, 33.30816040445823 ], [ 290, 33.341453291968286 ], [ 300, 32.03088334267395 ], [ 310, 31.623630370561365 ], [ 320, 32.06134904723367 ], [ 330, 32.28973036965397 ], [ 340, 32.258825496613 ], [ 350, 32.56168110943926 ], [ 360, 32.51254652068894 ], [ 370, 32.26939845489981 ], [ 380, 32.62771997683353 ], [ 390, 32.73626549905945 ], [ 400, 32.77719411938334 ], [ 410, 32.946703425036894 ], [ 420, 32.93272198720656 ], [ 430, 32.890326843898194 ], [ 440, 32.51085507105689 ], [ 450, 32.890012167124546 ], [ 460, 32.267798276560775 ], [ 470, 30.65 ], [ 480, 32.4375 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPMS1", "pairs": [ [ 1, 32.331078370919364 ], [ 2, 33.171810176066664 ], [ 3, 33.63988649357336 ], [ 4, 33.49088835541401 ], [ 5, 33.385068756398205 ], [ 6, 33.1895904549237 ], [ 7, 33.57285125030681 ], [ 8, 33.52644891312807 ], [ 9, 33.5287597507169 ], [ 10, 33.47464933338921 ], [ 20, 33.596290985937415 ], [ 30, 33.571124408072365 ], [ 40, 33.675901735522835 ], [ 50, 33.598493465597855 ], [ 60, 33.4731556702327 ], [ 70, 33.59167200474141 ], [ 80, 33.65503654835099 ], [ 90, 33.55413765647543 ], [ 100, 33.38280042385311 ], [ 110, 33.37466549727908 ], [ 120, 33.287750465460164 ], [ 130, 33.43781991032034 ], [ 140, 33.0832712719784 ], [ 150, 33.048424918731556 ], [ 160, 33.202068678572076 ], [ 170, 33.03928364034746 ], [ 180, 33.08693418902172 ], [ 190, 33.25370003412377 ], [ 200, 33.20595100545381 ], [ 210, 33.31031525571873 ], [ 220, 33.432436436999744 ], [ 230, 33.4029439232754 ], [ 240, 33.44703422554014 ], [ 250, 33.43484964589108 ], [ 260, 33.439893378193126 ], [ 270, 33.42265069833991 ], [ 280, 33.36156047390131 ], [ 290, 33.31834960697801 ], [ 300, 31.50860832519903 ], [ 310, 30.944919407777974 ], [ 320, 32.0196163125535 ], [ 330, 31.93005890910397 ], [ 340, 32.2116988145613 ], [ 350, 32.511322550806895 ], [ 360, 32.42738939157229 ], [ 370, 31.907644593461868 ], [ 380, 32.617973677904175 ], [ 390, 32.587597572553626 ], [ 400, 32.72192760552164 ], [ 410, 32.861707852643434 ], [ 420, 32.88043026455644 ], [ 430, 32.60610870580819 ], [ 440, 32.60370941672819 ], [ 450, 32.86011234723451 ], [ 460, 29.928666171224734 ], [ 470, 18.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPMS2", "pairs": [ [ 1, 32.34023793809548 ], [ 2, 33.15290822629504 ], [ 3, 33.64146824389501 ], [ 4, 33.43964393900932 ], [ 5, 33.35559560677599 ], [ 6, 33.175293191856625 ], [ 7, 33.57061989135401 ], [ 8, 33.515543822240275 ], [ 9, 33.50715421976274 ], [ 10, 33.4733021949197 ], [ 20, 33.565243861163296 ], [ 30, 33.55342057166066 ], [ 40, 33.615219322739506 ], [ 50, 33.50431114721362 ], [ 60, 33.470162545903776 ], [ 70, 33.52372907887833 ], [ 80, 33.632985987713866 ], [ 90, 33.442854664838976 ], [ 100, 33.42501269228817 ], [ 110, 33.278510686906635 ], [ 120, 33.36292836472559 ], [ 130, 33.36559120678275 ], [ 140, 33.18701028921494 ], [ 150, 33.110895906313985 ], [ 160, 33.1997732311181 ], [ 170, 33.10784129562878 ], [ 180, 33.166304090301395 ], [ 190, 33.25260826521806 ], [ 200, 33.2505110761368 ], [ 210, 33.290655091299854 ], [ 220, 33.37211631212874 ], [ 230, 33.3888092095243 ], [ 240, 33.40701418151665 ], [ 250, 33.36714981976951 ], [ 260, 33.38656013606133 ], [ 270, 33.353357533296105 ], [ 280, 33.304410147061304 ], [ 290, 33.29092966780051 ], [ 300, 31.83731321182583 ], [ 310, 31.35510893208822 ], [ 320, 31.990534517836107 ], [ 330, 32.144247050013334 ], [ 340, 32.17672400563984 ], [ 350, 32.51149009354218 ], [ 360, 32.38649355345887 ], [ 370, 32.19199192633842 ], [ 380, 32.58425568164917 ], [ 390, 32.545485076546385 ], [ 400, 32.69048306422712 ], [ 410, 32.90743386019551 ], [ 420, 32.86170691869723 ], [ 430, 32.80211212627172 ], [ 440, 32.76894466710013 ], [ 450, 32.94246310532248 ], [ 460, 32.39017868489398 ], [ 470, 29.223333333333336 ], [ 480, 29.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVFS1", "pairs": [ [ 1, 32.3790088385264 ], [ 2, 33.15471711747517 ], [ 3, 33.65680141994517 ], [ 4, 33.42247885212066 ], [ 5, 33.27742223948477 ], [ 6, 33.21152847342345 ], [ 7, 33.58831977671091 ], [ 8, 33.52585393172159 ], [ 9, 33.4953775003726 ], [ 10, 33.34750086940028 ], [ 20, 33.63470465230764 ], [ 30, 33.57583744698916 ], [ 40, 33.68772271325147 ], [ 50, 33.49402259085798 ], [ 60, 33.31949443809644 ], [ 70, 33.53856975751636 ], [ 80, 33.6264103478956 ], [ 90, 33.545176747946186 ], [ 100, 33.366110099947164 ], [ 110, 33.389344991576976 ], [ 120, 33.31017672536436 ], [ 130, 33.33100755587873 ], [ 140, 32.98638361101451 ], [ 150, 33.094293121124394 ], [ 160, 33.2195829588514 ], [ 170, 33.00353541056016 ], [ 180, 33.04964569116193 ], [ 190, 33.19573609975747 ], [ 200, 33.13252550617161 ], [ 210, 33.19992457670369 ], [ 220, 33.35777605152269 ], [ 230, 33.17295419954204 ], [ 240, 33.359189222146455 ], [ 250, 33.40588617856804 ], [ 260, 33.45082130098412 ], [ 270, 33.43211000058712 ], [ 280, 33.37162096857965 ], [ 290, 33.36108745037644 ], [ 300, 31.901214902198113 ], [ 310, 31.532686288767348 ], [ 320, 32.03463661162698 ], [ 330, 31.847106803483037 ], [ 340, 32.17040615576605 ], [ 350, 32.434728552566 ], [ 360, 32.40345517572846 ], [ 370, 32.030832463878085 ], [ 380, 32.716639638999176 ], [ 390, 32.610779534395746 ], [ 400, 32.741274097924745 ], [ 410, 32.873401046448 ], [ 420, 32.90318006988982 ], [ 430, 32.67378887477899 ], [ 440, 32.81119909693561 ], [ 450, 32.97970098374232 ], [ 460, 31.848985254250316 ], [ 470, 32.24583333333334 ], [ 480, 32.75 ], [ 490, 34.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVFS2", "pairs": [ [ 1, 32.09694325987174 ], [ 2, 33.01039259090465 ], [ 3, 33.54963540479833 ], [ 4, 33.31580617858654 ], [ 5, 33.16532113675575 ], [ 6, 32.99825026856343 ], [ 7, 33.472053126729385 ], [ 8, 33.43080829454084 ], [ 9, 33.440126631726294 ], [ 10, 33.41046095250497 ], [ 20, 33.70925160324229 ], [ 30, 33.59558660763697 ], [ 40, 33.417734952309644 ], [ 50, 33.49170301767636 ], [ 60, 33.42661138057879 ], [ 70, 33.5066774634591 ], [ 80, 33.64483544386211 ], [ 90, 33.098793092223055 ], [ 100, 33.42098212832449 ], [ 110, 33.233288844037894 ], [ 120, 33.44341938214134 ], [ 130, 33.36366418177675 ], [ 140, 33.40594583157004 ], [ 150, 33.1096707249585 ], [ 160, 33.213374458804 ], [ 170, 33.00557472573976 ], [ 180, 33.05142745532081 ], [ 190, 33.06616914613106 ], [ 200, 33.21779354796705 ], [ 210, 33.29500716169146 ], [ 220, 33.30550310882516 ], [ 230, 33.32868013281682 ], [ 240, 33.312698167258056 ], [ 250, 33.18356066278199 ], [ 260, 33.3710472346105 ], [ 270, 33.3349750968456 ], [ 280, 33.33036231648166 ], [ 290, 33.21427211172239 ], [ 300, 31.808304306780816 ], [ 310, 31.225632344802886 ], [ 320, 31.728996362559336 ], [ 330, 31.90999641909599 ], [ 340, 31.975161547601612 ], [ 350, 32.212300405293234 ], [ 360, 31.997646369451633 ], [ 370, 32.25072594690496 ], [ 380, 32.56566268962117 ], [ 390, 32.22072824344231 ], [ 400, 32.65824238428921 ], [ 410, 32.97521221443627 ], [ 420, 32.87551867688228 ], [ 430, 32.87350895097141 ], [ 440, 33.03914635618351 ], [ 450, 33.023499769521734 ], [ 460, 32.6028823538209 ], [ 470, 32.633752913752915 ], [ 480, 31.90740740740741 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVMS1", "pairs": [ [ 1, 32.3724313353718 ], [ 2, 33.154153258649 ], [ 3, 33.645280600323126 ], [ 4, 33.391578652210484 ], [ 5, 33.34525256031939 ], [ 6, 33.17860814762394 ], [ 7, 33.563390437023486 ], [ 8, 33.52548969863672 ], [ 9, 33.51482782102466 ], [ 10, 33.443328481967605 ], [ 20, 33.639915612941124 ], [ 30, 33.57201874674536 ], [ 40, 33.64288117714606 ], [ 50, 33.48011563163446 ], [ 60, 33.35411787483476 ], [ 70, 33.478492649513306 ], [ 80, 33.610586436649626 ], [ 90, 33.46451070193476 ], [ 100, 33.377457839851516 ], [ 110, 33.34937577610725 ], [ 120, 33.321167532346145 ], [ 130, 33.31798098620699 ], [ 140, 33.022583552534954 ], [ 150, 33.06736010040992 ], [ 160, 33.13383627308293 ], [ 170, 32.93082397553843 ], [ 180, 33.02201474103054 ], [ 190, 33.10485826445729 ], [ 200, 33.12565059484865 ], [ 210, 33.098266860721296 ], [ 220, 33.26814655575288 ], [ 230, 33.15967713938552 ], [ 240, 33.26255724834097 ], [ 250, 33.28131868131868 ], [ 260, 33.349345065626956 ], [ 270, 33.31896438919525 ], [ 280, 33.24556767655188 ], [ 290, 33.19825083786201 ], [ 300, 31.49840015102344 ], [ 310, 30.95052275276398 ], [ 320, 31.684477578853933 ], [ 330, 31.703690004873714 ], [ 340, 32.040879838101304 ], [ 350, 32.29795634960375 ], [ 360, 32.231524472312664 ], [ 370, 32.01781970649895 ], [ 380, 32.54509954945468 ], [ 390, 32.47368110407665 ], [ 400, 32.602080047055054 ], [ 410, 32.82725489095524 ], [ 420, 32.81342290728828 ], [ 430, 32.702848412806325 ], [ 440, 32.73067262467093 ], [ 450, 32.93518820196986 ], [ 460, 32.35232167956785 ], [ 470, 32.53333333333333 ], [ 480, 29.125 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVMS2", "pairs": [ [ 1, 32.248133077801796 ], [ 2, 33.149297130934734 ], [ 3, 33.60623282950823 ], [ 4, 33.3764432653909 ], [ 5, 33.338274029247664 ], [ 6, 33.10349027123476 ], [ 7, 33.541619855933085 ], [ 8, 33.48899672403538 ], [ 9, 33.49497276323367 ], [ 10, 33.47665285159975 ], [ 20, 33.708577929250495 ], [ 30, 33.598251560095534 ], [ 40, 33.47043512740387 ], [ 50, 33.50887342692333 ], [ 60, 33.46333940692767 ], [ 70, 33.517177572387496 ], [ 80, 33.64921877212692 ], [ 90, 33.24550192120692 ], [ 100, 33.42302521643081 ], [ 110, 33.276534841347015 ], [ 120, 33.42503611113734 ], [ 130, 33.38391284234775 ], [ 140, 33.35840374611746 ], [ 150, 33.12300822295441 ], [ 160, 33.206633120285495 ], [ 170, 33.011040095163466 ], [ 180, 33.064195689321494 ], [ 190, 33.09034204091652 ], [ 200, 33.21360516601682 ], [ 210, 33.25085769851685 ], [ 220, 33.27416991588229 ], [ 230, 33.30896594696147 ], [ 240, 33.300890269346596 ], [ 250, 33.214342494075886 ], [ 260, 33.363874701434064 ], [ 270, 33.34594847200325 ], [ 280, 33.31071061053784 ], [ 290, 33.19982534482596 ], [ 300, 31.735325661093434 ], [ 310, 31.136198936963645 ], [ 320, 31.723738302486435 ], [ 330, 31.840318347463228 ], [ 340, 32.03376352410264 ], [ 350, 32.2239553633806 ], [ 360, 32.04170623609887 ], [ 370, 32.26249451047092 ], [ 380, 32.53500218676122 ], [ 390, 32.24397265577052 ], [ 400, 32.61945254888631 ], [ 410, 32.9075593911697 ], [ 420, 32.83027648405185 ], [ 430, 32.83482870747837 ], [ 440, 32.94223221950928 ], [ 450, 32.94165481788401 ], [ 460, 32.50922461568015 ], [ 470, 33.05333333333333 ], [ 480, 32.44444444444444 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAFS1", "pairs": [ [ 1, 39.565152136408294 ], [ 2, 39.25793948583851 ], [ 3, 39.154163346459434 ], [ 4, 38.78284684238621 ], [ 5, 39.30341407561563 ], [ 6, 39.27463464826434 ], [ 7, 39.25999736962223 ], [ 8, 39.42020284854439 ], [ 9, 39.07314771118452 ], [ 10, 39.51871823238615 ], [ 20, 39.53795712484237 ], [ 30, 39.52885292320071 ], [ 40, 39.497786614471714 ], [ 50, 39.524514347163446 ], [ 60, 39.47965866980248 ], [ 70, 39.34286045845937 ], [ 80, 39.54131163013794 ], [ 90, 39.356374411066156 ], [ 100, 39.318394850648694 ], [ 110, 39.29130814875559 ], [ 120, 39.23699239511369 ], [ 130, 39.335176660812785 ], [ 140, 39.28351604143619 ], [ 150, 39.31526470110399 ], [ 160, 39.53888549346661 ], [ 170, 39.749052677183016 ], [ 180, 39.76189510981827 ], [ 190, 39.72433795712483 ], [ 200, 39.764940158905766 ], [ 210, 39.69355015898312 ], [ 220, 39.73913924755724 ], [ 230, 39.76390657517078 ], [ 240, 39.78047795511337 ], [ 250, 39.724973889632444 ], [ 260, 39.76815695618873 ], [ 270, 39.703520838007414 ], [ 280, 39.72844753556812 ], [ 290, 39.76549408551823 ], [ 300, 38.91486550259556 ], [ 310, 39.01605768263719 ], [ 320, 38.64488078107351 ], [ 330, 38.949313775549676 ], [ 340, 39.0525270146102 ], [ 350, 39.16746946006792 ], [ 360, 38.63554581505392 ], [ 370, 38.593284592472244 ], [ 380, 39.05876328143547 ], [ 390, 39.10535331574427 ], [ 400, 39.11123662444777 ], [ 410, 39.27450246942324 ], [ 420, 39.41549916350741 ], [ 430, 39.21176254939316 ], [ 440, 39.15002790866325 ], [ 450, 39.222779598724266 ], [ 460, 39.089252458739466 ], [ 470, 40.0 ], [ 480, 40.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAFS2", "pairs": [ [ 1, 39.6598164914626 ], [ 2, 39.112523546211335 ], [ 3, 39.32643859755727 ], [ 4, 39.03170687245549 ], [ 5, 39.31234125296226 ], [ 6, 39.362313908974905 ], [ 7, 39.471349577687306 ], [ 8, 39.50965546575925 ], [ 9, 38.99874825302303 ], [ 10, 39.5770553563833 ], [ 20, 39.57531506349881 ], [ 30, 39.57905329039315 ], [ 40, 39.545482165643804 ], [ 50, 39.50440542018593 ], [ 60, 39.47964270523182 ], [ 70, 39.427093637965605 ], [ 80, 39.56259828644345 ], [ 90, 39.40214133803245 ], [ 100, 39.35317494075469 ], [ 110, 39.389900954001334 ], [ 120, 39.34698183143951 ], [ 130, 39.3320337850155 ], [ 140, 39.34992039861457 ], [ 150, 39.39779060582123 ], [ 160, 39.59005408033056 ], [ 170, 39.75267667254057 ], [ 180, 39.77801543416175 ], [ 190, 39.73909461019627 ], [ 200, 39.78902594640578 ], [ 210, 39.703678677766305 ], [ 220, 39.74075955520448 ], [ 230, 39.771486905268276 ], [ 240, 39.791344716534 ], [ 250, 39.73910433250288 ], [ 260, 39.77567964999696 ], [ 270, 39.72600595491279 ], [ 280, 39.74999817706751 ], [ 290, 39.7752470073525 ], [ 300, 38.9128662575196 ], [ 310, 39.028923862186296 ], [ 320, 38.56604241356262 ], [ 330, 38.902677280184726 ], [ 340, 39.14793218691135 ], [ 350, 39.27945555082943 ], [ 360, 38.645942058347565 ], [ 370, 38.77295431620139 ], [ 380, 38.93875470125419 ], [ 390, 39.15241243528353 ], [ 400, 39.2424005250237 ], [ 410, 39.303560924625074 ], [ 420, 39.43596392285363 ], [ 430, 39.28413920347897 ], [ 440, 39.2392746066896 ], [ 450, 39.299883967224226 ], [ 460, 38.81329243955776 ], [ 470, 35.4 ], [ 480, 40.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAMS1", "pairs": [ [ 1, 39.68895489093997 ], [ 2, 39.06319278656065 ], [ 3, 39.223339662011014 ], [ 4, 38.926280304027166 ], [ 5, 39.11052628281043 ], [ 6, 39.33454894072974 ], [ 7, 39.359462626338576 ], [ 8, 39.4136511457413 ], [ 9, 38.950015978344645 ], [ 10, 39.59415756527624 ], [ 20, 39.6494113076552 ], [ 30, 39.48395084935867 ], [ 40, 39.4991872975293 ], [ 50, 39.51307279232538 ], [ 60, 39.512398568841604 ], [ 70, 39.3126629947804 ], [ 80, 39.662890764516796 ], [ 90, 39.35023654216089 ], [ 100, 39.29725611093358 ], [ 110, 39.12883809237363 ], [ 120, 39.123599701737575 ], [ 130, 39.23262339354976 ], [ 140, 39.26447857335314 ], [ 150, 39.10891466310757 ], [ 160, 39.50457356617854 ], [ 170, 39.77742729853187 ], [ 180, 39.76897569411809 ], [ 190, 39.7508430926556 ], [ 200, 39.71791517065499 ], [ 210, 39.67849189490636 ], [ 220, 39.76036367965612 ], [ 230, 39.78376976145272 ], [ 240, 39.813243854603336 ], [ 250, 39.757679317756015 ], [ 260, 39.821750599971175 ], [ 270, 39.794213959433804 ], [ 280, 39.7576730517385 ], [ 290, 39.81612622265667 ], [ 300, 39.08775557518908 ], [ 310, 38.985111942402774 ], [ 320, 39.115404643793674 ], [ 330, 39.05417883326023 ], [ 340, 38.96389748731123 ], [ 350, 39.36508302525221 ], [ 360, 39.18044990287612 ], [ 370, 39.174822983896235 ], [ 380, 39.19591954383107 ], [ 390, 38.772574722726986 ], [ 400, 39.12479478664077 ], [ 410, 39.23565887586942 ], [ 420, 39.369925433924436 ], [ 430, 38.98738389787633 ], [ 440, 39.324786476878465 ], [ 450, 39.24398773702736 ], [ 460, 39.0887829510635 ], [ 470, 39.5 ], [ 480, 40.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAMS2", "pairs": [ [ 1, 39.66511744232092 ], [ 2, 39.043982687591615 ], [ 3, 39.259929277561255 ], [ 4, 39.083414962867245 ], [ 5, 39.20865898306969 ], [ 6, 39.39298194424182 ], [ 7, 39.414490458028524 ], [ 8, 39.39945672939983 ], [ 9, 39.0122479036841 ], [ 10, 39.57781621891999 ], [ 20, 39.63900710697984 ], [ 30, 39.485799239976934 ], [ 40, 39.49756778724912 ], [ 50, 39.501041384436895 ], [ 60, 39.51452727815872 ], [ 70, 39.32212611936669 ], [ 80, 39.65891776606018 ], [ 90, 39.34629124028261 ], [ 100, 39.28954516718424 ], [ 110, 39.126701541582435 ], [ 120, 39.1136630471784 ], [ 130, 39.21445989037327 ], [ 140, 39.2494820866593 ], [ 150, 39.11169977004787 ], [ 160, 39.49027462259366 ], [ 170, 39.76752047685542 ], [ 180, 39.75346491319481 ], [ 190, 39.73204254461835 ], [ 200, 39.70970175694546 ], [ 210, 39.67091834962451 ], [ 220, 39.749981589934904 ], [ 230, 39.76707029865989 ], [ 240, 39.799977768977996 ], [ 250, 39.75102644796898 ], [ 260, 39.807605788402356 ], [ 270, 39.77993233432679 ], [ 280, 39.74109751776745 ], [ 290, 39.79762128064581 ], [ 300, 39.05829390800525 ], [ 310, 38.93541054445162 ], [ 320, 39.03899182315222 ], [ 330, 39.00557581820582 ], [ 340, 38.95551155665784 ], [ 350, 39.319933048880735 ], [ 360, 39.092045555407864 ], [ 370, 39.08082478237611 ], [ 380, 39.0802476446086 ], [ 390, 38.6980352378835 ], [ 400, 39.0404929968875 ], [ 410, 39.26444150374696 ], [ 420, 39.378567278705006 ], [ 430, 39.04828393774973 ], [ 440, 39.321034086851654 ], [ 450, 39.24225895756332 ], [ 460, 39.21378156633588 ], [ 470, 39.40767676767676 ], [ 480, 40.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCFS1", "pairs": [ [ 1, 32.2720597139806 ], [ 2, 33.12514724824678 ], [ 3, 33.6049893761078 ], [ 4, 33.41503638545463 ], [ 5, 33.27799918531811 ], [ 6, 33.08799665319873 ], [ 7, 33.53183314434182 ], [ 8, 33.49273391828961 ], [ 9, 33.48821463565004 ], [ 10, 33.47066814924092 ], [ 20, 33.73980106349014 ], [ 30, 33.630747085310404 ], [ 40, 33.456701308995626 ], [ 50, 33.4927707991589 ], [ 60, 33.428566710336554 ], [ 70, 33.54555062587386 ], [ 80, 33.66902337256283 ], [ 90, 33.20717415476754 ], [ 100, 33.45960774167979 ], [ 110, 33.32603404049189 ], [ 120, 33.489414089593 ], [ 130, 33.39997082558101 ], [ 140, 33.45062147017053 ], [ 150, 33.16847786597383 ], [ 160, 33.2493141259234 ], [ 170, 33.04459392511532 ], [ 180, 33.073414948311736 ], [ 190, 33.10840333359021 ], [ 200, 33.23199112657295 ], [ 210, 33.2995535763434 ], [ 220, 33.30296037783625 ], [ 230, 33.34749265134918 ], [ 240, 33.340214459502604 ], [ 250, 33.238590049871746 ], [ 260, 33.392321072737886 ], [ 270, 33.34508878931666 ], [ 280, 33.34275208349389 ], [ 290, 33.21695639250053 ], [ 300, 31.740683452049364 ], [ 310, 31.12143702227599 ], [ 320, 31.66710813860678 ], [ 330, 31.88965018027688 ], [ 340, 31.930131408000744 ], [ 350, 32.1197821252422 ], [ 360, 31.89212944033717 ], [ 370, 32.20448738126278 ], [ 380, 32.4349456683291 ], [ 390, 32.124127225286514 ], [ 400, 32.57217634948421 ], [ 410, 32.90249750909661 ], [ 420, 32.797219373294276 ], [ 430, 32.791982969961445 ], [ 440, 33.028560976874104 ], [ 450, 33.00012737404681 ], [ 460, 32.409608656441186 ], [ 470, 33.529120879120875 ], [ 480, 34.0 ], [ 490, 34.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCFS2", "pairs": [ [ 1, 32.235603558854834 ], [ 2, 33.12838077563385 ], [ 3, 33.58772959253295 ], [ 4, 33.40262956797031 ], [ 5, 33.28261373870801 ], [ 6, 33.088268606206164 ], [ 7, 33.534223956769736 ], [ 8, 33.48074561283808 ], [ 9, 33.477982314893154 ], [ 10, 33.44850236074343 ], [ 20, 33.728306405392864 ], [ 30, 33.62678352119211 ], [ 40, 33.44762356376736 ], [ 50, 33.483637864687104 ], [ 60, 33.42720313310226 ], [ 70, 33.54067165197457 ], [ 80, 33.6647314483775 ], [ 90, 33.17612510575585 ], [ 100, 33.441242051254065 ], [ 110, 33.30653229988265 ], [ 120, 33.46821934445021 ], [ 130, 33.38709710433667 ], [ 140, 33.43486940858601 ], [ 150, 33.14808274883327 ], [ 160, 33.24255547064764 ], [ 170, 33.04800633170492 ], [ 180, 33.06785909227368 ], [ 190, 33.1087115526323 ], [ 200, 33.24479954149723 ], [ 210, 33.30167230697852 ], [ 220, 33.29842253213614 ], [ 230, 33.34497693840234 ], [ 240, 33.331301683906005 ], [ 250, 33.2258460467782 ], [ 260, 33.37653994159548 ], [ 270, 33.3405038072105 ], [ 280, 33.33563903823586 ], [ 290, 33.211876722796866 ], [ 300, 31.76487882569242 ], [ 310, 31.172961797998134 ], [ 320, 31.727957260700187 ], [ 330, 31.94481895157714 ], [ 340, 31.975935688127123 ], [ 350, 32.175975355139805 ], [ 360, 31.945220452777665 ], [ 370, 32.22702191152225 ], [ 380, 32.49306568596011 ], [ 390, 32.072820873220024 ], [ 400, 32.587490532952145 ], [ 410, 32.919157893300394 ], [ 420, 32.8274530937809 ], [ 430, 32.82963743836335 ], [ 440, 33.079939732977174 ], [ 450, 33.0308488137788 ], [ 460, 32.38493155443672 ], [ 470, 33.3 ], [ 480, 30.5 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCMS1", "pairs": [ [ 1, 32.236181807678236 ], [ 2, 33.11421070536809 ], [ 3, 33.59733874228935 ], [ 4, 33.40391935349282 ], [ 5, 33.25217117805265 ], [ 6, 33.092688281094546 ], [ 7, 33.529273192931555 ], [ 8, 33.47499534632938 ], [ 9, 33.463800861410476 ], [ 10, 33.44044200242632 ], [ 20, 33.6949631236721 ], [ 30, 33.60747989293348 ], [ 40, 33.48375580104114 ], [ 50, 33.48190588673287 ], [ 60, 33.42741878542406 ], [ 70, 33.536081031638545 ], [ 80, 33.66370265291319 ], [ 90, 33.26493699892805 ], [ 100, 33.44861448992561 ], [ 110, 33.28393809655243 ], [ 120, 33.447960408496 ], [ 130, 33.37432072456047 ], [ 140, 33.40664672542059 ], [ 150, 33.151780269720334 ], [ 160, 33.24318349583738 ], [ 170, 33.06226161973414 ], [ 180, 33.105137652367596 ], [ 190, 33.12043571194742 ], [ 200, 33.23102875005617 ], [ 210, 33.30159701138063 ], [ 220, 33.29556200293983 ], [ 230, 33.357492409702736 ], [ 240, 33.36223979562362 ], [ 250, 33.26758862835466 ], [ 260, 33.41542258538684 ], [ 270, 33.35903100949349 ], [ 280, 33.345903165137905 ], [ 290, 33.24761635781271 ], [ 300, 31.838335346019022 ], [ 310, 31.23974067655177 ], [ 320, 31.811595095962513 ], [ 330, 31.863983567623087 ], [ 340, 32.04832792154527 ], [ 350, 32.25958081910387 ], [ 360, 32.105267043266146 ], [ 370, 32.42430992425215 ], [ 380, 32.561431505969956 ], [ 390, 32.2811798690461 ], [ 400, 32.62202029798625 ], [ 410, 32.93526204211453 ], [ 420, 32.78357418647449 ], [ 430, 32.7749791235024 ], [ 440, 32.98020727599551 ], [ 450, 33.011347028230304 ], [ 460, 32.14632477902283 ], [ 470, 32.36262626262626 ], [ 480, 34.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCMS2", "pairs": [ [ 1, 32.239886668993904 ], [ 2, 33.10492859984251 ], [ 3, 33.60649948449005 ], [ 4, 33.40388377889088 ], [ 5, 33.2711663514073 ], [ 6, 33.122756313982094 ], [ 7, 33.52508950389271 ], [ 8, 33.48854918452009 ], [ 9, 33.45523993537859 ], [ 10, 33.420156033090066 ], [ 20, 33.669221214655096 ], [ 30, 33.59759699299393 ], [ 40, 33.498757093335705 ], [ 50, 33.469063720277 ], [ 60, 33.42959108289563 ], [ 70, 33.51736253744551 ], [ 80, 33.64753975921221 ], [ 90, 33.27381696555419 ], [ 100, 33.42753310223334 ], [ 110, 33.26568895672152 ], [ 120, 33.41419803700306 ], [ 130, 33.33843025190982 ], [ 140, 33.369524837837616 ], [ 150, 33.13113680091575 ], [ 160, 33.216618904196324 ], [ 170, 33.06049488955098 ], [ 180, 33.10899260425884 ], [ 190, 33.1225054595345 ], [ 200, 33.23765333376631 ], [ 210, 33.292076571493524 ], [ 220, 33.29943334496952 ], [ 230, 33.35842716696839 ], [ 240, 33.3569066155757 ], [ 250, 33.274903189667064 ], [ 260, 33.39783567004117 ], [ 270, 33.35932667094229 ], [ 280, 33.341771730570954 ], [ 290, 33.2540627866763 ], [ 300, 31.859175671177717 ], [ 310, 31.3132027374796 ], [ 320, 31.870874669177944 ], [ 330, 31.93323970189482 ], [ 340, 32.08783037649751 ], [ 350, 32.31212742847095 ], [ 360, 32.15187536577007 ], [ 370, 32.38331181852872 ], [ 380, 32.56271687328997 ], [ 390, 32.259051237710175 ], [ 400, 32.628580851411684 ], [ 410, 32.93913926162704 ], [ 420, 32.81433135918072 ], [ 430, 32.80935950425899 ], [ 440, 33.01758109243743 ], [ 450, 33.02452880624644 ], [ 460, 32.23683456758248 ], [ 470, 32.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPFS1", "pairs": [ [ 1, 32.21879902946519 ], [ 2, 33.09073793350334 ], [ 3, 33.58731498627728 ], [ 4, 33.35276023459011 ], [ 5, 33.22952529533693 ], [ 6, 33.064459245051204 ], [ 7, 33.5162617615472 ], [ 8, 33.46943655062382 ], [ 9, 33.46553850097451 ], [ 10, 33.452096859020536 ], [ 20, 33.73006624916581 ], [ 30, 33.626811687077655 ], [ 40, 33.45159126165106 ], [ 50, 33.51436223576572 ], [ 60, 33.45175213354134 ], [ 70, 33.534325818612515 ], [ 80, 33.663245192626405 ], [ 90, 33.131871196418395 ], [ 100, 33.44093482478665 ], [ 110, 33.27461362019207 ], [ 120, 33.46695099152771 ], [ 130, 33.378647792210096 ], [ 140, 33.42464433611618 ], [ 150, 33.15123769705701 ], [ 160, 33.23445928924677 ], [ 170, 33.02397079556454 ], [ 180, 33.05679175487367 ], [ 190, 33.076555131769105 ], [ 200, 33.2265597723044 ], [ 210, 33.30370182129961 ], [ 220, 33.31946240503476 ], [ 230, 33.33879089747953 ], [ 240, 33.32394162648553 ], [ 250, 33.204656003747786 ], [ 260, 33.389960975307936 ], [ 270, 33.34384642921857 ], [ 280, 33.333448094507816 ], [ 290, 33.223946487998695 ], [ 300, 31.764356711318932 ], [ 310, 31.16172364395723 ], [ 320, 31.667128954416484 ], [ 330, 31.88828370148409 ], [ 340, 31.970997852085596 ], [ 350, 32.19833787825877 ], [ 360, 31.956555808454688 ], [ 370, 32.216364439926636 ], [ 380, 32.52558239232757 ], [ 390, 32.193337900249716 ], [ 400, 32.63799836474929 ], [ 410, 32.95975736415265 ], [ 420, 32.851886623956226 ], [ 430, 32.854399427249305 ], [ 440, 33.10318602961439 ], [ 450, 33.058490789929884 ], [ 460, 32.37845268586726 ], [ 470, 33.13828627893845 ], [ 480, 34.0 ], [ 490, 31.666666666666668 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPFS2", "pairs": [ [ 1, 32.20114874921362 ], [ 2, 33.08305160165101 ], [ 3, 33.57446155577264 ], [ 4, 33.30510901865311 ], [ 5, 33.18374361308735 ], [ 6, 33.0692369461479 ], [ 7, 33.500467989995755 ], [ 8, 33.46662950024806 ], [ 9, 33.43754763012935 ], [ 10, 33.43162691735246 ], [ 20, 33.71992102988487 ], [ 30, 33.60137993115688 ], [ 40, 33.42908800769243 ], [ 50, 33.509942869418 ], [ 60, 33.446422561720965 ], [ 70, 33.51314565996818 ], [ 80, 33.64951589887325 ], [ 90, 33.12907573254499 ], [ 100, 33.431234112634705 ], [ 110, 33.252531493425124 ], [ 120, 33.450143977250065 ], [ 130, 33.369874230885294 ], [ 140, 33.42333914697955 ], [ 150, 33.13191896356839 ], [ 160, 33.22563101929755 ], [ 170, 33.02555839134193 ], [ 180, 33.06812399944762 ], [ 190, 33.08427297882025 ], [ 200, 33.23341704301928 ], [ 210, 33.30020714311288 ], [ 220, 33.32657467125621 ], [ 230, 33.34428566313927 ], [ 240, 33.32647544714782 ], [ 250, 33.22435747275173 ], [ 260, 33.40373624799889 ], [ 270, 33.352390840694156 ], [ 280, 33.34498841532961 ], [ 290, 33.24687316192454 ], [ 300, 31.85773769032871 ], [ 310, 31.28846801045433 ], [ 320, 31.78098017052226 ], [ 330, 31.98365922144877 ], [ 340, 32.07426043533213 ], [ 350, 32.28417060496328 ], [ 360, 32.0422947482559 ], [ 370, 32.33047065201825 ], [ 380, 32.60515763415781 ], [ 390, 32.215352707706785 ], [ 400, 32.65995468401564 ], [ 410, 32.999826612655745 ], [ 420, 32.91968155039585 ], [ 430, 32.9219758441222 ], [ 440, 33.15343367219996 ], [ 450, 33.093446692239766 ], [ 460, 32.73996139872827 ], [ 470, 32.68621933621934 ], [ 480, 34.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPMS1", "pairs": [ [ 1, 32.27932226257926 ], [ 2, 33.13761041830634 ], [ 3, 33.611640423732545 ], [ 4, 33.37640237970699 ], [ 5, 33.31040315208518 ], [ 6, 33.119860385309174 ], [ 7, 33.541134027170116 ], [ 8, 33.49777330211231 ], [ 9, 33.47237770271261 ], [ 10, 33.44261865537756 ], [ 20, 33.674163460645374 ], [ 30, 33.59629405122139 ], [ 40, 33.548444733407315 ], [ 50, 33.52735978647165 ], [ 60, 33.4894629038487 ], [ 70, 33.502400238557314 ], [ 80, 33.641056300504005 ], [ 90, 33.27321509754942 ], [ 100, 33.4553638732322 ], [ 110, 33.20153302405616 ], [ 120, 33.38877460733368 ], [ 130, 33.2741214198071 ], [ 140, 33.344472851884255 ], [ 150, 33.18542453913953 ], [ 160, 33.198650782399554 ], [ 170, 33.04576291900294 ], [ 180, 33.06962353895866 ], [ 190, 33.10067363110631 ], [ 200, 33.18571100345615 ], [ 210, 33.26474191324921 ], [ 220, 33.288023249561256 ], [ 230, 33.34779114502622 ], [ 240, 33.34281663839502 ], [ 250, 33.27368243524 ], [ 260, 33.41300479558865 ], [ 270, 33.37284064078059 ], [ 280, 33.33676569076519 ], [ 290, 33.30931400106569 ], [ 300, 31.693381989900423 ], [ 310, 31.344105727819787 ], [ 320, 31.74764400209226 ], [ 330, 31.939142953515546 ], [ 340, 32.042433598597384 ], [ 350, 32.287762595027985 ], [ 360, 32.125857879684176 ], [ 370, 32.34201129335843 ], [ 380, 32.57385899153126 ], [ 390, 32.31493964594242 ], [ 400, 32.65813398649673 ], [ 410, 32.965301070540804 ], [ 420, 32.90697723978004 ], [ 430, 32.8803228365581 ], [ 440, 33.04024839547096 ], [ 450, 33.0137409926641 ], [ 460, 32.07099885623463 ], [ 470, 33.37 ], [ 480, 30.5 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPMS2", "pairs": [ [ 1, 32.172958471773605 ], [ 2, 33.097780587269405 ], [ 3, 33.563225125078056 ], [ 4, 33.32402346610751 ], [ 5, 33.27278964531025 ], [ 6, 33.06175656611599 ], [ 7, 33.52245237783208 ], [ 8, 33.475096169412346 ], [ 9, 33.474479451737984 ], [ 10, 33.42357403310232 ], [ 20, 33.68813435194536 ], [ 30, 33.58955511528766 ], [ 40, 33.492489920520505 ], [ 50, 33.508938551792724 ], [ 60, 33.471700367717915 ], [ 70, 33.49302800669139 ], [ 80, 33.6330421911979 ], [ 90, 33.22289949814599 ], [ 100, 33.42773687740423 ], [ 110, 33.19335332526461 ], [ 120, 33.37994202853861 ], [ 130, 33.27511312914839 ], [ 140, 33.3583129688018 ], [ 150, 33.1406162551361 ], [ 160, 33.19418203963953 ], [ 170, 33.03218495363054 ], [ 180, 33.054176335001046 ], [ 190, 33.08454890956607 ], [ 200, 33.18111070853152 ], [ 210, 33.25102953306763 ], [ 220, 33.27602972579191 ], [ 230, 33.33527625097326 ], [ 240, 33.328069904948386 ], [ 250, 33.24571419761177 ], [ 260, 33.404178262243775 ], [ 270, 33.3635373384007 ], [ 280, 33.33831898179912 ], [ 290, 33.28052482674088 ], [ 300, 31.75244027474772 ], [ 310, 31.349447652232904 ], [ 320, 31.783871291021363 ], [ 330, 31.96598594352357 ], [ 340, 32.10661601161554 ], [ 350, 32.31165604096278 ], [ 360, 32.126365577802275 ], [ 370, 32.41013283785763 ], [ 380, 32.61433847055285 ], [ 390, 32.27624415027716 ], [ 400, 32.66303360651314 ], [ 410, 32.98015600850922 ], [ 420, 32.92628367351531 ], [ 430, 32.931566661051704 ], [ 440, 33.09339249064227 ], [ 450, 33.0473733537532 ], [ 460, 32.205804463169684 ], [ 470, 32.375 ], [ 480, 20.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVFS1", "pairs": [ [ 1, 32.23760784016952 ], [ 2, 33.114149765400335 ], [ 3, 33.58523157257454 ], [ 4, 33.390901695171785 ], [ 5, 33.271643711215376 ], [ 6, 33.07219615559255 ], [ 7, 33.5272154533071 ], [ 8, 33.472008854245495 ], [ 9, 33.45981534735886 ], [ 10, 33.44986472680491 ], [ 20, 33.72723437263509 ], [ 30, 33.61880108218556 ], [ 40, 33.45852599515665 ], [ 50, 33.4864547071288 ], [ 60, 33.42606894203117 ], [ 70, 33.53623145905858 ], [ 80, 33.662951225972456 ], [ 90, 33.20333547752384 ], [ 100, 33.441946988042986 ], [ 110, 33.299298092931735 ], [ 120, 33.46326812471621 ], [ 130, 33.37463107310429 ], [ 140, 33.42794384743455 ], [ 150, 33.15305736340245 ], [ 160, 33.23050552444377 ], [ 170, 33.04211726199485 ], [ 180, 33.06916433328288 ], [ 190, 33.09574598910247 ], [ 200, 33.22401241107916 ], [ 210, 33.29295728015741 ], [ 220, 33.29034925079461 ], [ 230, 33.334893862570006 ], [ 240, 33.331160133192064 ], [ 250, 33.2360706447707 ], [ 260, 33.38790865748449 ], [ 270, 33.33904760102921 ], [ 280, 33.33431303920084 ], [ 290, 33.21526222188588 ], [ 300, 31.744499926708745 ], [ 310, 31.156682842845118 ], [ 320, 31.704942721192687 ], [ 330, 31.915879142189556 ], [ 340, 31.948434883786934 ], [ 350, 32.15374180548854 ], [ 360, 31.93712506378723 ], [ 370, 32.205380758679404 ], [ 380, 32.463159145649136 ], [ 390, 32.14532674915806 ], [ 400, 32.597661812176966 ], [ 410, 32.91006480298945 ], [ 420, 32.80833451586964 ], [ 430, 32.80097793303254 ], [ 440, 33.0463335883847 ], [ 450, 33.025653803581505 ], [ 460, 32.32093910114817 ], [ 470, 34.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVFS2", "pairs": [ [ 1, 32.3516396845164 ], [ 2, 33.16519302615193 ], [ 3, 33.65994188459942 ], [ 4, 33.43372076933721 ], [ 5, 33.34847792998478 ], [ 6, 33.211325584613256 ], [ 7, 33.573522900235226 ], [ 8, 33.54239656842397 ], [ 9, 33.51450117614501 ], [ 10, 33.38333748443337 ], [ 20, 33.62804414003044 ], [ 30, 33.575933305659326 ], [ 40, 33.67770720907707 ], [ 50, 33.5442894700429 ], [ 60, 33.396314515013145 ], [ 70, 33.57180226926803 ], [ 80, 33.65010446935104 ], [ 90, 33.53191504081915 ], [ 100, 33.352603431576036 ], [ 110, 33.38261934412619 ], [ 120, 33.327987408329875 ], [ 130, 33.39784834647848 ], [ 140, 32.944943960149445 ], [ 150, 32.98369447903695 ], [ 160, 33.125377058253775 ], [ 170, 32.90340597758406 ], [ 180, 32.886033623910336 ], [ 190, 33.10191227341912 ], [ 200, 33.047499654075 ], [ 210, 33.134373875743734 ], [ 220, 33.30239864397398 ], [ 230, 33.185805313408046 ], [ 240, 33.30303929708039 ], [ 250, 33.293984364189846 ], [ 260, 33.36523730455237 ], [ 270, 33.310285734052854 ], [ 280, 33.26226373322263 ], [ 290, 33.23201466722014 ], [ 300, 31.21843226788432 ], [ 310, 30.555888335408884 ], [ 320, 31.34395483291475 ], [ 330, 31.140686186331624 ], [ 340, 31.6447580030243 ], [ 350, 31.874726019815135 ], [ 360, 31.831707835964846 ], [ 370, 31.419455629817207 ], [ 380, 32.18298075225452 ], [ 390, 32.104265557063336 ], [ 400, 32.17986983764323 ], [ 410, 32.35538362486709 ], [ 420, 32.37230007515156 ], [ 430, 32.09608021420527 ], [ 440, 32.39831279176476 ], [ 450, 32.54994416541695 ], [ 460, 30.1415904308108 ], [ 470, 30.75 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVMS1", "pairs": [ [ 1, 32.218929783812754 ], [ 2, 33.105550592579355 ], [ 3, 33.59207313441725 ], [ 4, 33.39827883985468 ], [ 5, 33.25328747543327 ], [ 6, 33.07620153653743 ], [ 7, 33.520582454886544 ], [ 8, 33.47427193139182 ], [ 9, 33.45545232565065 ], [ 10, 33.43831129771902 ], [ 20, 33.69972157703531 ], [ 30, 33.61051605026502 ], [ 40, 33.474641772378064 ], [ 50, 33.47488446191412 ], [ 60, 33.41397147281281 ], [ 70, 33.52642606158061 ], [ 80, 33.65442856292062 ], [ 90, 33.24992138645703 ], [ 100, 33.4328300875469 ], [ 110, 33.27157971532368 ], [ 120, 33.4463224346376 ], [ 130, 33.37705675659579 ], [ 140, 33.394916621999876 ], [ 150, 33.139643559049496 ], [ 160, 33.22786671431123 ], [ 170, 33.05577779762969 ], [ 180, 33.104136144363046 ], [ 190, 33.11042522780061 ], [ 200, 33.22334494669764 ], [ 210, 33.29225835268894 ], [ 220, 33.285372223214814 ], [ 230, 33.34600083378 ], [ 240, 33.34958638556369 ], [ 250, 33.24969686141385 ], [ 260, 33.4030745637544 ], [ 270, 33.35454380322792 ], [ 280, 33.33828687987612 ], [ 290, 33.231083020665835 ], [ 300, 31.82831057444266 ], [ 310, 31.23830039396222 ], [ 320, 31.807670248974894 ], [ 330, 31.852347856124016 ], [ 340, 32.0302790565061 ], [ 350, 32.261801798045916 ], [ 360, 32.10382836672037 ], [ 370, 32.401123257566056 ], [ 380, 32.55640928248721 ], [ 390, 32.27707683144728 ], [ 400, 32.64548351411051 ], [ 410, 32.94624907146792 ], [ 420, 32.801097714561536 ], [ 430, 32.80454060307079 ], [ 440, 32.99859696122915 ], [ 450, 33.041444181809496 ], [ 460, 32.27450400832484 ], [ 470, 33.01131021756022 ], [ 480, 34.0 ], [ 490, 34.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVMS2", "pairs": [ [ 1, 32.238406548141064 ], [ 2, 33.119650624075405 ], [ 3, 33.59105122821937 ], [ 4, 33.36967055551126 ], [ 5, 33.30976108852215 ], [ 6, 33.09357144755375 ], [ 7, 33.53242623154127 ], [ 8, 33.48038303790516 ], [ 9, 33.47270279128686 ], [ 10, 33.43437951225562 ], [ 20, 33.67473491190306 ], [ 30, 33.58227165218316 ], [ 40, 33.47895594709754 ], [ 50, 33.47460557903036 ], [ 60, 33.412012012012006 ], [ 70, 33.49780754205533 ], [ 80, 33.64022252340837 ], [ 90, 33.26499774110393 ], [ 100, 33.42295392737871 ], [ 110, 33.27218457395449 ], [ 120, 33.42639719365383 ], [ 130, 33.36615642190863 ], [ 140, 33.32771266842063 ], [ 150, 33.0846545660705 ], [ 160, 33.139737968056565 ], [ 170, 32.90280900369396 ], [ 180, 32.97690079459991 ], [ 190, 32.966275124682205 ], [ 200, 33.092485405759746 ], [ 210, 33.15495229743017 ], [ 220, 33.16100259551587 ], [ 230, 33.218553952182276 ], [ 240, 33.23916571438696 ], [ 250, 33.13594036514391 ], [ 260, 33.285697201626405 ], [ 270, 33.22381673709108 ], [ 280, 33.18949126117268 ], [ 290, 33.08141327167876 ], [ 300, 31.138649268737765 ], [ 310, 30.49164474208722 ], [ 320, 31.11497869550967 ], [ 330, 31.198215915030072 ], [ 340, 31.4601140075879 ], [ 350, 31.63205347363632 ], [ 360, 31.50198703070463 ], [ 370, 31.777891072092984 ], [ 380, 32.054664162576856 ], [ 390, 31.811127549122098 ], [ 400, 32.15010453393809 ], [ 410, 32.49041057689301 ], [ 420, 32.31740740331201 ], [ 430, 32.28798643521305 ], [ 440, 32.58235506837977 ], [ 450, 32.59051207857236 ], [ 460, 31.664620897224506 ], [ 470, 29.45 ], [ 480, 34.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null } ] } ], "pconfig": { "id": "fastqc_per_base_sequence_quality_plot", "title": "FastQC: Mean Quality Scores", "anchor": null, "table_title": null, "height": null, "width": null, "square": false, "logswitch": false, "logswitch_active": false, "logswitch_label": "Log10", "cpswitch": true, "cpswitch_c_active": true, "cpswitch_counts_label": "Counts", "cpswitch_percent_label": "Percentages", "xLog": null, "yLog": null, "xlog": false, "ylog": false, "data_labels": [], "xTitle": null, "yTitle": null, "xlab": "Position (bp)", "ylab": "Phred Score", "xsuffix": null, "ysuffix": null, "tt_suffix": null, "xLabFormat": null, "yLabFormat": null, "xLabelFormat": null, "yLabelFormat": null, "xlab_format": null, "ylab_format": null, "tt_label": "Base {point.x}: {point.y:.2f}", "xDecimals": null, "yDecimals": null, "decimalPlaces": null, "x_decimals": 0, "y_decimals": null, "tt_decimals": null, "xmin": 0, "xmax": null, "ymin": 0, "ymax": null, "xFloor": null, "xCeiling": null, "yFloor": null, "yCeiling": null, "x_clipmin": null, "x_clipmax": null, "y_clipmin": null, "y_clipmax": null, "save_data_file": true, "showlegend": false, "xMinRange": null, "yMinRange": null, "x_minrange": null, "y_minrange": null, "xPlotBands": null, "yPlotBands": null, "xPlotLines": null, "yPlotLines": null, "x_bands": null, "y_bands": [ { "from_": 28, "to": 100, "color": "#c3e6c3" }, { "from_": 20, "to": 28, "color": "#e6dcc3" }, { "from_": 0, "to": 20, "color": "#e6c3c3" } ], "x_lines": null, "y_lines": null, "categories": false, "smooth_points": 500, "smooth_points_sumcounts": null, "extra_series": null, "style": null, "hide_zero_cats": false, "hide_empty": false, "colors": { "CVFS2": "#5cb85c", "JPFS1": "#5cb85c", "CCMS1": "#5cb85c", "ICFS1": "#5cb85c", "CCFS2": "#5cb85c", "IAFS2": "#5cb85c", "DVMS1": "#5cb85c", "DVMS2": "#5cb85c", "DCMS2": "#5cb85c", "JCMS1": "#5cb85c", "JCFS1": "#5cb85c", "DPMS1": "#5cb85c", "CAFS2": "#5cb85c", "DAMS1": "#5cb85c", "JAMS2": "#5cb85c", "IPMS1": "#5cb85c", "DCMS1": "#5cb85c", "CAFS1": "#5cb85c", "IPFS1": "#5cb85c", "JVFS1": "#5cb85c", "IVFS2": "#5cb85c", "DVFS1": "#5cb85c", "DPFS2": "#5cb85c", "CVMS1": "#5cb85c", "JVFS2": "#5cb85c", "CPMS1": "#5cb85c", "ICMS1": "#5cb85c", "CVMS2": "#5cb85c", "ICMS2": "#5cb85c", "DCFS2": "#5cb85c", "CCFS1": "#5cb85c", "CCMS2": "#5cb85c", "JVMS1": "#5cb85c", "CPFS2": "#5cb85c", "IAFS1": "#5cb85c", "CAMS1": "#5cb85c", "JPMS2": "#5cb85c", "IAMS1": "#5cb85c", "DAFS1": "#5cb85c", "DAFS2": "#5cb85c", "IAMS2": "#5cb85c", "JVMS2": "#5cb85c", "ICFS2": "#5cb85c", "IPMS2": "#5cb85c", "DPFS1": "#5cb85c", "DCFS1": "#5cb85c", "JCMS2": "#5cb85c", "JPMS1": "#5cb85c", "JAFS1": "#5cb85c", "JCFS2": "#5cb85c", "DPMS2": "#5cb85c", "CAMS2": "#5cb85c", "DAMS2": "#5cb85c", "IVMS1": "#5cb85c", "CPMS2": "#5cb85c", "CPFS1": "#5cb85c", "IVFS1": "#5cb85c", "CVFS1": "#5cb85c", "IVMS2": "#5cb85c", "IPFS2": "#5cb85c", "JAFS2": "#5cb85c", "JAMS1": "#5cb85c", "DVFS2": "#5cb85c", "JPFS2": "#5cb85c" } }, "add_log_tab": false, "add_pct_tab": false, "l_active": false, "p_active": false, "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "yaxis" ], "square": false, "flat": false, "defer_render": false }, "fastqc_per_sequence_quality_scores_plot": { "id": "fastqc_per_sequence_quality_scores_plot", "anchor": "fastqc_per_sequence_quality_scores_plot", "plot_type": "xy_line", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 500, "hoverlabel": { "namelength": -1 }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "white", "plot_bgcolor": "white", "showlegend": false, "title": { "font": { "size": 20 }, "text": "FastQC: Per Sequence Quality Scores", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "shapes": [ { "fillcolor": "#c3e6c3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 28, "x1": 100, "y0": 0, "y1": 1, "yref": "paper" }, { "fillcolor": "#e6dcc3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 20, "x1": 28, "y0": 0, "y1": 1, "yref": "paper" }, { "fillcolor": "#e6c3c3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 20, "y0": 0, "y1": 1, "yref": "paper" }, { "fillcolor": "#c3e6c3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 28, "x1": 100, "y0": 0, "y1": 1, "yref": "paper" }, { "fillcolor": "#e6dcc3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 20, "x1": 28, "y0": 0, "y1": 1, "yref": "paper" }, { "fillcolor": "#e6c3c3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 20, "y0": 0, "y1": 1, "yref": "paper" } ], "hoverdistance": -1 }, "datasets": [ { "plot_id": "fastqc_per_sequence_quality_scores_plot", "label": "1", "uid": "fastqc_per_sequence_quality_scores_plot", "dconfig": { "title": "FastQC: Per Sequence Quality Scores
64 samples" }, "layout": { "title": { "text": "FastQC: Per Sequence Quality Scores
64 samples" }, "xaxis": { "hoverformat": ",.0f", "ticksuffix": "", "title": { "text": "Mean Sequence Quality (Phred Score)" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": null }, "range": [ 0, 40.0 ] }, "yaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "Count" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": null } } }, "trace_params": { "hovertemplate": "%{text}
Phred %{x}: %{y} reads", "mode": "lines", "line": { "width": 2 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "n_samples": 64, "lines": [ { "name": "CAFS1", "pairs": [ [ 21.0, 3.0 ], [ 22.0, 5.0 ], [ 23.0, 19.0 ], [ 24.0, 38.0 ], [ 25.0, 65.0 ], [ 26.0, 118.0 ], [ 27.0, 154.0 ], [ 28.0, 191.0 ], [ 29.0, 287.0 ], [ 30.0, 341.0 ], [ 31.0, 422.0 ], [ 32.0, 613.0 ], [ 33.0, 783.0 ], [ 34.0, 1089.0 ], [ 35.0, 1385.0 ], [ 36.0, 2050.0 ], [ 37.0, 3209.0 ], [ 38.0, 7018.0 ], [ 39.0, 136233.0 ], [ 40.0, 6346.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAFS2", "pairs": [ [ 22.0, 7.0 ], [ 23.0, 8.0 ], [ 24.0, 24.0 ], [ 25.0, 52.0 ], [ 26.0, 85.0 ], [ 27.0, 144.0 ], [ 28.0, 161.0 ], [ 29.0, 236.0 ], [ 30.0, 273.0 ], [ 31.0, 350.0 ], [ 32.0, 451.0 ], [ 33.0, 721.0 ], [ 34.0, 972.0 ], [ 35.0, 1322.0 ], [ 36.0, 1940.0 ], [ 37.0, 3058.0 ], [ 38.0, 7021.0 ], [ 39.0, 127059.0 ], [ 40.0, 4425.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAMS1", "pairs": [ [ 21.0, 2.0 ], [ 22.0, 2.0 ], [ 23.0, 16.0 ], [ 24.0, 28.0 ], [ 25.0, 70.0 ], [ 26.0, 85.0 ], [ 27.0, 144.0 ], [ 28.0, 210.0 ], [ 29.0, 246.0 ], [ 30.0, 315.0 ], [ 31.0, 428.0 ], [ 32.0, 586.0 ], [ 33.0, 685.0 ], [ 34.0, 958.0 ], [ 35.0, 1353.0 ], [ 36.0, 1837.0 ], [ 37.0, 3035.0 ], [ 38.0, 6519.0 ], [ 39.0, 121723.0 ], [ 40.0, 5435.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAMS2", "pairs": [ [ 21.0, 2.0 ], [ 22.0, 5.0 ], [ 23.0, 23.0 ], [ 24.0, 42.0 ], [ 25.0, 75.0 ], [ 26.0, 89.0 ], [ 27.0, 166.0 ], [ 28.0, 200.0 ], [ 29.0, 258.0 ], [ 30.0, 349.0 ], [ 31.0, 411.0 ], [ 32.0, 558.0 ], [ 33.0, 779.0 ], [ 34.0, 1067.0 ], [ 35.0, 1438.0 ], [ 36.0, 2094.0 ], [ 37.0, 3274.0 ], [ 38.0, 6909.0 ], [ 39.0, 139177.0 ], [ 40.0, 6637.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCFS1", "pairs": [ [ 17.0, 12.0 ], [ 18.0, 54.0 ], [ 19.0, 97.0 ], [ 20.0, 199.0 ], [ 21.0, 312.0 ], [ 22.0, 394.0 ], [ 23.0, 531.0 ], [ 24.0, 623.0 ], [ 25.0, 910.0 ], [ 26.0, 1173.0 ], [ 27.0, 1510.0 ], [ 28.0, 1836.0 ], [ 29.0, 2381.0 ], [ 30.0, 3745.0 ], [ 31.0, 7000.0 ], [ 32.0, 23690.0 ], [ 33.0, 162245.0 ], [ 34.0, 3781.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCFS2", "pairs": [ [ 17.0, 6.0 ], [ 18.0, 47.0 ], [ 19.0, 91.0 ], [ 20.0, 176.0 ], [ 21.0, 301.0 ], [ 22.0, 382.0 ], [ 23.0, 481.0 ], [ 24.0, 574.0 ], [ 25.0, 777.0 ], [ 26.0, 1009.0 ], [ 27.0, 1291.0 ], [ 28.0, 1628.0 ], [ 29.0, 2244.0 ], [ 30.0, 3313.0 ], [ 31.0, 6335.0 ], [ 32.0, 21328.0 ], [ 33.0, 152970.0 ], [ 34.0, 3858.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCMS1", "pairs": [ [ 17.0, 5.0 ], [ 18.0, 45.0 ], [ 19.0, 79.0 ], [ 20.0, 180.0 ], [ 21.0, 309.0 ], [ 22.0, 372.0 ], [ 23.0, 463.0 ], [ 24.0, 641.0 ], [ 25.0, 828.0 ], [ 26.0, 1090.0 ], [ 27.0, 1352.0 ], [ 28.0, 1770.0 ], [ 29.0, 2413.0 ], [ 30.0, 3593.0 ], [ 31.0, 6921.0 ], [ 32.0, 23358.0 ], [ 33.0, 156706.0 ], [ 34.0, 3834.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCMS2", "pairs": [ [ 17.0, 7.0 ], [ 18.0, 35.0 ], [ 19.0, 103.0 ], [ 20.0, 177.0 ], [ 21.0, 296.0 ], [ 22.0, 341.0 ], [ 23.0, 418.0 ], [ 24.0, 585.0 ], [ 25.0, 761.0 ], [ 26.0, 991.0 ], [ 27.0, 1290.0 ], [ 28.0, 1623.0 ], [ 29.0, 2037.0 ], [ 30.0, 3271.0 ], [ 31.0, 6249.0 ], [ 32.0, 21117.0 ], [ 33.0, 148062.0 ], [ 34.0, 3943.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPFS1", "pairs": [ [ 17.0, 4.0 ], [ 18.0, 40.0 ], [ 19.0, 48.0 ], [ 20.0, 136.0 ], [ 21.0, 208.0 ], [ 22.0, 286.0 ], [ 23.0, 370.0 ], [ 24.0, 502.0 ], [ 25.0, 674.0 ], [ 26.0, 829.0 ], [ 27.0, 1156.0 ], [ 28.0, 1345.0 ], [ 29.0, 1948.0 ], [ 30.0, 2914.0 ], [ 31.0, 5431.0 ], [ 32.0, 19517.0 ], [ 33.0, 106800.0 ], [ 34.0, 1734.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPFS2", "pairs": [ [ 17.0, 8.0 ], [ 18.0, 32.0 ], [ 19.0, 72.0 ], [ 20.0, 164.0 ], [ 21.0, 303.0 ], [ 22.0, 401.0 ], [ 23.0, 492.0 ], [ 24.0, 665.0 ], [ 25.0, 880.0 ], [ 26.0, 1247.0 ], [ 27.0, 1590.0 ], [ 28.0, 1990.0 ], [ 29.0, 2640.0 ], [ 30.0, 4220.0 ], [ 31.0, 8801.0 ], [ 32.0, 31902.0 ], [ 33.0, 116117.0 ], [ 34.0, 1516.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPMS1", "pairs": [ [ 17.0, 8.0 ], [ 18.0, 46.0 ], [ 19.0, 119.0 ], [ 20.0, 201.0 ], [ 21.0, 326.0 ], [ 22.0, 407.0 ], [ 23.0, 499.0 ], [ 24.0, 679.0 ], [ 25.0, 917.0 ], [ 26.0, 1183.0 ], [ 27.0, 1477.0 ], [ 28.0, 1930.0 ], [ 29.0, 2602.0 ], [ 30.0, 4206.0 ], [ 31.0, 8379.0 ], [ 32.0, 30034.0 ], [ 33.0, 162782.0 ], [ 34.0, 3221.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPMS2", "pairs": [ [ 16.0, 1.0 ], [ 17.0, 5.0 ], [ 18.0, 47.0 ], [ 19.0, 112.0 ], [ 20.0, 185.0 ], [ 21.0, 366.0 ], [ 22.0, 449.0 ], [ 23.0, 547.0 ], [ 24.0, 752.0 ], [ 25.0, 972.0 ], [ 26.0, 1439.0 ], [ 27.0, 1850.0 ], [ 28.0, 2346.0 ], [ 29.0, 3064.0 ], [ 30.0, 4752.0 ], [ 31.0, 9986.0 ], [ 32.0, 36164.0 ], [ 33.0, 133035.0 ], [ 34.0, 1824.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVFS1", "pairs": [ [ 17.0, 5.0 ], [ 18.0, 44.0 ], [ 19.0, 91.0 ], [ 20.0, 166.0 ], [ 21.0, 283.0 ], [ 22.0, 404.0 ], [ 23.0, 489.0 ], [ 24.0, 624.0 ], [ 25.0, 921.0 ], [ 26.0, 1114.0 ], [ 27.0, 1493.0 ], [ 28.0, 1883.0 ], [ 29.0, 2518.0 ], [ 30.0, 3880.0 ], [ 31.0, 7487.0 ], [ 32.0, 26125.0 ], [ 33.0, 161719.0 ], [ 34.0, 3773.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVFS2", "pairs": [ [ 17.0, 9.0 ], [ 18.0, 46.0 ], [ 19.0, 85.0 ], [ 20.0, 205.0 ], [ 21.0, 278.0 ], [ 22.0, 400.0 ], [ 23.0, 495.0 ], [ 24.0, 605.0 ], [ 25.0, 846.0 ], [ 26.0, 1071.0 ], [ 27.0, 1411.0 ], [ 28.0, 1781.0 ], [ 29.0, 2308.0 ], [ 30.0, 3567.0 ], [ 31.0, 6724.0 ], [ 32.0, 22938.0 ], [ 33.0, 154001.0 ], [ 34.0, 3964.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVMS1", "pairs": [ [ 17.0, 11.0 ], [ 18.0, 43.0 ], [ 19.0, 87.0 ], [ 20.0, 169.0 ], [ 21.0, 280.0 ], [ 22.0, 348.0 ], [ 23.0, 431.0 ], [ 24.0, 581.0 ], [ 25.0, 749.0 ], [ 26.0, 998.0 ], [ 27.0, 1296.0 ], [ 28.0, 1631.0 ], [ 29.0, 2158.0 ], [ 30.0, 3343.0 ], [ 31.0, 6517.0 ], [ 32.0, 22580.0 ], [ 33.0, 133734.0 ], [ 34.0, 3215.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVMS2", "pairs": [ [ 17.0, 9.0 ], [ 18.0, 61.0 ], [ 19.0, 116.0 ], [ 20.0, 228.0 ], [ 21.0, 380.0 ], [ 22.0, 515.0 ], [ 23.0, 520.0 ], [ 24.0, 691.0 ], [ 25.0, 953.0 ], [ 26.0, 1278.0 ], [ 27.0, 1591.0 ], [ 28.0, 2060.0 ], [ 29.0, 2578.0 ], [ 30.0, 3925.0 ], [ 31.0, 7697.0 ], [ 32.0, 25688.0 ], [ 33.0, 168660.0 ], [ 34.0, 4640.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAFS1", "pairs": [ [ 22.0, 4.0 ], [ 23.0, 12.0 ], [ 24.0, 20.0 ], [ 25.0, 48.0 ], [ 26.0, 69.0 ], [ 27.0, 83.0 ], [ 28.0, 112.0 ], [ 29.0, 157.0 ], [ 30.0, 207.0 ], [ 31.0, 254.0 ], [ 32.0, 323.0 ], [ 33.0, 426.0 ], [ 34.0, 598.0 ], [ 35.0, 838.0 ], [ 36.0, 1185.0 ], [ 37.0, 1789.0 ], [ 38.0, 3904.0 ], [ 39.0, 74609.0 ], [ 40.0, 2682.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAFS2", "pairs": [ [ 22.0, 1.0 ], [ 23.0, 3.0 ], [ 24.0, 14.0 ], [ 25.0, 13.0 ], [ 26.0, 15.0 ], [ 27.0, 36.0 ], [ 28.0, 50.0 ], [ 29.0, 64.0 ], [ 30.0, 61.0 ], [ 31.0, 96.0 ], [ 32.0, 147.0 ], [ 33.0, 169.0 ], [ 34.0, 259.0 ], [ 35.0, 349.0 ], [ 36.0, 497.0 ], [ 37.0, 795.0 ], [ 38.0, 1613.0 ], [ 39.0, 31143.0 ], [ 40.0, 1163.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAMS1", "pairs": [ [ 22.0, 3.0 ], [ 23.0, 6.0 ], [ 24.0, 16.0 ], [ 25.0, 23.0 ], [ 26.0, 37.0 ], [ 27.0, 51.0 ], [ 28.0, 70.0 ], [ 29.0, 113.0 ], [ 30.0, 160.0 ], [ 31.0, 212.0 ], [ 32.0, 244.0 ], [ 33.0, 308.0 ], [ 34.0, 468.0 ], [ 35.0, 534.0 ], [ 36.0, 892.0 ], [ 37.0, 1434.0 ], [ 38.0, 2963.0 ], [ 39.0, 51977.0 ], [ 40.0, 2024.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAMS2", "pairs": [ [ 22.0, 3.0 ], [ 23.0, 10.0 ], [ 24.0, 28.0 ], [ 25.0, 29.0 ], [ 26.0, 59.0 ], [ 27.0, 74.0 ], [ 28.0, 98.0 ], [ 29.0, 134.0 ], [ 30.0, 168.0 ], [ 31.0, 271.0 ], [ 32.0, 339.0 ], [ 33.0, 476.0 ], [ 34.0, 649.0 ], [ 35.0, 822.0 ], [ 36.0, 1069.0 ], [ 37.0, 1710.0 ], [ 38.0, 3625.0 ], [ 39.0, 66003.0 ], [ 40.0, 2462.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCFS1", "pairs": [ [ 17.0, 3.0 ], [ 18.0, 29.0 ], [ 19.0, 62.0 ], [ 20.0, 119.0 ], [ 21.0, 203.0 ], [ 22.0, 260.0 ], [ 23.0, 329.0 ], [ 24.0, 425.0 ], [ 25.0, 505.0 ], [ 26.0, 678.0 ], [ 27.0, 858.0 ], [ 28.0, 1180.0 ], [ 29.0, 1598.0 ], [ 30.0, 2484.0 ], [ 31.0, 4759.0 ], [ 32.0, 17933.0 ], [ 33.0, 83298.0 ], [ 34.0, 1649.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCFS2", "pairs": [ [ 17.0, 1.0 ], [ 18.0, 9.0 ], [ 19.0, 43.0 ], [ 20.0, 69.0 ], [ 21.0, 119.0 ], [ 22.0, 133.0 ], [ 23.0, 195.0 ], [ 24.0, 227.0 ], [ 25.0, 291.0 ], [ 26.0, 367.0 ], [ 27.0, 511.0 ], [ 28.0, 653.0 ], [ 29.0, 791.0 ], [ 30.0, 1304.0 ], [ 31.0, 2562.0 ], [ 32.0, 9464.0 ], [ 33.0, 47038.0 ], [ 34.0, 1124.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCMS1", "pairs": [ [ 16.0, 2.0 ], [ 17.0, 9.0 ], [ 18.0, 59.0 ], [ 19.0, 145.0 ], [ 20.0, 268.0 ], [ 21.0, 447.0 ], [ 22.0, 512.0 ], [ 23.0, 624.0 ], [ 24.0, 788.0 ], [ 25.0, 1120.0 ], [ 26.0, 1420.0 ], [ 27.0, 1853.0 ], [ 28.0, 2327.0 ], [ 29.0, 3027.0 ], [ 30.0, 4820.0 ], [ 31.0, 9643.0 ], [ 32.0, 34840.0 ], [ 33.0, 166378.0 ], [ 34.0, 3405.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCMS2", "pairs": [ [ 16.0, 1.0 ], [ 17.0, 3.0 ], [ 18.0, 30.0 ], [ 19.0, 50.0 ], [ 20.0, 91.0 ], [ 21.0, 138.0 ], [ 22.0, 177.0 ], [ 23.0, 210.0 ], [ 24.0, 288.0 ], [ 25.0, 387.0 ], [ 26.0, 485.0 ], [ 27.0, 622.0 ], [ 28.0, 857.0 ], [ 29.0, 1085.0 ], [ 30.0, 1713.0 ], [ 31.0, 3353.0 ], [ 32.0, 12167.0 ], [ 33.0, 62911.0 ], [ 34.0, 1546.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPFS1", "pairs": [ [ 17.0, 5.0 ], [ 18.0, 40.0 ], [ 19.0, 64.0 ], [ 20.0, 139.0 ], [ 21.0, 235.0 ], [ 22.0, 285.0 ], [ 23.0, 359.0 ], [ 24.0, 476.0 ], [ 25.0, 587.0 ], [ 26.0, 785.0 ], [ 27.0, 1118.0 ], [ 28.0, 1369.0 ], [ 29.0, 1825.0 ], [ 30.0, 2781.0 ], [ 31.0, 5208.0 ], [ 32.0, 19636.0 ], [ 33.0, 99297.0 ], [ 34.0, 2068.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPFS2", "pairs": [ [ 17.0, 7.0 ], [ 18.0, 28.0 ], [ 19.0, 71.0 ], [ 20.0, 134.0 ], [ 21.0, 193.0 ], [ 22.0, 242.0 ], [ 23.0, 326.0 ], [ 24.0, 448.0 ], [ 25.0, 590.0 ], [ 26.0, 735.0 ], [ 27.0, 1029.0 ], [ 28.0, 1240.0 ], [ 29.0, 1685.0 ], [ 30.0, 2573.0 ], [ 31.0, 5264.0 ], [ 32.0, 19651.0 ], [ 33.0, 88001.0 ], [ 34.0, 1566.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPMS1", "pairs": [ [ 17.0, 1.0 ], [ 18.0, 11.0 ], [ 19.0, 21.0 ], [ 20.0, 34.0 ], [ 21.0, 35.0 ], [ 22.0, 49.0 ], [ 23.0, 67.0 ], [ 24.0, 92.0 ], [ 25.0, 143.0 ], [ 26.0, 189.0 ], [ 27.0, 326.0 ], [ 28.0, 417.0 ], [ 29.0, 611.0 ], [ 30.0, 1030.0 ], [ 31.0, 2271.0 ], [ 32.0, 9391.0 ], [ 33.0, 62151.0 ], [ 34.0, 2458.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPMS2", "pairs": [ [ 17.0, 4.0 ], [ 18.0, 25.0 ], [ 19.0, 52.0 ], [ 20.0, 98.0 ], [ 21.0, 143.0 ], [ 22.0, 194.0 ], [ 23.0, 205.0 ], [ 24.0, 272.0 ], [ 25.0, 390.0 ], [ 26.0, 520.0 ], [ 27.0, 658.0 ], [ 28.0, 785.0 ], [ 29.0, 1090.0 ], [ 30.0, 1810.0 ], [ 31.0, 3632.0 ], [ 32.0, 13191.0 ], [ 33.0, 58981.0 ], [ 34.0, 1063.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVFS1", "pairs": [ [ 17.0, 4.0 ], [ 18.0, 14.0 ], [ 19.0, 42.0 ], [ 20.0, 69.0 ], [ 21.0, 105.0 ], [ 22.0, 126.0 ], [ 23.0, 181.0 ], [ 24.0, 244.0 ], [ 25.0, 318.0 ], [ 26.0, 408.0 ], [ 27.0, 507.0 ], [ 28.0, 609.0 ], [ 29.0, 857.0 ], [ 30.0, 1360.0 ], [ 31.0, 2747.0 ], [ 32.0, 9890.0 ], [ 33.0, 50326.0 ], [ 34.0, 1084.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVFS2", "pairs": [ [ 17.0, 4.0 ], [ 18.0, 28.0 ], [ 19.0, 51.0 ], [ 20.0, 106.0 ], [ 21.0, 150.0 ], [ 22.0, 205.0 ], [ 23.0, 264.0 ], [ 24.0, 295.0 ], [ 25.0, 433.0 ], [ 26.0, 552.0 ], [ 27.0, 726.0 ], [ 28.0, 942.0 ], [ 29.0, 1258.0 ], [ 30.0, 1808.0 ], [ 31.0, 3877.0 ], [ 32.0, 13727.0 ], [ 33.0, 69684.0 ], [ 34.0, 1648.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVMS1", "pairs": [ [ 17.0, 8.0 ], [ 18.0, 41.0 ], [ 19.0, 90.0 ], [ 20.0, 160.0 ], [ 21.0, 246.0 ], [ 22.0, 284.0 ], [ 23.0, 422.0 ], [ 24.0, 501.0 ], [ 25.0, 710.0 ], [ 26.0, 897.0 ], [ 27.0, 1223.0 ], [ 28.0, 1468.0 ], [ 29.0, 1988.0 ], [ 30.0, 3056.0 ], [ 31.0, 6050.0 ], [ 32.0, 21695.0 ], [ 33.0, 116419.0 ], [ 34.0, 2487.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVMS2", "pairs": [ [ 17.0, 5.0 ], [ 18.0, 32.0 ], [ 19.0, 82.0 ], [ 20.0, 162.0 ], [ 21.0, 268.0 ], [ 22.0, 298.0 ], [ 23.0, 354.0 ], [ 24.0, 517.0 ], [ 25.0, 689.0 ], [ 26.0, 874.0 ], [ 27.0, 1100.0 ], [ 28.0, 1417.0 ], [ 29.0, 1882.0 ], [ 30.0, 2902.0 ], [ 31.0, 5647.0 ], [ 32.0, 20259.0 ], [ 33.0, 114156.0 ], [ 34.0, 2982.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAFS1", "pairs": [ [ 21.0, 1.0 ], [ 22.0, 9.0 ], [ 23.0, 19.0 ], [ 24.0, 37.0 ], [ 25.0, 69.0 ], [ 26.0, 115.0 ], [ 27.0, 122.0 ], [ 28.0, 203.0 ], [ 29.0, 259.0 ], [ 30.0, 343.0 ], [ 31.0, 514.0 ], [ 32.0, 635.0 ], [ 33.0, 854.0 ], [ 34.0, 1103.0 ], [ 35.0, 1443.0 ], [ 36.0, 2069.0 ], [ 37.0, 3271.0 ], [ 38.0, 7186.0 ], [ 39.0, 139177.0 ], [ 40.0, 3200.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAFS2", "pairs": [ [ 21.0, 2.0 ], [ 22.0, 4.0 ], [ 23.0, 16.0 ], [ 24.0, 30.0 ], [ 25.0, 51.0 ], [ 26.0, 84.0 ], [ 27.0, 111.0 ], [ 28.0, 141.0 ], [ 29.0, 220.0 ], [ 30.0, 273.0 ], [ 31.0, 332.0 ], [ 32.0, 497.0 ], [ 33.0, 668.0 ], [ 34.0, 843.0 ], [ 35.0, 1132.0 ], [ 36.0, 1653.0 ], [ 37.0, 2592.0 ], [ 38.0, 5714.0 ], [ 39.0, 108136.0 ], [ 40.0, 2453.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAMS1", "pairs": [ [ 22.0, 4.0 ], [ 23.0, 23.0 ], [ 24.0, 44.0 ], [ 25.0, 78.0 ], [ 26.0, 87.0 ], [ 27.0, 132.0 ], [ 28.0, 173.0 ], [ 29.0, 254.0 ], [ 30.0, 353.0 ], [ 31.0, 442.0 ], [ 32.0, 596.0 ], [ 33.0, 829.0 ], [ 34.0, 1101.0 ], [ 35.0, 1453.0 ], [ 36.0, 2109.0 ], [ 37.0, 3298.0 ], [ 38.0, 7246.0 ], [ 39.0, 127461.0 ], [ 40.0, 2338.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAMS2", "pairs": [ [ 22.0, 6.0 ], [ 23.0, 14.0 ], [ 24.0, 41.0 ], [ 25.0, 57.0 ], [ 26.0, 97.0 ], [ 27.0, 144.0 ], [ 28.0, 182.0 ], [ 29.0, 258.0 ], [ 30.0, 347.0 ], [ 31.0, 419.0 ], [ 32.0, 580.0 ], [ 33.0, 731.0 ], [ 34.0, 1030.0 ], [ 35.0, 1377.0 ], [ 36.0, 2003.0 ], [ 37.0, 3143.0 ], [ 38.0, 6551.0 ], [ 39.0, 127307.0 ], [ 40.0, 4126.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICFS1", "pairs": [ [ 17.0, 7.0 ], [ 18.0, 30.0 ], [ 19.0, 73.0 ], [ 20.0, 120.0 ], [ 21.0, 187.0 ], [ 22.0, 281.0 ], [ 23.0, 371.0 ], [ 24.0, 441.0 ], [ 25.0, 575.0 ], [ 26.0, 780.0 ], [ 27.0, 1031.0 ], [ 28.0, 1351.0 ], [ 29.0, 1713.0 ], [ 30.0, 2684.0 ], [ 31.0, 5261.0 ], [ 32.0, 18742.0 ], [ 33.0, 98632.0 ], [ 34.0, 2181.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICFS2", "pairs": [ [ 17.0, 5.0 ], [ 18.0, 39.0 ], [ 19.0, 67.0 ], [ 20.0, 164.0 ], [ 21.0, 267.0 ], [ 22.0, 314.0 ], [ 23.0, 420.0 ], [ 24.0, 539.0 ], [ 25.0, 703.0 ], [ 26.0, 956.0 ], [ 27.0, 1251.0 ], [ 28.0, 1602.0 ], [ 29.0, 2098.0 ], [ 30.0, 3209.0 ], [ 31.0, 6427.0 ], [ 32.0, 23408.0 ], [ 33.0, 123390.0 ], [ 34.0, 2207.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICMS1", "pairs": [ [ 17.0, 9.0 ], [ 18.0, 50.0 ], [ 19.0, 80.0 ], [ 20.0, 176.0 ], [ 21.0, 329.0 ], [ 22.0, 366.0 ], [ 23.0, 458.0 ], [ 24.0, 610.0 ], [ 25.0, 816.0 ], [ 26.0, 1109.0 ], [ 27.0, 1460.0 ], [ 28.0, 1762.0 ], [ 29.0, 2472.0 ], [ 30.0, 3715.0 ], [ 31.0, 7236.0 ], [ 32.0, 25757.0 ], [ 33.0, 139471.0 ], [ 34.0, 2380.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICMS2", "pairs": [ [ 17.0, 9.0 ], [ 18.0, 23.0 ], [ 19.0, 46.0 ], [ 20.0, 99.0 ], [ 21.0, 169.0 ], [ 22.0, 222.0 ], [ 23.0, 288.0 ], [ 24.0, 403.0 ], [ 25.0, 541.0 ], [ 26.0, 746.0 ], [ 27.0, 928.0 ], [ 28.0, 1185.0 ], [ 29.0, 1628.0 ], [ 30.0, 2405.0 ], [ 31.0, 4955.0 ], [ 32.0, 18455.0 ], [ 33.0, 88053.0 ], [ 34.0, 993.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPFS1", "pairs": [ [ 17.0, 6.0 ], [ 18.0, 33.0 ], [ 19.0, 92.0 ], [ 20.0, 163.0 ], [ 21.0, 256.0 ], [ 22.0, 334.0 ], [ 23.0, 408.0 ], [ 24.0, 535.0 ], [ 25.0, 706.0 ], [ 26.0, 932.0 ], [ 27.0, 1307.0 ], [ 28.0, 1524.0 ], [ 29.0, 2126.0 ], [ 30.0, 3355.0 ], [ 31.0, 6739.0 ], [ 32.0, 25055.0 ], [ 33.0, 109492.0 ], [ 34.0, 2120.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPFS2", "pairs": [ [ 17.0, 6.0 ], [ 18.0, 57.0 ], [ 19.0, 111.0 ], [ 20.0, 169.0 ], [ 21.0, 361.0 ], [ 22.0, 439.0 ], [ 23.0, 527.0 ], [ 24.0, 670.0 ], [ 25.0, 921.0 ], [ 26.0, 1200.0 ], [ 27.0, 1601.0 ], [ 28.0, 1933.0 ], [ 29.0, 2587.0 ], [ 30.0, 3904.0 ], [ 31.0, 7494.0 ], [ 32.0, 25492.0 ], [ 33.0, 166139.0 ], [ 34.0, 3964.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPMS1", "pairs": [ [ 17.0, 15.0 ], [ 18.0, 67.0 ], [ 19.0, 139.0 ], [ 20.0, 264.0 ], [ 21.0, 467.0 ], [ 22.0, 600.0 ], [ 23.0, 747.0 ], [ 24.0, 904.0 ], [ 25.0, 1448.0 ], [ 26.0, 1928.0 ], [ 27.0, 2665.0 ], [ 28.0, 3326.0 ], [ 29.0, 4156.0 ], [ 30.0, 6122.0 ], [ 31.0, 12122.0 ], [ 32.0, 44411.0 ], [ 33.0, 250128.0 ], [ 34.0, 4569.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPMS2", "pairs": [ [ 17.0, 12.0 ], [ 18.0, 64.0 ], [ 19.0, 113.0 ], [ 20.0, 218.0 ], [ 21.0, 426.0 ], [ 22.0, 440.0 ], [ 23.0, 566.0 ], [ 24.0, 759.0 ], [ 25.0, 1019.0 ], [ 26.0, 1450.0 ], [ 27.0, 1748.0 ], [ 28.0, 2298.0 ], [ 29.0, 2885.0 ], [ 30.0, 4382.0 ], [ 31.0, 8261.0 ], [ 32.0, 29404.0 ], [ 33.0, 177171.0 ], [ 34.0, 5148.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVFS1", "pairs": [ [ 17.0, 6.0 ], [ 18.0, 44.0 ], [ 19.0, 106.0 ], [ 20.0, 181.0 ], [ 21.0, 314.0 ], [ 22.0, 408.0 ], [ 23.0, 507.0 ], [ 24.0, 655.0 ], [ 25.0, 977.0 ], [ 26.0, 1368.0 ], [ 27.0, 1666.0 ], [ 28.0, 2130.0 ], [ 29.0, 2753.0 ], [ 30.0, 4180.0 ], [ 31.0, 8298.0 ], [ 32.0, 29257.0 ], [ 33.0, 164646.0 ], [ 34.0, 3921.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVFS2", "pairs": [ [ 17.0, 9.0 ], [ 18.0, 28.0 ], [ 19.0, 79.0 ], [ 20.0, 142.0 ], [ 21.0, 208.0 ], [ 22.0, 228.0 ], [ 23.0, 287.0 ], [ 24.0, 372.0 ], [ 25.0, 598.0 ], [ 26.0, 693.0 ], [ 27.0, 943.0 ], [ 28.0, 1202.0 ], [ 29.0, 1618.0 ], [ 30.0, 2556.0 ], [ 31.0, 5110.0 ], [ 32.0, 18506.0 ], [ 33.0, 88236.0 ], [ 34.0, 2061.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVMS1", "pairs": [ [ 17.0, 9.0 ], [ 18.0, 29.0 ], [ 19.0, 89.0 ], [ 20.0, 157.0 ], [ 21.0, 273.0 ], [ 22.0, 337.0 ], [ 23.0, 398.0 ], [ 24.0, 553.0 ], [ 25.0, 681.0 ], [ 26.0, 969.0 ], [ 27.0, 1240.0 ], [ 28.0, 1576.0 ], [ 29.0, 2101.0 ], [ 30.0, 3107.0 ], [ 31.0, 6265.0 ], [ 32.0, 22538.0 ], [ 33.0, 107653.0 ], [ 34.0, 1811.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVMS2", "pairs": [ [ 17.0, 5.0 ], [ 18.0, 30.0 ], [ 19.0, 59.0 ], [ 20.0, 133.0 ], [ 21.0, 174.0 ], [ 22.0, 218.0 ], [ 23.0, 314.0 ], [ 24.0, 369.0 ], [ 25.0, 473.0 ], [ 26.0, 663.0 ], [ 27.0, 815.0 ], [ 28.0, 1031.0 ], [ 29.0, 1382.0 ], [ 30.0, 2092.0 ], [ 31.0, 4350.0 ], [ 32.0, 15378.0 ], [ 33.0, 76501.0 ], [ 34.0, 1936.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAFS1", "pairs": [ [ 21.0, 3.0 ], [ 22.0, 4.0 ], [ 23.0, 23.0 ], [ 24.0, 38.0 ], [ 25.0, 56.0 ], [ 26.0, 90.0 ], [ 27.0, 108.0 ], [ 28.0, 175.0 ], [ 29.0, 203.0 ], [ 30.0, 273.0 ], [ 31.0, 365.0 ], [ 32.0, 513.0 ], [ 33.0, 730.0 ], [ 34.0, 956.0 ], [ 35.0, 1232.0 ], [ 36.0, 1831.0 ], [ 37.0, 2800.0 ], [ 38.0, 6250.0 ], [ 39.0, 110887.0 ], [ 40.0, 2722.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAFS2", "pairs": [ [ 22.0, 3.0 ], [ 23.0, 11.0 ], [ 24.0, 14.0 ], [ 25.0, 30.0 ], [ 26.0, 34.0 ], [ 27.0, 77.0 ], [ 28.0, 107.0 ], [ 29.0, 151.0 ], [ 30.0, 167.0 ], [ 31.0, 236.0 ], [ 32.0, 330.0 ], [ 33.0, 364.0 ], [ 34.0, 583.0 ], [ 35.0, 765.0 ], [ 36.0, 1063.0 ], [ 37.0, 1674.0 ], [ 38.0, 3644.0 ], [ 39.0, 71331.0 ], [ 40.0, 1701.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAMS1", "pairs": [ [ 22.0, 12.0 ], [ 23.0, 23.0 ], [ 24.0, 42.0 ], [ 25.0, 55.0 ], [ 26.0, 103.0 ], [ 27.0, 145.0 ], [ 28.0, 203.0 ], [ 29.0, 282.0 ], [ 30.0, 362.0 ], [ 31.0, 525.0 ], [ 32.0, 658.0 ], [ 33.0, 901.0 ], [ 34.0, 1087.0 ], [ 35.0, 1486.0 ], [ 36.0, 2209.0 ], [ 37.0, 3377.0 ], [ 38.0, 7006.0 ], [ 39.0, 134443.0 ], [ 40.0, 6672.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAMS2", "pairs": [ [ 21.0, 4.0 ], [ 22.0, 7.0 ], [ 23.0, 29.0 ], [ 24.0, 43.0 ], [ 25.0, 81.0 ], [ 26.0, 109.0 ], [ 27.0, 153.0 ], [ 28.0, 204.0 ], [ 29.0, 242.0 ], [ 30.0, 332.0 ], [ 31.0, 436.0 ], [ 32.0, 589.0 ], [ 33.0, 778.0 ], [ 34.0, 1093.0 ], [ 35.0, 1446.0 ], [ 36.0, 1998.0 ], [ 37.0, 3050.0 ], [ 38.0, 6387.0 ], [ 39.0, 121522.0 ], [ 40.0, 5440.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCFS1", "pairs": [ [ 16.0, 1.0 ], [ 17.0, 6.0 ], [ 18.0, 53.0 ], [ 19.0, 106.0 ], [ 20.0, 202.0 ], [ 21.0, 281.0 ], [ 22.0, 356.0 ], [ 23.0, 485.0 ], [ 24.0, 609.0 ], [ 25.0, 827.0 ], [ 26.0, 1040.0 ], [ 27.0, 1441.0 ], [ 28.0, 1793.0 ], [ 29.0, 2397.0 ], [ 30.0, 3767.0 ], [ 31.0, 7600.0 ], [ 32.0, 27255.0 ], [ 33.0, 130163.0 ], [ 34.0, 3284.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCFS2", "pairs": [ [ 17.0, 2.0 ], [ 18.0, 40.0 ], [ 19.0, 92.0 ], [ 20.0, 156.0 ], [ 21.0, 287.0 ], [ 22.0, 291.0 ], [ 23.0, 382.0 ], [ 24.0, 477.0 ], [ 25.0, 649.0 ], [ 26.0, 894.0 ], [ 27.0, 1164.0 ], [ 28.0, 1438.0 ], [ 29.0, 1880.0 ], [ 30.0, 2940.0 ], [ 31.0, 5972.0 ], [ 32.0, 21244.0 ], [ 33.0, 105926.0 ], [ 34.0, 2730.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCMS1", "pairs": [ [ 17.0, 6.0 ], [ 18.0, 34.0 ], [ 19.0, 94.0 ], [ 20.0, 161.0 ], [ 21.0, 229.0 ], [ 22.0, 319.0 ], [ 23.0, 397.0 ], [ 24.0, 519.0 ], [ 25.0, 694.0 ], [ 26.0, 865.0 ], [ 27.0, 1141.0 ], [ 28.0, 1474.0 ], [ 29.0, 1968.0 ], [ 30.0, 3001.0 ], [ 31.0, 6205.0 ], [ 32.0, 22454.0 ], [ 33.0, 113371.0 ], [ 34.0, 2859.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCMS2", "pairs": [ [ 17.0, 5.0 ], [ 18.0, 28.0 ], [ 19.0, 58.0 ], [ 20.0, 146.0 ], [ 21.0, 202.0 ], [ 22.0, 267.0 ], [ 23.0, 327.0 ], [ 24.0, 384.0 ], [ 25.0, 535.0 ], [ 26.0, 719.0 ], [ 27.0, 903.0 ], [ 28.0, 1130.0 ], [ 29.0, 1501.0 ], [ 30.0, 2498.0 ], [ 31.0, 4799.0 ], [ 32.0, 17026.0 ], [ 33.0, 90301.0 ], [ 34.0, 2350.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPFS1", "pairs": [ [ 17.0, 9.0 ], [ 18.0, 66.0 ], [ 19.0, 125.0 ], [ 20.0, 237.0 ], [ 21.0, 358.0 ], [ 22.0, 470.0 ], [ 23.0, 593.0 ], [ 24.0, 800.0 ], [ 25.0, 1017.0 ], [ 26.0, 1312.0 ], [ 27.0, 1750.0 ], [ 28.0, 2171.0 ], [ 29.0, 2887.0 ], [ 30.0, 4588.0 ], [ 31.0, 9197.0 ], [ 32.0, 33098.0 ], [ 33.0, 163629.0 ], [ 34.0, 3960.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPFS2", "pairs": [ [ 16.0, 1.0 ], [ 17.0, 8.0 ], [ 18.0, 41.0 ], [ 19.0, 110.0 ], [ 20.0, 220.0 ], [ 21.0, 309.0 ], [ 22.0, 416.0 ], [ 23.0, 491.0 ], [ 24.0, 616.0 ], [ 25.0, 842.0 ], [ 26.0, 1104.0 ], [ 27.0, 1444.0 ], [ 28.0, 1765.0 ], [ 29.0, 2473.0 ], [ 30.0, 3809.0 ], [ 31.0, 7729.0 ], [ 32.0, 27647.0 ], [ 33.0, 142995.0 ], [ 34.0, 3497.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPMS1", "pairs": [ [ 17.0, 6.0 ], [ 18.0, 54.0 ], [ 19.0, 127.0 ], [ 20.0, 221.0 ], [ 21.0, 332.0 ], [ 22.0, 436.0 ], [ 23.0, 552.0 ], [ 24.0, 678.0 ], [ 25.0, 878.0 ], [ 26.0, 1130.0 ], [ 27.0, 1545.0 ], [ 28.0, 1939.0 ], [ 29.0, 2603.0 ], [ 30.0, 4006.0 ], [ 31.0, 7953.0 ], [ 32.0, 28433.0 ], [ 33.0, 149978.0 ], [ 34.0, 3692.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPMS2", "pairs": [ [ 17.0, 5.0 ], [ 18.0, 33.0 ], [ 19.0, 68.0 ], [ 20.0, 137.0 ], [ 21.0, 223.0 ], [ 22.0, 235.0 ], [ 23.0, 372.0 ], [ 24.0, 454.0 ], [ 25.0, 537.0 ], [ 26.0, 734.0 ], [ 27.0, 914.0 ], [ 28.0, 1217.0 ], [ 29.0, 1658.0 ], [ 30.0, 2575.0 ], [ 31.0, 5075.0 ], [ 32.0, 18276.0 ], [ 33.0, 94801.0 ], [ 34.0, 2405.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVFS1", "pairs": [ [ 17.0, 4.0 ], [ 18.0, 34.0 ], [ 19.0, 64.0 ], [ 20.0, 123.0 ], [ 21.0, 173.0 ], [ 22.0, 215.0 ], [ 23.0, 262.0 ], [ 24.0, 379.0 ], [ 25.0, 501.0 ], [ 26.0, 640.0 ], [ 27.0, 823.0 ], [ 28.0, 1067.0 ], [ 29.0, 1412.0 ], [ 30.0, 2109.0 ], [ 31.0, 4317.0 ], [ 32.0, 15258.0 ], [ 33.0, 76448.0 ], [ 34.0, 1883.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVFS2", "pairs": [ [ 17.0, 4.0 ], [ 18.0, 31.0 ], [ 19.0, 71.0 ], [ 20.0, 147.0 ], [ 21.0, 194.0 ], [ 22.0, 301.0 ], [ 23.0, 352.0 ], [ 24.0, 524.0 ], [ 25.0, 755.0 ], [ 26.0, 1085.0 ], [ 27.0, 1456.0 ], [ 28.0, 1838.0 ], [ 29.0, 2326.0 ], [ 30.0, 3588.0 ], [ 31.0, 7848.0 ], [ 32.0, 29051.0 ], [ 33.0, 93943.0 ], [ 34.0, 1026.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVMS1", "pairs": [ [ 16.0, 1.0 ], [ 17.0, 16.0 ], [ 18.0, 74.0 ], [ 19.0, 166.0 ], [ 20.0, 392.0 ], [ 21.0, 583.0 ], [ 22.0, 654.0 ], [ 23.0, 899.0 ], [ 24.0, 1144.0 ], [ 25.0, 1444.0 ], [ 26.0, 1833.0 ], [ 27.0, 2593.0 ], [ 28.0, 3148.0 ], [ 29.0, 4269.0 ], [ 30.0, 6730.0 ], [ 31.0, 13427.0 ], [ 32.0, 47576.0 ], [ 33.0, 244660.0 ], [ 34.0, 6211.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVMS2", "pairs": [ [ 17.0, 8.0 ], [ 18.0, 32.0 ], [ 19.0, 66.0 ], [ 20.0, 138.0 ], [ 21.0, 203.0 ], [ 22.0, 256.0 ], [ 23.0, 316.0 ], [ 24.0, 443.0 ], [ 25.0, 664.0 ], [ 26.0, 823.0 ], [ 27.0, 1150.0 ], [ 28.0, 1362.0 ], [ 29.0, 1843.0 ], [ 30.0, 3083.0 ], [ 31.0, 6726.0 ], [ 32.0, 23886.0 ], [ 33.0, 71033.0 ], [ 34.0, 855.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null } ] } ], "pconfig": { "id": "fastqc_per_sequence_quality_scores_plot", "title": "FastQC: Per Sequence Quality Scores", "anchor": null, "table_title": null, "height": null, "width": null, "square": false, "logswitch": false, "logswitch_active": false, "logswitch_label": "Log10", "cpswitch": true, "cpswitch_c_active": true, "cpswitch_counts_label": "Counts", "cpswitch_percent_label": "Percentages", "xLog": null, "yLog": null, "xlog": false, "ylog": false, "data_labels": [], "xTitle": null, "yTitle": null, "xlab": "Mean Sequence Quality (Phred Score)", "ylab": "Count", "xsuffix": null, "ysuffix": null, "tt_suffix": null, "xLabFormat": null, "yLabFormat": null, "xLabelFormat": null, "yLabelFormat": null, "xlab_format": null, "ylab_format": null, "tt_label": "Phred {point.x}: {point.y} reads", "xDecimals": null, "yDecimals": null, "decimalPlaces": null, "x_decimals": 0, "y_decimals": null, "tt_decimals": null, "xmin": 0, "xmax": null, "ymin": 0, "ymax": null, "xFloor": null, "xCeiling": null, "yFloor": null, "yCeiling": null, "x_clipmin": null, "x_clipmax": null, "y_clipmin": null, "y_clipmax": null, "save_data_file": true, "showlegend": false, "xMinRange": null, "yMinRange": null, "x_minrange": null, "y_minrange": null, "xPlotBands": null, "yPlotBands": null, "xPlotLines": null, "yPlotLines": null, "x_bands": [ { "from_": 28, "to": 100, "color": "#c3e6c3" }, { "from_": 20, "to": 28, "color": "#e6dcc3" }, { "from_": 0, "to": 20, "color": "#e6c3c3" } ], "y_bands": null, "x_lines": null, "y_lines": null, "categories": false, "smooth_points": 500, "smooth_points_sumcounts": null, "extra_series": null, "style": null, "hide_zero_cats": false, "hide_empty": false, "colors": { "CVFS2": "#5cb85c", "JPFS1": "#5cb85c", "CCMS1": "#5cb85c", "ICFS1": "#5cb85c", "CCFS2": "#5cb85c", "IAFS2": "#5cb85c", "DVMS1": "#5cb85c", "DVMS2": "#5cb85c", "DCMS2": "#5cb85c", "JCMS1": "#5cb85c", "JCFS1": "#5cb85c", "DPMS1": "#5cb85c", "CAFS2": "#5cb85c", "DAMS1": "#5cb85c", "JAMS2": "#5cb85c", "IPMS1": "#5cb85c", "DCMS1": "#5cb85c", "CAFS1": "#5cb85c", "IPFS1": "#5cb85c", "JVFS1": "#5cb85c", "IVFS2": "#5cb85c", "DVFS1": "#5cb85c", "DPFS2": "#5cb85c", "CVMS1": "#5cb85c", "JVFS2": "#5cb85c", "CPMS1": "#5cb85c", "ICMS1": "#5cb85c", "CVMS2": "#5cb85c", "ICMS2": "#5cb85c", "DCFS2": "#5cb85c", "CCFS1": "#5cb85c", "CCMS2": "#5cb85c", "JVMS1": "#5cb85c", "CPFS2": "#5cb85c", "IAFS1": "#5cb85c", "CAMS1": "#5cb85c", "JPMS2": "#5cb85c", "IAMS1": "#5cb85c", "DAFS1": "#5cb85c", "DAFS2": "#5cb85c", "IAMS2": "#5cb85c", "JVMS2": "#5cb85c", "ICFS2": "#5cb85c", "IPMS2": "#5cb85c", "DPFS1": "#5cb85c", "DCFS1": "#5cb85c", "JCMS2": "#5cb85c", "JPMS1": "#5cb85c", "JAFS1": "#5cb85c", "JCFS2": "#5cb85c", "DPMS2": "#5cb85c", "CAMS2": "#5cb85c", "DAMS2": "#5cb85c", "IVMS1": "#5cb85c", "CPMS2": "#5cb85c", "CPFS1": "#5cb85c", "IVFS1": "#5cb85c", "CVFS1": "#5cb85c", "IVMS2": "#5cb85c", "IPFS2": "#5cb85c", "JAFS2": "#5cb85c", "JAMS1": "#5cb85c", "DVFS2": "#5cb85c", "JPFS2": "#5cb85c" } }, "add_log_tab": false, "add_pct_tab": false, "l_active": false, "p_active": false, "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "yaxis" ], "square": false, "flat": false, "defer_render": false }, "fastqc_per_sequence_gc_content_plot": { "id": "fastqc_per_sequence_gc_content_plot", "anchor": "fastqc_per_sequence_gc_content_plot", "plot_type": "xy_line", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 500, "hoverlabel": { "namelength": -1 }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "white", "plot_bgcolor": "white", "showlegend": false, "title": { "font": { "size": 20 }, "text": "FastQC: Per Sequence GC Content", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "hoverdistance": -1 }, "datasets": [ { "plot_id": "fastqc_per_sequence_gc_content_plot", "label": "Percentages", "uid": "fastqc_per_sequence_gc_content_plot_Percentages", "dconfig": { "name": "Percentages", "ylab": "Percentage", "tt_suffix": "%", "title": "FastQC: Per Sequence GC Content
Percentages, 64 samples" }, "layout": { "title": { "text": "FastQC: Per Sequence GC Content
Percentages, 64 samples" }, "xaxis": { "hoverformat": null, "ticksuffix": "%", "title": { "text": "% GC" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": 100 } }, "yaxis": { "hoverformat": null, "ticksuffix": "%", "title": { "text": "Percentage" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": null } } }, "trace_params": { "hovertemplate": "%{text}
%{x} GC: %{y}", "mode": "lines", "line": { "width": 2 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "n_samples": 64, "lines": [ { "name": "CAFS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.0 ], [ 46.0, 0.0 ], [ 47.0, 0.008094524116699246 ], [ 48.0, 0.2225371476391026 ], [ 49.0, 1.9780526318408902 ], [ 50.0, 2.6192634730238735 ], [ 51.0, 3.081024941096606 ], [ 52.0, 6.702515030906851 ], [ 53.0, 18.281918576544978 ], [ 54.0, 22.908624030517196 ], [ 55.0, 33.50074469624759 ], [ 56.0, 8.73897276752627 ], [ 57.0, 1.6194029479009036 ], [ 58.0, 0.24719431340997142 ], [ 59.0, 0.030385598222686373 ], [ 60.0, 0.0019924982441105834 ], [ 61.0, 0.005479370171304104 ], [ 62.0, 0.002490622805138229 ], [ 63.0, 0.017434359635967615 ], [ 64.0, 0.033872470149879874 ], [ 65.0, 0.0 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAFS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.0006757971365123587 ], [ 46.0, 0.0006757971365123587 ], [ 47.0, 0.008650203347358193 ], [ 48.0, 0.2665343906404766 ], [ 49.0, 2.4096222699486436 ], [ 50.0, 2.940123022110966 ], [ 51.0, 3.3953399732657936 ], [ 52.0, 6.910025720838505 ], [ 53.0, 18.22111271349017 ], [ 54.0, 21.78729420286265 ], [ 55.0, 33.754850533974626 ], [ 56.0, 8.523018326264738 ], [ 57.0, 1.4820231203715695 ], [ 58.0, 0.21192998201027724 ], [ 59.0, 0.024328696914444913 ], [ 60.0, 0.0032438262552593215 ], [ 61.0, 0.01351594273024718 ], [ 62.0, 0.0 ], [ 63.0, 0.01567849356708673 ], [ 64.0, 0.030816349424963533 ], [ 65.0, 0.0 ], [ 66.0, 0.000540637709209887 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAMS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.0020587145386420165 ], [ 46.0, 0.003842933805465097 ], [ 47.0, 0.03046897517190182 ], [ 48.0, 1.8061788885686305 ], [ 49.0, 3.290100328022133 ], [ 50.0, 3.764977148268999 ], [ 51.0, 3.190458544351836 ], [ 52.0, 4.715828769850008 ], [ 53.0, 18.56535046182693 ], [ 54.0, 28.325441594274576 ], [ 55.0, 27.750373999811817 ], [ 56.0, 6.518439219884348 ], [ 57.0, 1.6998119707387689 ], [ 58.0, 0.21424355965468075 ], [ 59.0, 0.023057602832790586 ], [ 60.0, 0.003293943261827226 ], [ 61.0, 0.021959621745514853 ], [ 62.0, 0.000548990543637871 ], [ 63.0, 0.026900536638255673 ], [ 64.0, 0.04666419620921896 ], [ 65.0, 0.0 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAMS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.007262832214048052 ], [ 46.0, 0.0030261800891866883 ], [ 47.0, 0.031956461741811396 ], [ 48.0, 1.771646871413526 ], [ 49.0, 3.13948027172622 ], [ 50.0, 3.704528617979287 ], [ 51.0, 3.2399494506872415 ], [ 52.0, 4.43456430269485 ], [ 53.0, 18.15526482705542 ], [ 54.0, 27.86530835565465 ], [ 55.0, 29.54302259710585 ], [ 56.0, 6.344447080581212 ], [ 57.0, 1.4690288624947885 ], [ 58.0, 0.19996998029345792 ], [ 59.0, 0.02517781834203324 ], [ 60.0, 0.0019367552570794808 ], [ 61.0, 0.005326076956968571 ], [ 62.0, 0.002420944071349351 ], [ 63.0, 0.02033593019933455 ], [ 64.0, 0.035345783441700473 ], [ 65.0, 0.0 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCFS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.0008465608465607189 ], [ 46.0, 0.004232804232803594 ], [ 47.0, 0.4037154614931715 ], [ 48.0, 2.422669018224501 ], [ 49.0, 5.626525573190396 ], [ 50.0, 4.389888300998878 ], [ 51.0, 6.602610229274017 ], [ 52.0, 9.210770135208934 ], [ 53.0, 17.274356261017203 ], [ 54.0, 25.57855379191027 ], [ 55.0, 18.15778953556467 ], [ 56.0, 7.127383891824899 ], [ 57.0, 1.9935567313344036 ], [ 58.0, 1.122445620223226 ], [ 59.0, 0.04063492063491442 ], [ 60.0, 0.010911228689004824 ], [ 61.0, 0.006772486772485752 ], [ 62.0, 0.0022574955908285835 ], [ 63.0, 0.0037624926513809714 ], [ 64.0, 0.018059964726628665 ], [ 65.0, 0.0011287477954142918 ], [ 66.0, 0.00037624926513809724 ], [ 67.0, 0.0007524985302761945 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCFS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.00140606717988112 ], [ 46.0, 0.0024104008797962055 ], [ 47.0, 0.4545614325815591 ], [ 48.0, 2.1602213551475735 ], [ 49.0, 4.770685507966711 ], [ 50.0, 4.072171419676357 ], [ 51.0, 7.169235250101737 ], [ 52.0, 9.304147396009295 ], [ 53.0, 17.655885144391043 ], [ 54.0, 25.816598623080694 ], [ 55.0, 17.915404972450037 ], [ 56.0, 7.215233733557806 ], [ 57.0, 2.151885385438277 ], [ 58.0, 1.2286014151061282 ], [ 59.0, 0.03776294711680715 ], [ 60.0, 0.007632936119354653 ], [ 61.0, 0.007231202639388619 ], [ 62.0, 0.0032138678397282735 ], [ 63.0, 0.006026002199490514 ], [ 64.0, 0.01647107267860741 ], [ 65.0, 0.0016069339198641372 ], [ 66.0, 0.0008034669599320686 ], [ 67.0, 0.0004017334799660343 ], [ 68.0, 0.0 ], [ 69.0, 0.0004017334799660343 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCMS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0003917044824702956 ], [ 43.0, 0.0004896306030878695 ], [ 44.0, 0.0 ], [ 45.0, 0.0012730395680284608 ], [ 46.0, 0.00822579413187621 ], [ 47.0, 0.7847799306292094 ], [ 48.0, 2.572127484141512 ], [ 49.0, 5.667670082982461 ], [ 50.0, 2.435030915276877 ], [ 51.0, 4.224336991201351 ], [ 52.0, 10.329247202736594 ], [ 53.0, 19.039579779434252 ], [ 54.0, 20.136254404234446 ], [ 55.0, 17.21717467473458 ], [ 56.0, 13.046305345389328 ], [ 57.0, 2.8617929489283616 ], [ 58.0, 1.5903201988294935 ], [ 59.0, 0.037211925834678014 ], [ 60.0, 0.009400907579287097 ], [ 61.0, 0.009009203096816801 ], [ 62.0, 0.005092158272113843 ], [ 63.0, 0.006658976201995027 ], [ 64.0, 0.01566817929881183 ], [ 65.0, 0.0007834089649405912 ], [ 66.0, 0.0 ], [ 67.0, 0.0003917044824702956 ], [ 68.0, 0.0007834089649405912 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCMS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.0022924976970822675 ], [ 46.0, 0.0069816975320232694 ], [ 47.0, 0.6433582173538867 ], [ 48.0, 2.4159799594026445 ], [ 49.0, 5.467919620863131 ], [ 50.0, 2.243938427680658 ], [ 51.0, 4.269985369697958 ], [ 52.0, 9.974136457796561 ], [ 53.0, 19.683072613824553 ], [ 54.0, 20.754711082773618 ], [ 55.0, 17.775089303200513 ], [ 56.0, 12.684702371271547 ], [ 57.0, 2.608549765957598 ], [ 58.0, 1.3754986182493876 ], [ 59.0, 0.03626314539021035 ], [ 60.0, 0.01250453289317601 ], [ 61.0, 0.011670897366964274 ], [ 62.0, 0.007085901972799737 ], [ 63.0, 0.00666908420969387 ], [ 64.0, 0.01833998157665814 ], [ 65.0, 0.0012504532893176006 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPFS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0005694850004765843 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.0005694850004765843 ], [ 46.0, 0.0011389700009531685 ], [ 47.0, 0.003986395003336089 ], [ 48.0, 0.023918370020016545 ], [ 49.0, 0.4686861553922265 ], [ 50.0, 6.168661525162989 ], [ 51.0, 5.078097749250466 ], [ 52.0, 6.534555637968861 ], [ 53.0, 13.825529727813823 ], [ 54.0, 5.102585604270964 ], [ 55.0, 47.79587949132292 ], [ 56.0, 14.612415627221623 ], [ 57.0, 0.24957680145886504 ], [ 58.0, 0.07061614005909628 ], [ 59.0, 0.02334888501953996 ], [ 60.0, 0.01879300501572729 ], [ 61.0, 0.01025073000857852 ], [ 62.0, 0.003986395003336089 ], [ 63.0, 0.002277940001906337 ], [ 64.0, 0.002277940001906337 ], [ 65.0, 0.0017084550014297528 ], [ 66.0, 0.0 ], [ 67.0, 0.0005694850004765843 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPFS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.0 ], [ 46.0, 0.0 ], [ 47.0, 0.020306123514609118 ], [ 48.0, 0.8248927546591511 ], [ 49.0, 3.5925593722051423 ], [ 50.0, 2.6498911011610176 ], [ 51.0, 2.7822870264762987 ], [ 52.0, 10.278959723090871 ], [ 53.0, 20.77710954515075 ], [ 54.0, 25.295628149638 ], [ 55.0, 20.408582412107144 ], [ 56.0, 10.777213976643168 ], [ 57.0, 1.8893977667908555 ], [ 58.0, 0.6261248141990172 ], [ 59.0, 0.040844317012242254 ], [ 60.0, 0.008818659354915959 ], [ 61.0, 0.002320699830241041 ], [ 62.0, 0.002320699830241041 ], [ 63.0, 0.0055696795925784985 ], [ 64.0, 0.014388338947494462 ], [ 65.0, 0.0013924198981446249 ], [ 66.0, 0.00046413996604820825 ], [ 67.0, 0.00046413996604820825 ], [ 68.0, 0.00046413996604820825 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPMS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0003616224553078701 ], [ 43.0, 0.0003616224553078701 ], [ 44.0, 0.0 ], [ 45.0, 0.0011752729797505778 ], [ 46.0, 0.002260140345674188 ], [ 47.0, 0.05641310302802759 ], [ 48.0, 1.4407942675604613 ], [ 49.0, 4.543605339715564 ], [ 50.0, 2.471508670801952 ], [ 51.0, 4.412336388438926 ], [ 52.0, 9.872564246741321 ], [ 53.0, 19.045931476160792 ], [ 54.0, 23.066088311832974 ], [ 55.0, 21.705303012504533 ], [ 56.0, 10.47276711693801 ], [ 57.0, 2.109886215494 ], [ 58.0, 0.7334607449781612 ], [ 59.0, 0.03263642659153522 ], [ 60.0, 0.009040561382696755 ], [ 61.0, 0.00325460209777083 ], [ 62.0, 0.0021697347318472204 ], [ 63.0, 0.003977847008386571 ], [ 64.0, 0.014103275757006942 ], [ 65.0, 0.0 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPMS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0004024391838935812 ], [ 43.0, 0.0 ], [ 44.0, 0.0005030489798669764 ], [ 45.0, 0.00171036653154772 ], [ 46.0, 0.002917684083228463 ], [ 47.0, 0.03752745389807637 ], [ 48.0, 1.4733298522344598 ], [ 49.0, 5.195489864065816 ], [ 50.0, 3.397995249205948 ], [ 51.0, 5.0174105251930685 ], [ 52.0, 10.874309187982977 ], [ 53.0, 19.008208753252173 ], [ 54.0, 21.070508351122328 ], [ 55.0, 20.72481309215648 ], [ 56.0, 10.244592474986067 ], [ 57.0, 2.2721716322634 ], [ 58.0, 0.5992319448175255 ], [ 59.0, 0.03420733063095434 ], [ 60.0, 0.006841466126190881 ], [ 61.0, 0.008451222861765206 ], [ 62.0, 0.0032195134711486485 ], [ 63.0, 0.004829270206722974 ], [ 64.0, 0.02012195919467905 ], [ 65.0, 0.0008048783677871624 ], [ 66.0, 0.0004024391838935812 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVFS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.0007512026284577553 ], [ 46.0, 0.0015963055854727303 ], [ 47.0, 0.08854800982945815 ], [ 48.0, 1.4157352536572618 ], [ 49.0, 4.626938689656893 ], [ 50.0, 2.805554016632982 ], [ 51.0, 4.874553856062056 ], [ 52.0, 9.7477931075202 ], [ 53.0, 26.8196240418876 ], [ 54.0, 21.844127332608117 ], [ 55.0, 16.88581438345469 ], [ 56.0, 9.031427500957822 ], [ 57.0, 1.4828739885756888 ], [ 58.0, 0.3088381806246931 ], [ 59.0, 0.021784876225274884 ], [ 60.0, 0.010892438112637456 ], [ 61.0, 0.008357129241592532 ], [ 62.0, 0.002253607885373266 ], [ 63.0, 0.007136424970348677 ], [ 64.0, 0.014272849940697357 ], [ 65.0, 0.0007512026284577553 ], [ 66.0, 0.00037560131422887766 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVFS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0004958467873094217 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.0008925242171569592 ], [ 46.0, 0.0028759113663946465 ], [ 47.0, 0.09341753472909534 ], [ 48.0, 1.778304918006643 ], [ 49.0, 5.765904781547984 ], [ 50.0, 3.3179091926027473 ], [ 51.0, 4.868917943306053 ], [ 52.0, 8.986231326404825 ], [ 53.0, 25.051270557825667 ], [ 54.0, 21.37397161376815 ], [ 55.0, 17.30088776407883 ], [ 56.0, 9.404130998748824 ], [ 57.0, 1.589486461399172 ], [ 58.0, 0.39588407498783684 ], [ 59.0, 0.029750807238565262 ], [ 60.0, 0.011900322895426129 ], [ 61.0, 0.008726903456645826 ], [ 62.0, 0.002776742008932762 ], [ 63.0, 0.0023800645790852245 ], [ 64.0, 0.012297000325273668 ], [ 65.0, 0.0011900322895426125 ], [ 66.0, 0.00039667742984753746 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVMS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0005517637127079152 ], [ 44.0, 0.0004414109701663322 ], [ 45.0, 0.0013242329104989966 ], [ 46.0, 0.004855520671829652 ], [ 47.0, 0.32355424113192194 ], [ 48.0, 6.68693478704852 ], [ 49.0, 16.66094671617535 ], [ 50.0, 3.6287292329953966 ], [ 51.0, 3.7316883417867173 ], [ 52.0, 6.205576124082572 ], [ 53.0, 16.429095604095696 ], [ 54.0, 16.444765693536592 ], [ 55.0, 18.541467801826855 ], [ 56.0, 8.675270502160954 ], [ 57.0, 1.9204687784513035 ], [ 58.0, 0.6807660687390059 ], [ 59.0, 0.03178158985197587 ], [ 60.0, 0.011035274254158307 ], [ 61.0, 0.008828219403326645 ], [ 62.0, 0.0026484658209979927 ], [ 63.0, 0.0035312877613306566 ], [ 64.0, 0.004855520671829652 ], [ 65.0, 0.0004414109701663322 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0004414109701663322 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVMS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0007998499836920135 ], [ 44.0, 0.0008887222041022372 ], [ 45.0, 0.0007109777632817899 ], [ 46.0, 0.005332333224613424 ], [ 47.0, 0.3782401700659059 ], [ 48.0, 6.171464729725037 ], [ 49.0, 14.851881113846247 ], [ 50.0, 3.4728597569708572 ], [ 51.0, 3.37127880904195 ], [ 52.0, 6.219722345407746 ], [ 53.0, 16.033526156424884 ], [ 54.0, 17.025162391765768 ], [ 55.0, 20.229894659770085 ], [ 56.0, 9.397348586172408 ], [ 57.0, 2.103072223787768 ], [ 58.0, 0.6684079697052699 ], [ 59.0, 0.03341595487424406 ], [ 60.0, 0.00853173315938148 ], [ 61.0, 0.01039804978799618 ], [ 62.0, 0.004265866579690738 ], [ 63.0, 0.0014219555265635798 ], [ 64.0, 0.00853173315938148 ], [ 65.0, 0.0010664666449226848 ], [ 66.0, 0.0007109777632817899 ], [ 67.0, 0.00035548888164089494 ], [ 68.0, 0.0 ], [ 69.0, 0.00035548888164089494 ], [ 70.0, 0.00035548888164089494 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAFS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0009530026731722147 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0009530026731722147 ], [ 43.0, 0.006671018712205502 ], [ 44.0, 0.008100522721963824 ], [ 45.0, 0.004288512029274966 ], [ 46.0, 0.0038120106926888588 ], [ 47.0, 0.00857702405854993 ], [ 48.0, 0.3337891862785703 ], [ 49.0, 1.0842787914016665 ], [ 50.0, 4.956566903169162 ], [ 51.0, 1.7468538999246113 ], [ 52.0, 1.7447096439099734 ], [ 53.0, 6.493045462991414 ], [ 54.0, 15.166799292864152 ], [ 55.0, 54.94798987912808 ], [ 56.0, 12.429299114179452 ], [ 57.0, 0.8081462668500329 ], [ 58.0, 0.14342690231241795 ], [ 59.0, 0.025016320170770646 ], [ 60.0, 0.012150784082945737 ], [ 61.0, 0.015486293439048494 ], [ 62.0, 0.004765013365861073 ], [ 63.0, 0.013342037424411007 ], [ 64.0, 0.03526109890737196 ], [ 65.0, 0.0038120106926888588 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0009530026731722147 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0009530026731722147 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAFS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0022571452755131547 ], [ 44.0, 0.0 ], [ 45.0, 0.014107157971957216 ], [ 46.0, 0.03160003385718417 ], [ 47.0, 0.08351437519398677 ], [ 48.0, 0.8357080382587513 ], [ 49.0, 1.3836300538895774 ], [ 50.0, 5.66317749626228 ], [ 51.0, 2.0607736365434897 ], [ 52.0, 1.8017662161783699 ], [ 53.0, 7.1901362751472435 ], [ 54.0, 15.448466551932874 ], [ 55.0, 48.88694523600081 ], [ 56.0, 15.47611658155792 ], [ 57.0, 0.8074937223148363 ], [ 58.0, 0.14953587450274633 ], [ 59.0, 0.03837146968372364 ], [ 60.0, 0.0022571452755131547 ], [ 61.0, 0.015800016928592082 ], [ 62.0, 0.04740005078577626 ], [ 63.0, 0.022571452755131543 ], [ 64.0, 0.02934288858167101 ], [ 65.0, 0.0 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.009028581102052619 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAMS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.006756939376740207 ], [ 44.0, 0.006756939376740207 ], [ 45.0, 0.006081245439066186 ], [ 46.0, 0.016892348441850516 ], [ 47.0, 0.06013676045298784 ], [ 48.0, 0.641233546852651 ], [ 49.0, 1.1233411713830532 ], [ 50.0, 64.3608611043542 ], [ 51.0, 18.169409984052695 ], [ 52.0, 0.9895537717236048 ], [ 53.0, 2.163909835400986 ], [ 54.0, 3.6055028514284695 ], [ 55.0, 5.676166923430976 ], [ 56.0, 2.5243925511500556 ], [ 57.0, 0.22027622368173028 ], [ 58.0, 0.05844752560880281 ], [ 59.0, 0.021622206005568665 ], [ 60.0, 0.008108327252088246 ], [ 61.0, 0.010811103002784329 ], [ 62.0, 0.025676369631612794 ], [ 63.0, 0.017568042379524536 ], [ 64.0, 0.004054163626044124 ], [ 65.0, 0.0 ], [ 66.0, 0.0027027757506960827 ], [ 67.0, 0.0027027757506960827 ], [ 68.0, 0.004054163626044124 ], [ 69.0, 0.23514149031055886 ], [ 70.0, 0.03783886050974517 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAMS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0010714582278609495 ], [ 35.0, 0.0010714582278609495 ], [ 36.0, 0.004285832911443798 ], [ 37.0, 0.002142916455721899 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.003750103797513322 ], [ 44.0, 0.0 ], [ 45.0, 0.0 ], [ 46.0, 0.0013393227848261867 ], [ 47.0, 0.0010714582278609495 ], [ 48.0, 0.035625986076376584 ], [ 49.0, 0.8017186189969555 ], [ 50.0, 71.74698585409807 ], [ 51.0, 19.832691797699873 ], [ 52.0, 0.7138590443123627 ], [ 53.0, 1.3090540898890866 ], [ 54.0, 2.254615975976321 ], [ 55.0, 2.097915210151666 ], [ 56.0, 0.7564495088698331 ], [ 57.0, 0.3779568898779523 ], [ 58.0, 0.028125778481349933 ], [ 59.0, 0.008571665822887594 ], [ 60.0, 0.008571665822887594 ], [ 61.0, 0.002410781012687136 ], [ 62.0, 0.0 ], [ 63.0, 0.002142916455721899 ], [ 64.0, 0.0064287493671656955 ], [ 65.0, 0.0010714582278609495 ], [ 66.0, 0.0010714582278609495 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCFS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0015685126317552226 ], [ 35.0, 0.0 ], [ 36.0, 0.0048798170765718026 ], [ 37.0, 0.005751212983102482 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0017427918130613583 ], [ 42.0, 0.0013942334504490866 ], [ 43.0, 0.014290892867103137 ], [ 44.0, 0.01254810105404178 ], [ 45.0, 0.006274050527020889 ], [ 46.0, 0.008016842340082247 ], [ 47.0, 0.017776476493225862 ], [ 48.0, 0.0895794991913536 ], [ 49.0, 0.5874951201829802 ], [ 50.0, 27.221188165732162 ], [ 51.0, 36.77273297642492 ], [ 52.0, 9.110618481958909 ], [ 53.0, 1.2572500139424236 ], [ 54.0, 11.90274524566198 ], [ 55.0, 9.56025876972833 ], [ 56.0, 2.8111231944681325 ], [ 57.0, 0.2900005576934122 ], [ 58.0, 0.1918813786180564 ], [ 59.0, 0.057163571468412465 ], [ 60.0, 0.0355529529864517 ], [ 61.0, 0.015336567954939956 ], [ 62.0, 0.005576933801796346 ], [ 63.0, 0.008539679884000655 ], [ 64.0, 0.0071454464335515685 ], [ 65.0, 0.0 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0006971167252245433 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0008713959065306792 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCFS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0012489033067840727 ], [ 36.0, 0.012489033067840726 ], [ 37.0, 0.008742323147488509 ], [ 38.0, 0.0037467099203522185 ], [ 39.0, 0.0012489033067840727 ], [ 40.0, 0.0 ], [ 41.0, 0.0012489033067840727 ], [ 42.0, 0.007181194014008419 ], [ 43.0, 0.014986839681408872 ], [ 44.0, 0.024978066135681452 ], [ 45.0, 0.007181194014008419 ], [ 46.0, 0.011864581414448691 ], [ 47.0, 0.011240129761056653 ], [ 48.0, 0.05557619715189124 ], [ 49.0, 0.600722490563144 ], [ 50.0, 22.26669705664668 ], [ 51.0, 42.5907250195788 ], [ 52.0, 11.256677729873243 ], [ 53.0, 1.140560944920544 ], [ 54.0, 10.497656745175043 ], [ 55.0, 8.435405159847384 ], [ 56.0, 2.454407223657314 ], [ 57.0, 0.30129792276165845 ], [ 58.0, 0.13925271870642383 ], [ 59.0, 0.0458971965243147 ], [ 60.0, 0.02747587274924961 ], [ 61.0, 0.027788098575945625 ], [ 62.0, 0.00530783905383231 ], [ 63.0, 0.0103034522809686 ], [ 64.0, 0.017796872121673038 ], [ 65.0, 0.004995613227136291 ], [ 66.0, 0.004995613227136291 ], [ 67.0, 0.0028100324402641637 ], [ 68.0, 0.005932290707224346 ], [ 69.0, 0.0015611291334800908 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCMS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.00034618996308725405 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0004327374538590675 ], [ 44.0, 0.0010385698892617621 ], [ 45.0, 0.0007789274169463215 ], [ 46.0, 0.0018174973062080838 ], [ 47.0, 0.02631043719463127 ], [ 48.0, 0.11735839748657985 ], [ 49.0, 0.654645220197975 ], [ 50.0, 24.48463132933751 ], [ 51.0, 31.039824827909285 ], [ 52.0, 7.981063409010088 ], [ 53.0, 2.279401264457533 ], [ 54.0, 16.715349630214323 ], [ 55.0, 13.225148969851046 ], [ 56.0, 2.7668367324844976 ], [ 57.0, 0.4000225023473141 ], [ 58.0, 0.21178170991862968 ], [ 59.0, 0.037821253467282434 ], [ 60.0, 0.010039508929530372 ], [ 61.0, 0.01765568811744995 ], [ 62.0, 0.011424268781879389 ], [ 63.0, 0.0013847598523490162 ], [ 64.0, 0.013501408560402913 ], [ 65.0, 0.0010385698892617621 ], [ 66.0, 0.00034618996308725405 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCMS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0011654957319550297 ], [ 36.0, 0.003729586342256095 ], [ 37.0, 0.005594379513384142 ], [ 38.0, 0.0018647931711280475 ], [ 39.0, 0.0027971897566920713 ], [ 40.0, 0.0032633880494740823 ], [ 41.0, 0.0011654957319550297 ], [ 42.0, 0.0009323965855640238 ], [ 43.0, 0.018414832564889468 ], [ 44.0, 0.021445121467972547 ], [ 45.0, 0.005361280366993135 ], [ 46.0, 0.006759875245339171 ], [ 47.0, 0.028904294152484744 ], [ 48.0, 0.20629274455604066 ], [ 49.0, 0.829599862005583 ], [ 50.0, 20.889180003821224 ], [ 51.0, 32.90544100026664 ], [ 52.0, 8.813012526752514 ], [ 53.0, 2.4887995860166985 ], [ 54.0, 17.208078284017805 ], [ 55.0, 13.068004344970904 ], [ 56.0, 2.625628784948249 ], [ 57.0, 0.4300679250914094 ], [ 58.0, 0.25710835846928065 ], [ 59.0, 0.06293676952557153 ], [ 60.0, 0.0270395009813567 ], [ 61.0, 0.02820499671331173 ], [ 62.0, 0.024242311224664623 ], [ 63.0, 0.01258735390511432 ], [ 64.0, 0.01724933683293444 ], [ 65.0, 0.0009323965855640238 ], [ 66.0, 0.0020978923175190532 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0009323965855640238 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0011654957319550297 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPFS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0029698971227640316 ], [ 37.0, 0.0017819382736584193 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0007424742806910079 ], [ 42.0, 0.0025244125543494272 ], [ 43.0, 0.0 ], [ 44.0, 0.0013364537052438143 ], [ 45.0, 0.0007424742806910079 ], [ 46.0, 0.0017819382736584193 ], [ 47.0, 0.01187958849105613 ], [ 48.0, 0.07602936634275903 ], [ 49.0, 0.4829052721614295 ], [ 50.0, 21.246644016241063 ], [ 51.0, 33.22720900950073 ], [ 52.0, 8.749465418517525 ], [ 53.0, 1.5232602342656116 ], [ 54.0, 13.138973365958776 ], [ 55.0, 17.72256409037247 ], [ 56.0, 3.4171636294526646 ], [ 57.0, 0.2459074817648637 ], [ 58.0, 0.09206681080568474 ], [ 59.0, 0.01722540331203139 ], [ 60.0, 0.008909691368292096 ], [ 61.0, 0.004751835396422451 ], [ 62.0, 0.0029698971227640316 ], [ 63.0, 0.005494309677113458 ], [ 64.0, 0.011434103922641525 ], [ 65.0, 0.0019304331297966206 ], [ 66.0, 0.0013364537052438143 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPFS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.001969469933580023 ], [ 36.0, 0.008534369712180098 ], [ 37.0, 0.006564899778600075 ], [ 38.0, 0.0013129799557200152 ], [ 39.0, 0.0006564899778600076 ], [ 40.0, 0.0027900824059050324 ], [ 41.0, 0.002297714922510026 ], [ 42.0, 0.0016412249446500187 ], [ 43.0, 0.023469516708495272 ], [ 44.0, 0.018709964369010214 ], [ 45.0, 0.003610694878230041 ], [ 46.0, 0.012145064590410141 ], [ 47.0, 0.02593135412547031 ], [ 48.0, 0.06384365034688562 ], [ 49.0, 0.6115204143765903 ], [ 50.0, 22.486094721647735 ], [ 51.0, 33.39219860136121 ], [ 52.0, 8.480373411500596 ], [ 53.0, 1.6321982074543822 ], [ 54.0, 13.515323296693357 ], [ 55.0, 16.4596808473928 ], [ 56.0, 2.756437294539884 ], [ 57.0, 0.19202331852405313 ], [ 58.0, 0.147382000029572 ], [ 59.0, 0.06729022273065065 ], [ 60.0, 0.020187066819195243 ], [ 61.0, 0.026423721608865317 ], [ 62.0, 0.015755759468640187 ], [ 63.0, 0.01263743207380515 ], [ 64.0, 0.008534369712180098 ], [ 65.0, 0.0 ], [ 66.0, 0.0008206124723250094 ], [ 67.0, 0.0016412249446500187 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPMS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.002037173320159999 ], [ 36.0, 0.004074346640319998 ], [ 37.0, 0.0010185866600799995 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0025464666501999987 ], [ 44.0, 0.0025464666501999987 ], [ 45.0, 0.0033104066452599988 ], [ 46.0, 0.006366166625499997 ], [ 47.0, 0.07741258616607985 ], [ 48.0, 0.7506983684789605 ], [ 49.0, 2.542646950224598 ], [ 50.0, 17.981619603717082 ], [ 51.0, 23.755987379705346 ], [ 52.0, 7.182818480220073 ], [ 53.0, 7.67479583703882 ], [ 54.0, 15.540322026172568 ], [ 55.0, 15.706351651765448 ], [ 56.0, 6.885136528811625 ], [ 57.0, 1.249551185253112 ], [ 58.0, 0.5390869898473446 ], [ 59.0, 0.015533446566219994 ], [ 60.0, 0.005856873295459997 ], [ 61.0, 0.022408906521759996 ], [ 62.0, 0.011204453260879993 ], [ 63.0, 0.005092933300399997 ], [ 64.0, 0.030557599802400002 ], [ 65.0, 0.0010185866600799995 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPMS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0009708784994104051 ], [ 37.0, 0.0 ], [ 38.0, 0.0012135981242630063 ], [ 39.0, 0.0 ], [ 40.0, 0.0009708784994104051 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0009708784994104051 ], [ 45.0, 0.0029126354982312156 ], [ 46.0, 0.015048616740861283 ], [ 47.0, 0.1407773824145084 ], [ 48.0, 2.082534381235242 ], [ 49.0, 5.777940669616822 ], [ 50.0, 25.0226942849171 ], [ 51.0, 21.976077553770022 ], [ 52.0, 6.3291569376572046 ], [ 53.0, 6.736925907409666 ], [ 54.0, 13.323608367032358 ], [ 55.0, 13.379919319998113 ], [ 56.0, 3.9636114738432147 ], [ 57.0, 0.8084990703840105 ], [ 58.0, 0.3099529609367736 ], [ 59.0, 0.04174777547464742 ], [ 60.0, 0.03009723348172257 ], [ 61.0, 0.023301083985849732 ], [ 62.0, 0.006796149495872835 ], [ 63.0, 0.0019417569988208101 ], [ 64.0, 0.010922383118367057 ], [ 65.0, 0.006067990621315031 ], [ 66.0, 0.0 ], [ 67.0, 0.0019417569988208101 ], [ 68.0, 0.0009708784994104051 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0012135981242630063 ], [ 74.0, 0.0012135981242630063 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVFS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.001173891479602445 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.0035216744388073353 ], [ 46.0, 0.010858496186322616 ], [ 47.0, 0.09772646567690339 ], [ 48.0, 0.40616645194244855 ], [ 49.0, 1.5316349080112532 ], [ 50.0, 37.49614816857016 ], [ 51.0, 21.62630925583914 ], [ 52.0, 5.4897035043612785 ], [ 53.0, 6.999327947130363 ], [ 54.0, 11.759751369789258 ], [ 55.0, 8.718785491878437 ], [ 56.0, 4.3739196529989 ], [ 57.0, 0.8947987803269629 ], [ 58.0, 0.4044056147230448 ], [ 59.0, 0.06280319415873077 ], [ 60.0, 0.04343398474529049 ], [ 61.0, 0.02465172107165135 ], [ 62.0, 0.014380170625129954 ], [ 63.0, 0.01203238766592506 ], [ 64.0, 0.025825612551253797 ], [ 65.0, 0.001173891479602445 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0014673643495030564 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVFS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.001060051942545559 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0008480415540364473 ], [ 37.0, 0.002544124662109342 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.002544124662109342 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.01844490380029273 ], [ 44.0, 0.012296602533528482 ], [ 45.0, 0.0019080934965820064 ], [ 46.0, 0.006996342820800689 ], [ 47.0, 0.06847935548844301 ], [ 48.0, 0.2160385858907857 ], [ 49.0, 1.130863412307575 ], [ 50.0, 32.27900567126924 ], [ 51.0, 31.594212116385428 ], [ 52.0, 8.517093337577904 ], [ 53.0, 3.8700376318456216 ], [ 54.0, 9.167117188746435 ], [ 55.0, 7.340223670963556 ], [ 56.0, 4.803519372451456 ], [ 57.0, 0.5836645995655878 ], [ 58.0, 0.25738061165006315 ], [ 59.0, 0.06551121004931545 ], [ 60.0, 0.01144856097949204 ], [ 61.0, 0.008692425928873584 ], [ 62.0, 0.004240207770182236 ], [ 63.0, 0.006784332432291576 ], [ 64.0, 0.022049080404947637 ], [ 65.0, 0.004240207770182236 ], [ 66.0, 0.0008480415540364473 ], [ 67.0, 0.0 ], [ 68.0, 0.0008480415540364473 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.001060051942545559 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVMS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.000509086558715084 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.002036346234860336 ], [ 40.0, 0.002036346234860336 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.000509086558715084 ], [ 44.0, 0.000509086558715084 ], [ 45.0, 0.003309062631648046 ], [ 46.0, 0.0048363223077932975 ], [ 47.0, 0.44761435675023387 ], [ 48.0, 1.4727874143627242 ], [ 49.0, 3.856967040465683 ], [ 50.0, 17.202162090612305 ], [ 51.0, 11.581591939123527 ], [ 52.0, 7.07057594235327 ], [ 53.0, 13.059724762351433 ], [ 54.0, 17.24377991678724 ], [ 55.0, 15.677066032342992 ], [ 56.0, 9.648335732404757 ], [ 57.0, 1.6499495367956136 ], [ 58.0, 0.9233557458694528 ], [ 59.0, 0.0474723216001815 ], [ 60.0, 0.01679985643759778 ], [ 61.0, 0.02952702040547485 ], [ 62.0, 0.008145384939441346 ], [ 63.0, 0.005090865587150839 ], [ 64.0, 0.03461788599262567 ], [ 65.0, 0.009163558056871515 ], [ 66.0, 0.0015272596761452522 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVMS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0005254543209423614 ], [ 43.0, 0.002233180864005036 ], [ 44.0, 0.004729088888481252 ], [ 45.0, 0.0017077265430626744 ], [ 46.0, 0.002889998765182987 ], [ 47.0, 0.10469677344776558 ], [ 48.0, 0.4797397950203711 ], [ 49.0, 2.0323259498249207 ], [ 50.0, 26.78555946436314 ], [ 51.0, 18.048042288557102 ], [ 52.0, 6.272610956249491 ], [ 53.0, 9.394335076965222 ], [ 54.0, 13.373732013038348 ], [ 55.0, 13.204404358114823 ], [ 56.0, 8.027759751775616 ], [ 57.0, 1.364604871487263 ], [ 58.0, 0.6934683400636645 ], [ 59.0, 0.045189071601043004 ], [ 60.0, 0.011559995060731954 ], [ 61.0, 0.04151089135444648 ], [ 62.0, 0.01944180987486738 ], [ 63.0, 0.02732362468900278 ], [ 64.0, 0.057799975303659636 ], [ 65.0, 0.0031527259256541682 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0006568179011779517 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAFS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.0 ], [ 46.0, 0.0 ], [ 47.0, 0.0 ], [ 48.0, 0.0027124602285487588 ], [ 49.0, 0.143217900067375 ], [ 50.0, 1.986063379343481 ], [ 51.0, 0.41392143087654026 ], [ 52.0, 0.3702508211969077 ], [ 53.0, 5.922928155059625 ], [ 54.0, 38.948352044789644 ], [ 55.0, 44.99306966413254 ], [ 56.0, 6.535944166711087 ], [ 57.0, 0.6341732014346869 ], [ 58.0, 0.04773930002245807 ], [ 59.0, 0.0 ], [ 60.0, 0.0005424920457097517 ], [ 61.0, 0.0005424920457097517 ], [ 62.0, 0.0 ], [ 63.0, 0.0 ], [ 64.0, 0.0005424920457097517 ], [ 65.0, 0.0 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAFS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.0 ], [ 46.0, 0.0 ], [ 47.0, 0.0 ], [ 48.0, 0.003497836588064986 ], [ 49.0, 0.08534721274878546 ], [ 50.0, 2.1924439733991523 ], [ 51.0, 0.45559321559546834 ], [ 52.0, 0.15600351182769873 ], [ 53.0, 1.015596853344641 ], [ 54.0, 7.5922292062252135 ], [ 55.0, 76.0531111507922 ], [ 56.0, 12.226338009918894 ], [ 57.0, 0.18258706989699294 ], [ 58.0, 0.020987019528389925 ], [ 59.0, 0.00996883427598521 ], [ 60.0, 0.0020987019528389914 ], [ 61.0, 0.0 ], [ 62.0, 0.0020987019528389914 ], [ 63.0, 0.0006995673176129971 ], [ 64.0, 0.0006995673176129971 ], [ 65.0, 0.0 ], [ 66.0, 0.0006995673176129971 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAMS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.0 ], [ 46.0, 0.0 ], [ 47.0, 0.0005887478510697513 ], [ 48.0, 0.0041212349574882585 ], [ 49.0, 0.062407272213393504 ], [ 50.0, 0.8919529943706478 ], [ 51.0, 0.20665049572548402 ], [ 52.0, 0.26773308527397155 ], [ 53.0, 3.8314238277996417 ], [ 54.0, 25.41948284385131 ], [ 55.0, 59.44174928766833 ], [ 56.0, 9.411134399347866 ], [ 57.0, 0.423898452770222 ], [ 58.0, 0.0347361232131153 ], [ 59.0, 0.003532487106418507 ], [ 60.0, 0.0005887478510697513 ], [ 61.0, 0.0 ], [ 62.0, 0.0 ], [ 63.0, 0.0 ], [ 64.0, 0.0 ], [ 65.0, 0.0 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAMS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.0 ], [ 46.0, 0.0 ], [ 47.0, 0.0005588957338088245 ], [ 48.0, 0.008383436007132369 ], [ 49.0, 0.8288423732384635 ], [ 50.0, 2.089152252977478 ], [ 51.0, 0.28224234557345884 ], [ 52.0, 0.8439325580513011 ], [ 53.0, 9.131657670766753 ], [ 54.0, 29.278731083117975 ], [ 55.0, 41.24915990987892 ], [ 56.0, 9.946667374592726 ], [ 57.0, 5.60628310583721 ], [ 58.0, 0.6757049421748542 ], [ 59.0, 0.007824540273323542 ], [ 60.0, 0.0 ], [ 61.0, 0.001117791467617649 ], [ 62.0, 0.0 ], [ 63.0, 0.014531289079029442 ], [ 64.0, 0.0352104312299559 ], [ 65.0, 0.0 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICFS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0024419577175022345 ], [ 44.0, 0.0032050695042216827 ], [ 45.0, 0.00457867072031669 ], [ 46.0, 0.003052447146877793 ], [ 47.0, 0.010683565014072279 ], [ 48.0, 0.10195173470571808 ], [ 49.0, 0.941374700097084 ], [ 50.0, 11.014145040075812 ], [ 51.0, 33.31623962932653 ], [ 52.0, 10.882584568045498 ], [ 53.0, 5.19541766634411 ], [ 54.0, 16.431933481064284 ], [ 55.0, 13.48586411725786 ], [ 56.0, 6.367099503673285 ], [ 57.0, 1.2179264116041963 ], [ 58.0, 0.900471908328924 ], [ 59.0, 0.0726482420956913 ], [ 60.0, 0.012820278016886734 ], [ 61.0, 0.012820278016886734 ], [ 62.0, 0.0038155589335972413 ], [ 63.0, 0.006715383723131144 ], [ 64.0, 0.00915734144063338 ], [ 65.0, 0.0018314682881266759 ], [ 66.0, 0.0006104894293755586 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0006104894293755586 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICFS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0004788618411759848 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0004788618411759848 ], [ 44.0, 0.0 ], [ 45.0, 0.0004788618411759848 ], [ 46.0, 0.00251402466617392 ], [ 47.0, 0.12234920042046456 ], [ 48.0, 0.5724793311258777 ], [ 49.0, 2.378985626962505 ], [ 50.0, 5.281846108171554 ], [ 51.0, 8.860979224577903 ], [ 52.0, 6.637144834158653 ], [ 53.0, 14.804971543629705 ], [ 54.0, 24.767333002929558 ], [ 55.0, 17.9446292052972 ], [ 56.0, 10.414526752811682 ], [ 57.0, 4.03081954809944 ], [ 58.0, 4.069607357234703 ], [ 59.0, 0.07470244722345344 ], [ 60.0, 0.007661789458815758 ], [ 61.0, 0.003950610189701874 ], [ 62.0, 0.0019154473647039392 ], [ 63.0, 0.003830894729407878 ], [ 64.0, 0.014844717076455533 ], [ 65.0, 0.0009577236823519696 ], [ 66.0, 0.0009577236823519696 ], [ 67.0, 0.0005985773014699809 ], [ 68.0, 0.0004788618411759848 ], [ 69.0, 0.0004788618411759848 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICMS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.0004483958079473964 ], [ 46.0, 0.0017935832317895856 ], [ 47.0, 0.006838036071197796 ], [ 48.0, 0.025558561053001572 ], [ 49.0, 0.32732893980159994 ], [ 50.0, 4.08174703974577 ], [ 51.0, 18.004100579644383 ], [ 52.0, 5.503161750938304 ], [ 53.0, 3.646018413372788 ], [ 54.0, 24.003524391048735 ], [ 55.0, 34.95256532850008 ], [ 56.0, 9.07967881407547 ], [ 57.0, 0.2699342763843352 ], [ 58.0, 0.05335910114574005 ], [ 59.0, 0.01434866585431669 ], [ 60.0, 0.012106686814579706 ], [ 61.0, 0.00896791615894793 ], [ 62.0, 0.003138770655631774 ], [ 63.0, 0.0017935832317895856 ], [ 64.0, 0.002690374847684378 ], [ 65.0, 0.0 ], [ 66.0, 0.0 ], [ 67.0, 0.0004483958079473964 ], [ 68.0, 0.0004483958079473964 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICMS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0007055855919418892 ], [ 40.0, 0.0014111711838837783 ], [ 41.0, 0.0007055855919418892 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.0 ], [ 46.0, 0.0007055855919418892 ], [ 47.0, 0.0035279279597094453 ], [ 48.0, 0.044451892292338965 ], [ 49.0, 0.636438203931578 ], [ 50.0, 7.405826373023061 ], [ 51.0, 2.315202723559367 ], [ 52.0, 0.7909614485668429 ], [ 53.0, 7.411118264962621 ], [ 54.0, 49.89707270181037 ], [ 55.0, 24.893236080092922 ], [ 56.0, 6.14988401936642 ], [ 57.0, 0.3034018045350147 ], [ 58.0, 0.07832000070554952 ], [ 59.0, 0.02469549571796613 ], [ 60.0, 0.014817297430779672 ], [ 61.0, 0.009878198287186448 ], [ 62.0, 0.007761441511360778 ], [ 63.0, 0.004233513551651334 ], [ 64.0, 0.004233513551651334 ], [ 65.0, 0.0014111711838837783 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPFS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0005306595169134641 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.0010613190338269283 ], [ 46.0, 0.0 ], [ 47.0, 0.006367914202961568 ], [ 48.0, 0.03396220908246167 ], [ 49.0, 0.1756483000983577 ], [ 50.0, 2.7217526622494126 ], [ 51.0, 62.08358152726896 ], [ 52.0, 20.994217137875644 ], [ 53.0, 4.612757850770972 ], [ 54.0, 2.286213863742588 ], [ 55.0, 5.318933002903725 ], [ 56.0, 1.5617309582763166 ], [ 57.0, 0.09074277739220223 ], [ 58.0, 0.05943386589430785 ], [ 59.0, 0.02016506164271165 ], [ 60.0, 0.013797147439750072 ], [ 61.0, 0.0068985737198750344 ], [ 62.0, 0.004245276135307713 ], [ 63.0, 0.004245276135307713 ], [ 64.0, 0.0026532975845673205 ], [ 65.0, 0.0010613190338269283 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPFS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.00036828716086491456 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0008286461119460578 ], [ 44.0, 0.0 ], [ 45.0, 0.00046035895108114316 ], [ 46.0, 0.0008286461119460578 ], [ 47.0, 0.024583167987733016 ], [ 48.0, 0.8325131271351078 ], [ 49.0, 3.432804626422396 ], [ 50.0, 2.5326187334781243 ], [ 51.0, 2.9835863619573146 ], [ 52.0, 10.344541846158565 ], [ 53.0, 21.751776295018146 ], [ 54.0, 26.51630729514481 ], [ 55.0, 19.058216072232582 ], [ 56.0, 9.971927311153825 ], [ 57.0, 1.8440138144507943 ], [ 58.0, 0.6346508499604436 ], [ 59.0, 0.0316726958343826 ], [ 60.0, 0.011416901986812356 ], [ 61.0, 0.0055243074129737195 ], [ 62.0, 0.0011048614825947438 ], [ 63.0, 0.005156020252108804 ], [ 64.0, 0.014363199273731675 ], [ 65.0, 0.0 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.00036828716086491456 ], [ 69.0, 0.00036828716086491456 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPMS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.00025331510309034957 ], [ 37.0, 0.00025331510309034957 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.00025331510309034957 ], [ 46.0, 0.0010765891881339858 ], [ 47.0, 0.0433802114042223 ], [ 48.0, 0.3217101809247365 ], [ 49.0, 1.08298539448709 ], [ 50.0, 3.499358162865455 ], [ 51.0, 1.6552242123683194 ], [ 52.0, 1.3681548717911152 ], [ 53.0, 11.98541411639177 ], [ 54.0, 64.71206622155688 ], [ 55.0, 10.834286959169258 ], [ 56.0, 3.806946026792632 ], [ 57.0, 0.43449873057570837 ], [ 58.0, 0.17865047645446974 ], [ 59.0, 0.024824880102854212 ], [ 60.0, 0.00785276819580084 ], [ 61.0, 0.010385919226704338 ], [ 62.0, 0.0037997265463552443 ], [ 63.0, 0.007346137989620142 ], [ 64.0, 0.018745317628685844 ], [ 65.0, 0.002279835927813146 ], [ 66.0, 0.00025331510309034957 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPMS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.000851515314077044 ], [ 44.0, 0.0007663637826693397 ], [ 45.0, 0.000425757657038522 ], [ 46.0, 0.0033209097249004707 ], [ 47.0, 0.00996272917470142 ], [ 48.0, 0.18937700585073636 ], [ 49.0, 1.4275654240502553 ], [ 50.0, 4.003399249133313 ], [ 51.0, 18.386429570747158 ], [ 52.0, 9.184359026098969 ], [ 53.0, 12.095264127268699 ], [ 54.0, 21.955641161245477 ], [ 55.0, 18.42466260834935 ], [ 56.0, 13.570599560437238 ], [ 57.0, 0.5818404141088257 ], [ 58.0, 0.12159638685020269 ], [ 59.0, 0.0217987920403723 ], [ 60.0, 0.008515153140770443 ], [ 61.0, 0.006471516386985536 ], [ 62.0, 0.0013624245025232703 ], [ 63.0, 0.0013624245025232703 ], [ 64.0, 0.003406061256308176 ], [ 65.0, 0.0010218183768924529 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVFS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.00048022113222631103 ], [ 45.0, 0.0 ], [ 46.0, 0.0 ], [ 47.0, 0.007299361209839929 ], [ 48.0, 0.033903611935177505 ], [ 49.0, 0.2948557751869546 ], [ 50.0, 1.1006668350626925 ], [ 51.0, 1.4244319224097446 ], [ 52.0, 17.384869384626363 ], [ 53.0, 14.725596842804867 ], [ 54.0, 59.7825366625507 ], [ 55.0, 4.745449184433853 ], [ 56.0, 0.29475973096050934 ], [ 57.0, 0.11294801029962892 ], [ 58.0, 0.04187528273013423 ], [ 59.0, 0.02266643744108186 ], [ 60.0, 0.011909484079212518 ], [ 61.0, 0.008067715021402027 ], [ 62.0, 0.0019208845289052441 ], [ 63.0, 0.00307341524624839 ], [ 64.0, 0.0015367076231241955 ], [ 65.0, 0.00038417690578104887 ], [ 66.0, 0.00038417690578104887 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.00038417690578104887 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVFS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0006726600678705363 ], [ 44.0, 0.0 ], [ 45.0, 0.0006726600678705363 ], [ 46.0, 0.0013453201357410726 ], [ 47.0, 0.004035960407223218 ], [ 48.0, 0.021525122171857168 ], [ 49.0, 0.11822000692824662 ], [ 50.0, 2.9798841006666925 ], [ 51.0, 71.22192064634142 ], [ 52.0, 22.15809529571055 ], [ 53.0, 0.5342602589061719 ], [ 54.0, 1.5370282550841168 ], [ 55.0, 0.8684041476208418 ], [ 56.0, 0.4183945622154777 ], [ 57.0, 0.04035960407223214 ], [ 58.0, 0.04523638956429351 ], [ 59.0, 0.025729247596048024 ], [ 60.0, 0.010089901018058045 ], [ 61.0, 0.005381280542964289 ], [ 62.0, 0.002690640271482145 ], [ 63.0, 0.0033633003393526814 ], [ 64.0, 0.0013453201357410726 ], [ 65.0, 0.0006726600678705363 ], [ 66.0, 0.0006726600678705363 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVMS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0007028542912769945 ], [ 35.0, 0.0007028542912769945 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0005622834330215957 ], [ 44.0, 0.001827421157320186 ], [ 45.0, 0.0029519880233633776 ], [ 46.0, 0.01068338522741032 ], [ 47.0, 0.01911763672273426 ], [ 48.0, 0.11920408780057848 ], [ 49.0, 1.9786754008030563 ], [ 50.0, 18.408035030250435 ], [ 51.0, 13.93633545829199 ], [ 52.0, 16.97955396866035 ], [ 53.0, 10.420377151611149 ], [ 54.0, 30.33406664466083 ], [ 55.0, 4.9641192884319 ], [ 56.0, 2.222846981592743 ], [ 57.0, 0.3268272454438056 ], [ 58.0, 0.1705124510637998 ], [ 59.0, 0.03092558881618774 ], [ 60.0, 0.016868502990647877 ], [ 61.0, 0.016868502990647877 ], [ 62.0, 0.011245668660431916 ], [ 63.0, 0.007309684629280744 ], [ 64.0, 0.016868502990647877 ], [ 65.0, 0.0011245668660431914 ], [ 66.0, 0.0011245668660431914 ], [ 67.0, 0.0005622834330215957 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVMS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.0 ], [ 46.0, 0.0 ], [ 47.0, 0.012501513855183978 ], [ 48.0, 0.04766202157288886 ], [ 49.0, 0.4576726087921302 ], [ 50.0, 5.796795705726402 ], [ 51.0, 60.92378373947592 ], [ 52.0, 21.311955744614057 ], [ 53.0, 2.029347303773463 ], [ 54.0, 6.437888963112702 ], [ 55.0, 1.625978145789807 ], [ 56.0, 1.1001332192561608 ], [ 57.0, 0.1406420308708196 ], [ 58.0, 0.06172622465997078 ], [ 59.0, 0.014064203087081978 ], [ 60.0, 0.009376135391387982 ], [ 61.0, 0.014845547703030976 ], [ 62.0, 0.005469412311642989 ], [ 63.0, 0.001562689231897997 ], [ 64.0, 0.006250756927591988 ], [ 65.0, 0.001562689231897997 ], [ 66.0, 0.0 ], [ 67.0, 0.0007813446159489985 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAFS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.0 ], [ 46.0, 0.0 ], [ 47.0, 0.001962002550602017 ], [ 48.0, 0.05101206631565236 ], [ 49.0, 1.6977862071208831 ], [ 50.0, 21.640397632490078 ], [ 51.0, 5.43164056112992 ], [ 52.0, 0.3549589614464181 ], [ 53.0, 0.9749517674366248 ], [ 54.0, 5.384552499915461 ], [ 55.0, 53.45884699654552 ], [ 56.0, 10.725940943713535 ], [ 57.0, 0.2164742814164238 ], [ 58.0, 0.03793204931163896 ], [ 59.0, 0.0052320068016053775 ], [ 60.0, 0.003924005101204033 ], [ 61.0, 0.004578005951404705 ], [ 62.0, 0.0013080017004013446 ], [ 63.0, 0.003270004251003361 ], [ 64.0, 0.002616003400802689 ], [ 65.0, 0.0 ], [ 66.0, 0.0006540008502006723 ], [ 67.0, 0.0006540008502006723 ], [ 68.0, 0.0006540008502006723 ], [ 69.0, 0.0006540008502006723 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAFS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.0 ], [ 46.0, 0.0 ], [ 47.0, 0.0020559210526307605 ], [ 48.0, 0.035978618421038326 ], [ 49.0, 2.2789884868411128 ], [ 50.0, 12.449629934205507 ], [ 51.0, 2.193667763156941 ], [ 52.0, 0.25621916118410937 ], [ 53.0, 0.9696237664469713 ], [ 54.0, 4.987921463814233 ], [ 55.0, 61.14848889804422 ], [ 56.0, 15.281661184201806 ], [ 57.0, 0.32277960526303123 ], [ 58.0, 0.03392269736840756 ], [ 59.0, 0.010279605263153802 ], [ 60.0, 0.010279605263153802 ], [ 61.0, 0.004111842105261521 ], [ 62.0, 0.0010279605263153802 ], [ 63.0, 0.0020559210526307605 ], [ 64.0, 0.009251644736838422 ], [ 65.0, 0.0 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0010279605263153802 ], [ 70.0, 0.0010279605263153802 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAMS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.0 ], [ 46.0, 0.0 ], [ 47.0, 0.0005298729099816101 ], [ 48.0, 0.012716949839558647 ], [ 49.0, 0.6337280003379923 ], [ 50.0, 77.21798176712556 ], [ 51.0, 19.879374431995284 ], [ 52.0, 0.3926358262963734 ], [ 53.0, 0.2055906890728662 ], [ 54.0, 0.4005839199460971 ], [ 55.0, 1.0215949704445089 ], [ 56.0, 0.22413624092222278 ], [ 57.0, 0.007948093649724153 ], [ 58.0, 0.0010597458199632201 ], [ 59.0, 0.0005298729099816101 ], [ 60.0, 0.0 ], [ 61.0, 0.0005298729099816101 ], [ 62.0, 0.0 ], [ 63.0, 0.0005298729099816101 ], [ 64.0, 0.0005298729099816101 ], [ 65.0, 0.0 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAMS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0013250181085786793 ], [ 43.0, 0.0029444846857303985 ], [ 44.0, 0.0017666908114382395 ], [ 45.0, 0.01884470198867456 ], [ 46.0, 0.015311320365798077 ], [ 47.0, 0.010011247931483357 ], [ 48.0, 0.04387282181738288 ], [ 49.0, 0.6778203746551243 ], [ 50.0, 75.68150098056337 ], [ 51.0, 18.792879058195055 ], [ 52.0, 0.5676966474088138 ], [ 53.0, 0.48480940350550766 ], [ 54.0, 0.7751355935185086 ], [ 55.0, 1.2634783786468673 ], [ 56.0, 0.5082180567570631 ], [ 57.0, 0.3097597889388407 ], [ 58.0, 0.27692878469294635 ], [ 59.0, 0.21082510349829794 ], [ 60.0, 0.15075761590939696 ], [ 61.0, 0.10482365481200209 ], [ 62.0, 0.048289548845978456 ], [ 63.0, 0.02237808361155104 ], [ 64.0, 0.010600144868629438 ], [ 65.0, 0.011189041805775518 ], [ 66.0, 0.007655660182899036 ], [ 67.0, 0.0011777938742921596 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCFS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.00045484058405995836 ], [ 42.0, 0.0 ], [ 43.0, 0.00045484058405995836 ], [ 44.0, 0.0009096811681199167 ], [ 45.0, 0.0 ], [ 46.0, 0.00045484058405995836 ], [ 47.0, 0.006822608760899376 ], [ 48.0, 0.024106550955177778 ], [ 49.0, 0.09699475455078627 ], [ 50.0, 2.2469124852563933 ], [ 51.0, 72.10815199412808 ], [ 52.0, 22.192581777454482 ], [ 53.0, 0.27893098817477213 ], [ 54.0, 1.3897654045952073 ], [ 55.0, 1.1035569670754304 ], [ 56.0, 0.433917917193195 ], [ 57.0, 0.057309913591554615 ], [ 58.0, 0.02547107270735765 ], [ 59.0, 0.014554898689918673 ], [ 60.0, 0.007732289929019294 ], [ 61.0, 0.0054580870087194994 ], [ 62.0, 0.0018193623362398334 ], [ 63.0, 0.0009096811681199167 ], [ 64.0, 0.0018193623362398334 ], [ 65.0, 0.00045484058405995836 ], [ 66.0, 0.00045484058405995836 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCFS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.000562085900776946 ], [ 43.0, 0.0012646932767481282 ], [ 44.0, 0.0 ], [ 45.0, 0.001124171801553892 ], [ 46.0, 0.0033725154046616757 ], [ 47.0, 0.004496687206215567 ], [ 48.0, 0.028104295038847284 ], [ 49.0, 0.08768540052120334 ], [ 50.0, 2.2642225298048624 ], [ 51.0, 72.21454818838308 ], [ 52.0, 22.93366683758547 ], [ 53.0, 0.23495190652476522 ], [ 54.0, 1.046603947246638 ], [ 55.0, 0.7325384501875372 ], [ 56.0, 0.3248856506490779 ], [ 57.0, 0.041032270756717 ], [ 58.0, 0.03316306814583978 ], [ 59.0, 0.015176319320977546 ], [ 60.0, 0.012365889817092813 ], [ 61.0, 0.01011754621398503 ], [ 62.0, 0.004496687206215567 ], [ 63.0, 0.0033725154046616757 ], [ 64.0, 0.0016862577023308383 ], [ 65.0, 0.0 ], [ 66.0, 0.000562085900776946 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCMS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0005251887068665926 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0005251887068665926 ], [ 45.0, 0.0005251887068665926 ], [ 46.0, 0.0005251887068665926 ], [ 47.0, 0.017331227326597563 ], [ 48.0, 0.11344076068318419 ], [ 49.0, 0.4621660620425977 ], [ 50.0, 2.3229096504711078 ], [ 51.0, 61.785300230746124 ], [ 52.0, 19.8195714197192 ], [ 53.0, 2.781399391565747 ], [ 54.0, 4.897778583061879 ], [ 55.0, 4.890163346812312 ], [ 56.0, 2.2857525494602875 ], [ 57.0, 0.355684051725402 ], [ 58.0, 0.15558715440922882 ], [ 59.0, 0.03413726594632848 ], [ 60.0, 0.012604528964798226 ], [ 61.0, 0.024683869222729846 ], [ 62.0, 0.01155415155106504 ], [ 63.0, 0.004726698361799332 ], [ 64.0, 0.021532736981530305 ], [ 65.0, 0.0010503774137331852 ], [ 66.0, 0.0005251887068665926 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCMS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0006605925184589667 ], [ 37.0, 0.0006605925184589667 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0008257406480737085 ], [ 44.0, 0.0006605925184589667 ], [ 45.0, 0.0 ], [ 46.0, 0.004624147629212767 ], [ 47.0, 0.021138960590686946 ], [ 48.0, 0.18166294257621665 ], [ 49.0, 0.755882989246658 ], [ 50.0, 4.009301142657543 ], [ 51.0, 53.0865359684768 ], [ 52.0, 18.200975364831365 ], [ 53.0, 4.117142871295993 ], [ 54.0, 7.873602227512501 ], [ 55.0, 6.832838714681347 ], [ 56.0, 3.824170089359375 ], [ 57.0, 0.6163328197222092 ], [ 58.0, 0.35011403478325553 ], [ 59.0, 0.03963555110753797 ], [ 60.0, 0.021138960590686946 ], [ 61.0, 0.027084293256817646 ], [ 62.0, 0.007266517703048633 ], [ 63.0, 0.005284740147671733 ], [ 64.0, 0.019817775553769013 ], [ 65.0, 0.0013211850369179334 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0013211850369179334 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPFS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.00036730810906118966 ], [ 43.0, 0.0 ], [ 44.0, 0.00036730810906118966 ], [ 45.0, 0.001101924327183569 ], [ 46.0, 0.0007346162181223793 ], [ 47.0, 0.0036730810906118964 ], [ 48.0, 0.023507718979916114 ], [ 49.0, 0.10468281108243953 ], [ 50.0, 3.190070927196906 ], [ 51.0, 73.00579244886089 ], [ 52.0, 21.46695512598587 ], [ 53.0, 0.1707982707134546 ], [ 54.0, 0.5013755688685112 ], [ 55.0, 1.162530165178678 ], [ 56.0, 0.2773176223411981 ], [ 57.0, 0.024793297361630273 ], [ 58.0, 0.02589522168881384 ], [ 59.0, 0.015426940580569969 ], [ 60.0, 0.012121167599019263 ], [ 61.0, 0.0058769297449790345 ], [ 62.0, 0.0025711567634283273 ], [ 63.0, 0.001101924327183569 ], [ 64.0, 0.0014692324362447586 ], [ 65.0, 0.001101924327183569 ], [ 66.0, 0.0 ], [ 67.0, 0.00036730810906118966 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPFS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.00042187996038472715 ], [ 41.0, 0.0008437599207694543 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.00042187996038472715 ], [ 45.0, 0.0016875198415389086 ], [ 46.0, 0.004218799603847271 ], [ 47.0, 0.00759383928692509 ], [ 48.0, 0.0219377579400058 ], [ 49.0, 0.15145490577811804 ], [ 50.0, 5.2903747032242885 ], [ 51.0, 69.48278571561602 ], [ 52.0, 21.52558121871428 ], [ 53.0, 0.26958129468584335 ], [ 54.0, 0.7168795226837249 ], [ 55.0, 1.9022567413748783 ], [ 56.0, 0.5117403919466629 ], [ 57.0, 0.04134423611770318 ], [ 58.0, 0.027844077385391956 ], [ 59.0, 0.01982835813808217 ], [ 60.0, 0.013078278771926546 ], [ 61.0, 0.0033750396830778163 ], [ 62.0, 0.0029531597226930897 ], [ 63.0, 0.0012656398811541816 ], [ 64.0, 0.0016875198415389086 ], [ 65.0, 0.0008437599207694543 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPMS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0003980848139596037 ], [ 42.0, 0.0011942544418788114 ], [ 43.0, 0.0003980848139596037 ], [ 44.0, 0.0015923392558384148 ], [ 45.0, 0.0007961696279192074 ], [ 46.0, 0.002388508883757622 ], [ 47.0, 0.07175478771621853 ], [ 48.0, 0.7039134722840463 ], [ 49.0, 2.3924897318974896 ], [ 50.0, 31.44442089110323 ], [ 51.0, 38.3387522628912 ], [ 52.0, 10.13722978747645 ], [ 53.0, 2.845609771387112 ], [ 54.0, 5.1061343874560645 ], [ 55.0, 5.752226040511914 ], [ 56.0, 2.474992809590636 ], [ 57.0, 0.4494377549603841 ], [ 58.0, 0.21735430842194564 ], [ 59.0, 0.0238850888375762 ], [ 60.0, 0.011942544418788116 ], [ 61.0, 0.009952120348990097 ], [ 62.0, 0.00437893295355564 ], [ 63.0, 0.0027865936977172255 ], [ 64.0, 0.005175102581474848 ], [ 65.0, 0.0003980848139596037 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0003980848139596037 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPMS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0006330616443773143 ], [ 43.0, 0.001424388699848957 ], [ 44.0, 0.0 ], [ 45.0, 0.0012661232887546286 ], [ 46.0, 0.005064493155018513 ], [ 47.0, 0.0633061644377313 ], [ 48.0, 0.3684418770276004 ], [ 49.0, 1.3541188573230252 ], [ 50.0, 23.597372794149862 ], [ 51.0, 49.07557173384133 ], [ 52.0, 13.578697475654694 ], [ 53.0, 2.0102872517201846 ], [ 54.0, 3.954577827014452 ], [ 55.0, 4.056184220937034 ], [ 56.0, 1.4770910817433116 ], [ 57.0, 0.2506924111734183 ], [ 58.0, 0.1202817124316897 ], [ 59.0, 0.02421460789743228 ], [ 60.0, 0.021524095908828693 ], [ 61.0, 0.019624910975696748 ], [ 62.0, 0.006330616443773141 ], [ 63.0, 0.0044314315106412 ], [ 64.0, 0.006963678088150456 ], [ 65.0, 0.0006330616443773143 ], [ 66.0, 0.0006330616443773143 ], [ 67.0, 0.0006330616443773143 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVFS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.0007796890989709885 ], [ 46.0, 0.001559378197941977 ], [ 47.0, 0.007017201890738895 ], [ 48.0, 0.031967253057810535 ], [ 49.0, 0.1719214463231033 ], [ 50.0, 5.375956337405652 ], [ 51.0, 68.50816237029741 ], [ 52.0, 21.447687734482983 ], [ 53.0, 0.5231713854095368 ], [ 54.0, 1.709858194043314 ], [ 55.0, 1.3488621412197668 ], [ 56.0, 0.6473368744206596 ], [ 57.0, 0.07894352127081242 ], [ 58.0, 0.05633253740065383 ], [ 59.0, 0.03976414404752039 ], [ 60.0, 0.021051605672216697 ], [ 61.0, 0.00935626918765186 ], [ 62.0, 0.008576580088680872 ], [ 63.0, 0.007017201890738895 ], [ 64.0, 0.003898445494854942 ], [ 65.0, 0.0007796890989709885 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVFS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0007345239476835185 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.0 ], [ 46.0, 0.0 ], [ 47.0, 0.023651671115409313 ], [ 48.0, 0.06933906066132402 ], [ 49.0, 0.6139151154738762 ], [ 50.0, 4.295936760422397 ], [ 51.0, 5.098918340030205 ], [ 52.0, 11.264218547302024 ], [ 53.0, 12.987852442934603 ], [ 54.0, 58.28814786853466 ], [ 55.0, 6.3346814296128775 ], [ 56.0, 0.7885849102330059 ], [ 57.0, 0.133536453688864 ], [ 58.0, 0.06405048823800269 ], [ 59.0, 0.014690478953670375 ], [ 60.0, 0.007051429897761778 ], [ 61.0, 0.006463810739614963 ], [ 62.0, 0.0017628574744404449 ], [ 63.0, 0.003525714948880889 ], [ 64.0, 0.0017628574744404449 ], [ 65.0, 0.0005876191581468149 ], [ 66.0, 0.0005876191581468149 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVMS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0003056122636095474 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.00024448981088763793 ], [ 44.0, 0.0007334694326629139 ], [ 45.0, 0.0010390816962724612 ], [ 46.0, 0.0017114286762134653 ], [ 47.0, 0.03642898182225796 ], [ 48.0, 0.1173551092260672 ], [ 49.0, 0.36105032822830935 ], [ 50.0, 2.4520494358452325 ], [ 51.0, 63.64717675380026 ], [ 52.0, 20.90290087168267 ], [ 53.0, 2.206520543261266 ], [ 54.0, 2.8106548659644077 ], [ 55.0, 3.441499700506662 ], [ 56.0, 3.3496937765184374 ], [ 57.0, 0.44619390486992433 ], [ 58.0, 0.13520286542086501 ], [ 59.0, 0.030316736550067034 ], [ 60.0, 0.0149138784641459 ], [ 61.0, 0.014669388653258262 ], [ 62.0, 0.010024082246393158 ], [ 63.0, 0.005623265650415674 ], [ 64.0, 0.012713470166157167 ], [ 65.0, 0.0007334694326629139 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.00024448981088763793 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVMS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0007236034002119199 ], [ 44.0, 0.0 ], [ 45.0, 0.0007236034002119199 ], [ 46.0, 0.0028944136008476795 ], [ 47.0, 0.06657151281949651 ], [ 48.0, 0.1651624760983711 ], [ 49.0, 0.7411507826670478 ], [ 50.0, 5.981305706152593 ], [ 51.0, 54.299922755373366 ], [ 52.0, 19.92369602142481 ], [ 53.0, 3.3596905871842124 ], [ 54.0, 4.507506480770631 ], [ 55.0, 5.16906088941453 ], [ 56.0, 4.229823675939244 ], [ 57.0, 1.1311730153812503 ], [ 58.0, 0.3026471221386378 ], [ 59.0, 0.0455870142133509 ], [ 60.0, 0.015195671404450321 ], [ 61.0, 0.012301257803602642 ], [ 62.0, 0.006512430601907277 ], [ 63.0, 0.007959637402331117 ], [ 64.0, 0.021708102006357605 ], [ 65.0, 0.005788827201695358 ], [ 66.0, 0.0028944136008476795 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null } ] }, { "plot_id": "fastqc_per_sequence_gc_content_plot", "label": "Counts", "uid": "fastqc_per_sequence_gc_content_plot_Counts", "dconfig": { "name": "Counts", "ylab": "Count", "tt_suffix": "", "title": "FastQC: Per Sequence GC Content
Counts, 64 samples" }, "layout": { "title": { "text": "FastQC: Per Sequence GC Content
Counts, 64 samples" }, "xaxis": { "hoverformat": null, "ticksuffix": "%", "title": { "text": "% GC" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": 100 } }, "yaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "Count" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": null } } }, "trace_params": { "hovertemplate": "%{text}
%{x} GC: %{y}", "mode": "lines", "line": { "width": 2 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "n_samples": 64, "lines": [ { "name": "CAFS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.0 ], [ 46.0, 0.0 ], [ 47.0, 3.250000000000001 ], [ 48.0, 89.35000000000072 ], [ 49.0, 794.2000000000436 ], [ 50.0, 1051.6500000001022 ], [ 51.0, 1237.0500000001443 ], [ 52.0, 2691.099999999744 ], [ 53.0, 7340.299999995516 ], [ 54.0, 9197.949999998402 ], [ 55.0, 13450.750000013872 ], [ 56.0, 3508.749999999 ], [ 57.0, 650.2000000000108 ], [ 58.0, 99.25000000000087 ], [ 59.0, 12.199999999999989 ], [ 60.0, 0.8 ], [ 61.0, 2.1999999999999997 ], [ 62.0, 1.0 ], [ 63.0, 7.0000000000000036 ], [ 64.0, 13.599999999999984 ], [ 65.0, 0.0 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAFS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.25 ], [ 46.0, 0.25 ], [ 47.0, 3.2000000000000006 ], [ 48.0, 98.60000000000086 ], [ 49.0, 891.4000000000657 ], [ 50.0, 1087.6500000001104 ], [ 51.0, 1256.0500000001484 ], [ 52.0, 2556.2499999998663 ], [ 53.0, 6740.599999996061 ], [ 54.0, 8059.849999994863 ], [ 55.0, 12487.050000010368 ], [ 56.0, 3152.949999999324 ], [ 57.0, 548.2499999999877 ], [ 58.0, 78.40000000000057 ], [ 59.0, 9.0 ], [ 60.0, 1.2 ], [ 61.0, 5.000000000000002 ], [ 62.0, 0.0 ], [ 63.0, 5.8000000000000025 ], [ 64.0, 11.399999999999991 ], [ 65.0, 0.0 ], [ 66.0, 0.2 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAMS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.75 ], [ 46.0, 1.4 ], [ 47.0, 11.099999999999993 ], [ 48.0, 658.0000000000126 ], [ 49.0, 1198.6000000001354 ], [ 50.0, 1371.6000000001748 ], [ 51.0, 1162.300000000127 ], [ 52.0, 1718.0000000002533 ], [ 53.0, 6763.449999996042 ], [ 54.0, 10319.100000002478 ], [ 55.0, 10109.600000001717 ], [ 56.0, 2374.700000000031 ], [ 57.0, 619.2500000000039 ], [ 58.0, 78.05000000000057 ], [ 59.0, 8.400000000000002 ], [ 60.0, 1.2 ], [ 61.0, 8.000000000000004 ], [ 62.0, 0.2 ], [ 63.0, 9.799999999999997 ], [ 64.0, 16.99999999999997 ], [ 65.0, 0.0 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAMS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 3.0 ], [ 46.0, 1.25 ], [ 47.0, 13.199999999999985 ], [ 48.0, 731.8000000000294 ], [ 49.0, 1296.8000000001578 ], [ 50.0, 1530.2000000002108 ], [ 51.0, 1338.3000000001673 ], [ 52.0, 1831.7500000002792 ], [ 53.0, 7499.249999995373 ], [ 54.0, 11510.10000000681 ], [ 55.0, 12203.10000000933 ], [ 56.0, 2620.6499999998077 ], [ 57.0, 606.800000000001 ], [ 58.0, 82.60000000000063 ], [ 59.0, 10.399999999999995 ], [ 60.0, 0.8 ], [ 61.0, 2.1999999999999997 ], [ 62.0, 1.0 ], [ 63.0, 8.400000000000002 ], [ 64.0, 14.59999999999998 ], [ 65.0, 0.0 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCFS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.45 ], [ 46.0, 2.25 ], [ 47.0, 214.59999999999638 ], [ 48.0, 1287.8000000001557 ], [ 49.0, 2990.849999999471 ], [ 50.0, 2333.5000000000687 ], [ 51.0, 3509.6999999989994 ], [ 52.0, 4896.099999997738 ], [ 53.0, 9182.399999998344 ], [ 54.0, 13596.600000014354 ], [ 55.0, 9652.000000000053 ], [ 56.0, 3788.6499999987454 ], [ 57.0, 1059.700000000104 ], [ 58.0, 596.6499999999987 ], [ 59.0, 21.599999999999955 ], [ 60.0, 5.8000000000000025 ], [ 61.0, 3.600000000000001 ], [ 62.0, 1.2 ], [ 63.0, 1.9999999999999998 ], [ 64.0, 9.599999999999998 ], [ 65.0, 0.6000000000000001 ], [ 66.0, 0.2 ], [ 67.0, 0.4 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCFS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.7 ], [ 46.0, 1.2 ], [ 47.0, 226.2999999999957 ], [ 48.0, 1075.4500000001074 ], [ 49.0, 2375.050000000031 ], [ 50.0, 2027.300000000324 ], [ 51.0, 3569.149999998945 ], [ 52.0, 4631.999999997979 ], [ 53.0, 8789.849999996919 ], [ 54.0, 12852.600000011666 ], [ 55.0, 8919.049999997385 ], [ 56.0, 3592.0499999989242 ], [ 57.0, 1071.3000000001066 ], [ 58.0, 611.650000000002 ], [ 59.0, 18.799999999999965 ], [ 60.0, 3.800000000000001 ], [ 61.0, 3.600000000000001 ], [ 62.0, 1.5999999999999999 ], [ 63.0, 3.0000000000000004 ], [ 64.0, 8.200000000000003 ], [ 65.0, 0.8 ], [ 66.0, 0.4 ], [ 67.0, 0.2 ], [ 68.0, 0.0 ], [ 69.0, 0.2 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCMS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.2 ], [ 43.0, 0.25 ], [ 44.0, 0.0 ], [ 45.0, 0.65 ], [ 46.0, 4.200000000000001 ], [ 47.0, 400.6999999999858 ], [ 48.0, 1313.3000000001614 ], [ 49.0, 2893.8499999995593 ], [ 50.0, 1243.3000000001455 ], [ 51.0, 2156.9000000002293 ], [ 52.0, 5273.999999997395 ], [ 53.0, 9721.400000000303 ], [ 54.0, 10281.350000002338 ], [ 55.0, 8790.899999996922 ], [ 56.0, 6661.299999996134 ], [ 57.0, 1461.2000000001951 ], [ 58.0, 812.0000000000476 ], [ 59.0, 18.999999999999964 ], [ 60.0, 4.800000000000002 ], [ 61.0, 4.600000000000001 ], [ 62.0, 2.6 ], [ 63.0, 3.400000000000001 ], [ 64.0, 8.000000000000004 ], [ 65.0, 0.4 ], [ 66.0, 0.0 ], [ 67.0, 0.2 ], [ 68.0, 0.4 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCMS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 1.1 ], [ 46.0, 3.3500000000000005 ], [ 47.0, 308.699999999991 ], [ 48.0, 1159.2500000001266 ], [ 49.0, 2623.649999999805 ], [ 50.0, 1076.7000000001076 ], [ 51.0, 2048.8500000003273 ], [ 52.0, 4785.849999997839 ], [ 53.0, 9444.449999999297 ], [ 54.0, 9958.65000000116 ], [ 55.0, 8528.94999999597 ], [ 56.0, 6086.449999996657 ], [ 57.0, 1251.6500000001474 ], [ 58.0, 660.0000000000131 ], [ 59.0, 17.39999999999997 ], [ 60.0, 6.000000000000003 ], [ 61.0, 5.600000000000002 ], [ 62.0, 3.400000000000001 ], [ 63.0, 3.2000000000000006 ], [ 64.0, 8.8 ], [ 65.0, 0.6000000000000001 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPFS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.2 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.2 ], [ 46.0, 0.4 ], [ 47.0, 1.4 ], [ 48.0, 8.400000000000002 ], [ 49.0, 164.5999999999992 ], [ 50.0, 2166.4000000002206 ], [ 51.0, 1783.4000000002684 ], [ 52.0, 2294.900000000104 ], [ 53.0, 4855.449999997776 ], [ 54.0, 1792.0000000002703 ], [ 55.0, 16785.650000026002 ], [ 56.0, 5131.799999997524 ], [ 57.0, 87.6500000000007 ], [ 58.0, 24.799999999999944 ], [ 59.0, 8.200000000000003 ], [ 60.0, 6.600000000000003 ], [ 61.0, 3.600000000000001 ], [ 62.0, 1.4 ], [ 63.0, 0.8 ], [ 64.0, 0.8 ], [ 65.0, 0.6000000000000001 ], [ 66.0, 0.0 ], [ 67.0, 0.2 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPFS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.0 ], [ 46.0, 0.0 ], [ 47.0, 8.750000000000004 ], [ 48.0, 355.4499999999884 ], [ 49.0, 1548.0500000002148 ], [ 50.0, 1141.8500000001227 ], [ 51.0, 1198.9000000001356 ], [ 52.0, 4429.249999998164 ], [ 53.0, 8952.94999999751 ], [ 54.0, 10900.00000000459 ], [ 55.0, 8794.149999996938 ], [ 56.0, 4643.949999997968 ], [ 57.0, 814.1500000000482 ], [ 58.0, 269.79999999999325 ], [ 59.0, 17.59999999999997 ], [ 60.0, 3.800000000000001 ], [ 61.0, 1.0 ], [ 62.0, 1.0 ], [ 63.0, 2.4 ], [ 64.0, 6.200000000000003 ], [ 65.0, 0.6000000000000001 ], [ 66.0, 0.2 ], [ 67.0, 0.2 ], [ 68.0, 0.2 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPMS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.2 ], [ 43.0, 0.2 ], [ 44.0, 0.0 ], [ 45.0, 0.65 ], [ 46.0, 1.25 ], [ 47.0, 31.19999999999992 ], [ 48.0, 796.8500000000441 ], [ 49.0, 2512.899999999906 ], [ 50.0, 1366.9000000001736 ], [ 51.0, 2440.299999999972 ], [ 52.0, 5460.1499999972275 ], [ 53.0, 10533.600000003256 ], [ 54.0, 12757.000000011327 ], [ 55.0, 12004.400000008602 ], [ 56.0, 5792.099999996924 ], [ 57.0, 1166.9000000001283 ], [ 58.0, 405.6499999999855 ], [ 59.0, 18.04999999999997 ], [ 60.0, 5.000000000000002 ], [ 61.0, 1.7999999999999998 ], [ 62.0, 1.2 ], [ 63.0, 2.1999999999999997 ], [ 64.0, 7.800000000000004 ], [ 65.0, 0.0 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPMS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.2 ], [ 43.0, 0.0 ], [ 44.0, 0.25 ], [ 45.0, 0.8500000000000001 ], [ 46.0, 1.45 ], [ 47.0, 18.649999999999967 ], [ 48.0, 732.2000000000295 ], [ 49.0, 2581.9999999998427 ], [ 50.0, 1688.7000000002467 ], [ 51.0, 2493.499999999923 ], [ 52.0, 5404.199999997277 ], [ 53.0, 9446.499999999305 ], [ 54.0, 10471.400000003032 ], [ 55.0, 10299.600000002405 ], [ 56.0, 5091.249999997561 ], [ 57.0, 1129.2000000001196 ], [ 58.0, 297.79999999999166 ], [ 59.0, 16.99999999999997 ], [ 60.0, 3.400000000000001 ], [ 61.0, 4.200000000000001 ], [ 62.0, 1.5999999999999999 ], [ 63.0, 2.4 ], [ 64.0, 9.999999999999996 ], [ 65.0, 0.4 ], [ 66.0, 0.2 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVFS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.4 ], [ 46.0, 0.8500000000000001 ], [ 47.0, 47.150000000000134 ], [ 48.0, 753.8500000000345 ], [ 49.0, 2463.7499999999504 ], [ 50.0, 1493.9000000002025 ], [ 51.0, 2595.5999999998303 ], [ 52.0, 5190.4999999974725 ], [ 53.0, 14280.900000016885 ], [ 54.0, 11631.550000007246 ], [ 55.0, 8991.349999997654 ], [ 56.0, 4809.049999997817 ], [ 57.0, 789.6000000000425 ], [ 58.0, 164.4499999999992 ], [ 59.0, 11.59999999999999 ], [ 60.0, 5.8000000000000025 ], [ 61.0, 4.450000000000002 ], [ 62.0, 1.2 ], [ 63.0, 3.800000000000001 ], [ 64.0, 7.600000000000004 ], [ 65.0, 0.4 ], [ 66.0, 0.2 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVFS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.25 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.45 ], [ 46.0, 1.45 ], [ 47.0, 47.100000000000136 ], [ 48.0, 896.6000000000669 ], [ 49.0, 2907.099999999548 ], [ 50.0, 1672.8500000002432 ], [ 51.0, 2454.8499999999585 ], [ 52.0, 4530.749999998071 ], [ 53.0, 12630.550000010888 ], [ 54.0, 10776.500000004142 ], [ 55.0, 8722.899999996676 ], [ 56.0, 4741.449999997879 ], [ 57.0, 801.4000000000452 ], [ 58.0, 199.5999999999972 ], [ 59.0, 14.999999999999979 ], [ 60.0, 6.000000000000003 ], [ 61.0, 4.400000000000001 ], [ 62.0, 1.4 ], [ 63.0, 1.2 ], [ 64.0, 6.200000000000003 ], [ 65.0, 0.6000000000000001 ], [ 66.0, 0.2 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVMS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.25 ], [ 44.0, 0.2 ], [ 45.0, 0.6000000000000001 ], [ 46.0, 2.1999999999999997 ], [ 47.0, 146.60000000000022 ], [ 48.0, 3029.7999999994354 ], [ 49.0, 7548.949999995326 ], [ 50.0, 1644.1500000002366 ], [ 51.0, 1690.8000000002473 ], [ 52.0, 2811.699999999634 ], [ 53.0, 7443.899999995422 ], [ 54.0, 7450.999999995419 ], [ 55.0, 8400.999999995503 ], [ 56.0, 3930.6999999986165 ], [ 57.0, 870.1500000000608 ], [ 58.0, 308.449999999991 ], [ 59.0, 14.39999999999998 ], [ 60.0, 5.000000000000002 ], [ 61.0, 4.000000000000001 ], [ 62.0, 1.2 ], [ 63.0, 1.5999999999999999 ], [ 64.0, 2.1999999999999997 ], [ 65.0, 0.2 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.2 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVMS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.45 ], [ 44.0, 0.5 ], [ 45.0, 0.4 ], [ 46.0, 3.0000000000000004 ], [ 47.0, 212.79999999999646 ], [ 48.0, 3472.099999999033 ], [ 49.0, 8355.749999995336 ], [ 50.0, 1953.8500000003066 ], [ 51.0, 1896.7000000002943 ], [ 52.0, 3499.249999999009 ], [ 53.0, 9020.549999997756 ], [ 54.0, 9578.449999999786 ], [ 55.0, 11381.450000006342 ], [ 56.0, 5286.999999997384 ], [ 57.0, 1183.2000000001317 ], [ 58.0, 376.0499999999872 ], [ 59.0, 18.799999999999965 ], [ 60.0, 4.800000000000002 ], [ 61.0, 5.850000000000002 ], [ 62.0, 2.4 ], [ 63.0, 0.8 ], [ 64.0, 4.800000000000002 ], [ 65.0, 0.6000000000000001 ], [ 66.0, 0.4 ], [ 67.0, 0.2 ], [ 68.0, 0.0 ], [ 69.0, 0.2 ], [ 70.0, 0.2 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAFS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.2 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.2 ], [ 43.0, 1.4 ], [ 44.0, 1.7 ], [ 45.0, 0.9 ], [ 46.0, 0.8 ], [ 47.0, 1.7999999999999998 ], [ 48.0, 70.05000000000045 ], [ 49.0, 227.54999999999563 ], [ 50.0, 1040.2000000000994 ], [ 51.0, 366.59999999998774 ], [ 52.0, 366.14999999998776 ], [ 53.0, 1362.6500000001724 ], [ 54.0, 3182.949999999297 ], [ 55.0, 11531.550000006888 ], [ 56.0, 2608.449999999819 ], [ 57.0, 169.59999999999891 ], [ 58.0, 30.099999999999927 ], [ 59.0, 5.250000000000002 ], [ 60.0, 2.5500000000000003 ], [ 61.0, 3.250000000000001 ], [ 62.0, 1.0 ], [ 63.0, 2.8000000000000003 ], [ 64.0, 7.400000000000004 ], [ 65.0, 0.8 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.2 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.2 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAFS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.2 ], [ 44.0, 0.0 ], [ 45.0, 1.25 ], [ 46.0, 2.8000000000000003 ], [ 47.0, 7.400000000000004 ], [ 48.0, 74.05000000000051 ], [ 49.0, 122.6000000000012 ], [ 50.0, 501.79999999998006 ], [ 51.0, 182.59999999999818 ], [ 52.0, 159.64999999999947 ], [ 53.0, 637.1000000000079 ], [ 54.0, 1368.850000000174 ], [ 55.0, 4331.749999998252 ], [ 56.0, 1371.3000000001748 ], [ 57.0, 71.55000000000047 ], [ 58.0, 13.249999999999986 ], [ 59.0, 3.400000000000001 ], [ 60.0, 0.2 ], [ 61.0, 1.4 ], [ 62.0, 4.200000000000001 ], [ 63.0, 1.9999999999999998 ], [ 64.0, 2.6 ], [ 65.0, 0.0 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.8 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAMS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 1.0 ], [ 44.0, 1.0 ], [ 45.0, 0.9 ], [ 46.0, 2.5 ], [ 47.0, 8.9 ], [ 48.0, 94.9000000000008 ], [ 49.0, 166.24999999999912 ], [ 50.0, 9525.14999999959 ], [ 51.0, 2688.9999999997453 ], [ 52.0, 146.45000000000022 ], [ 53.0, 320.2499999999904 ], [ 54.0, 533.5999999999844 ], [ 55.0, 840.0500000000541 ], [ 56.0, 373.59999999998735 ], [ 57.0, 32.59999999999993 ], [ 58.0, 8.650000000000002 ], [ 59.0, 3.2000000000000006 ], [ 60.0, 1.2 ], [ 61.0, 1.5999999999999999 ], [ 62.0, 3.800000000000001 ], [ 63.0, 2.6 ], [ 64.0, 0.6000000000000001 ], [ 65.0, 0.0 ], [ 66.0, 0.4 ], [ 67.0, 0.4 ], [ 68.0, 0.6000000000000001 ], [ 69.0, 34.799999999999955 ], [ 70.0, 5.600000000000002 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAMS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.2 ], [ 35.0, 0.2 ], [ 36.0, 0.8 ], [ 37.0, 0.4 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.7 ], [ 44.0, 0.0 ], [ 45.0, 0.0 ], [ 46.0, 0.25 ], [ 47.0, 0.2 ], [ 48.0, 6.650000000000004 ], [ 49.0, 149.65000000000003 ], [ 50.0, 13392.400000013658 ], [ 51.0, 3701.999999998824 ], [ 52.0, 133.25000000000097 ], [ 53.0, 244.3499999999947 ], [ 54.0, 420.84999999998473 ], [ 55.0, 391.5999999999863 ], [ 56.0, 141.20000000000053 ], [ 57.0, 70.55000000000045 ], [ 58.0, 5.250000000000002 ], [ 59.0, 1.5999999999999999 ], [ 60.0, 1.5999999999999999 ], [ 61.0, 0.45 ], [ 62.0, 0.0 ], [ 63.0, 0.4 ], [ 64.0, 1.2 ], [ 65.0, 0.2 ], [ 66.0, 0.2 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCFS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.45 ], [ 35.0, 0.0 ], [ 36.0, 1.4 ], [ 37.0, 1.65 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.5 ], [ 42.0, 0.4 ], [ 43.0, 4.1 ], [ 44.0, 3.6 ], [ 45.0, 1.7999999999999998 ], [ 46.0, 2.3 ], [ 47.0, 5.100000000000002 ], [ 48.0, 25.699999999999942 ], [ 49.0, 168.54999999999896 ], [ 50.0, 7809.649999995091 ], [ 51.0, 10549.950000003317 ], [ 52.0, 2613.799999999814 ], [ 53.0, 360.69999999998845 ], [ 54.0, 3414.8499999990877 ], [ 55.0, 2742.799999999697 ], [ 56.0, 806.5000000000464 ], [ 57.0, 83.20000000000063 ], [ 58.0, 55.050000000000246 ], [ 59.0, 16.399999999999974 ], [ 60.0, 10.199999999999998 ], [ 61.0, 4.400000000000001 ], [ 62.0, 1.5999999999999999 ], [ 63.0, 2.45 ], [ 64.0, 2.05 ], [ 65.0, 0.0 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.2 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.25 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCFS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.2 ], [ 36.0, 1.9999999999999998 ], [ 37.0, 1.4 ], [ 38.0, 0.6000000000000001 ], [ 39.0, 0.2 ], [ 40.0, 0.0 ], [ 41.0, 0.2 ], [ 42.0, 1.15 ], [ 43.0, 2.4 ], [ 44.0, 4.0 ], [ 45.0, 1.15 ], [ 46.0, 1.9 ], [ 47.0, 1.7999999999999998 ], [ 48.0, 8.9 ], [ 49.0, 96.2000000000008 ], [ 50.0, 3565.7999999989506 ], [ 51.0, 6820.49999999599 ], [ 52.0, 1802.6500000002723 ], [ 53.0, 182.64999999999833 ], [ 54.0, 1681.1000000002432 ], [ 55.0, 1350.85000000017 ], [ 56.0, 393.0499999999863 ], [ 57.0, 48.25000000000015 ], [ 58.0, 22.299999999999958 ], [ 59.0, 7.350000000000004 ], [ 60.0, 4.400000000000001 ], [ 61.0, 4.450000000000001 ], [ 62.0, 0.8500000000000001 ], [ 63.0, 1.65 ], [ 64.0, 2.85 ], [ 65.0, 0.8 ], [ 66.0, 0.8 ], [ 67.0, 0.45 ], [ 68.0, 0.95 ], [ 69.0, 0.25 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCMS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.2 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.25 ], [ 44.0, 0.6000000000000001 ], [ 45.0, 0.45 ], [ 46.0, 1.05 ], [ 47.0, 15.199999999999978 ], [ 48.0, 67.80000000000042 ], [ 49.0, 378.1999999999871 ], [ 50.0, 14145.200000016397 ], [ 51.0, 17932.250000030173 ], [ 52.0, 4610.7999999979975 ], [ 53.0, 1316.8500000001623 ], [ 54.0, 9656.750000000071 ], [ 55.0, 7640.399999995244 ], [ 56.0, 1598.4500000002263 ], [ 57.0, 231.09999999999542 ], [ 58.0, 122.35000000000119 ], [ 59.0, 21.849999999999962 ], [ 60.0, 5.8000000000000025 ], [ 61.0, 10.199999999999996 ], [ 62.0, 6.600000000000003 ], [ 63.0, 0.8 ], [ 64.0, 7.800000000000004 ], [ 65.0, 0.6000000000000001 ], [ 66.0, 0.2 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCMS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.25 ], [ 36.0, 0.8 ], [ 37.0, 1.2 ], [ 38.0, 0.4 ], [ 39.0, 0.6000000000000001 ], [ 40.0, 0.7 ], [ 41.0, 0.25 ], [ 42.0, 0.2 ], [ 43.0, 3.95 ], [ 44.0, 4.6000000000000005 ], [ 45.0, 1.15 ], [ 46.0, 1.45 ], [ 47.0, 6.200000000000003 ], [ 48.0, 44.25000000000009 ], [ 49.0, 177.94999999999848 ], [ 50.0, 4480.749999998119 ], [ 51.0, 7058.249999995773 ], [ 52.0, 1890.4000000002925 ], [ 53.0, 533.8499999999847 ], [ 54.0, 3691.149999998837 ], [ 55.0, 2803.099999999642 ], [ 56.0, 563.1999999999911 ], [ 57.0, 92.25000000000075 ], [ 58.0, 55.15000000000024 ], [ 59.0, 13.499999999999986 ], [ 60.0, 5.8000000000000025 ], [ 61.0, 6.0500000000000025 ], [ 62.0, 5.200000000000002 ], [ 63.0, 2.7 ], [ 64.0, 3.700000000000001 ], [ 65.0, 0.2 ], [ 66.0, 0.45 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.2 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.25 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPFS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 1.0 ], [ 37.0, 0.6000000000000001 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.25 ], [ 42.0, 0.8500000000000001 ], [ 43.0, 0.0 ], [ 44.0, 0.45 ], [ 45.0, 0.25 ], [ 46.0, 0.6000000000000001 ], [ 47.0, 4.000000000000001 ], [ 48.0, 25.59999999999994 ], [ 49.0, 162.5999999999993 ], [ 50.0, 7153.999999995684 ], [ 51.0, 11188.000000005639 ], [ 52.0, 2946.049999999512 ], [ 53.0, 512.8999999999797 ], [ 54.0, 4424.0499999981685 ], [ 55.0, 5967.399999996764 ], [ 56.0, 1150.6000000001245 ], [ 57.0, 82.80000000000064 ], [ 58.0, 30.999999999999922 ], [ 59.0, 5.8000000000000025 ], [ 60.0, 3.0000000000000004 ], [ 61.0, 1.5999999999999999 ], [ 62.0, 1.0 ], [ 63.0, 1.8499999999999999 ], [ 64.0, 3.8500000000000014 ], [ 65.0, 0.65 ], [ 66.0, 0.45 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPFS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.6000000000000001 ], [ 36.0, 2.6 ], [ 37.0, 1.9999999999999998 ], [ 38.0, 0.4 ], [ 39.0, 0.2 ], [ 40.0, 0.8500000000000001 ], [ 41.0, 0.7 ], [ 42.0, 0.5 ], [ 43.0, 7.15 ], [ 44.0, 5.7 ], [ 45.0, 1.0999999999999999 ], [ 46.0, 3.7000000000000006 ], [ 47.0, 7.900000000000004 ], [ 48.0, 19.449999999999964 ], [ 49.0, 186.29999999999797 ], [ 50.0, 6850.399999995965 ], [ 51.0, 10172.950000001947 ], [ 52.0, 2583.5499999998424 ], [ 53.0, 497.24999999998124 ], [ 54.0, 4117.449999998452 ], [ 55.0, 5014.4499999976315 ], [ 56.0, 839.750000000054 ], [ 57.0, 58.500000000000284 ], [ 58.0, 44.90000000000009 ], [ 59.0, 20.49999999999996 ], [ 60.0, 6.150000000000003 ], [ 61.0, 8.050000000000004 ], [ 62.0, 4.800000000000002 ], [ 63.0, 3.8500000000000014 ], [ 64.0, 2.6 ], [ 65.0, 0.0 ], [ 66.0, 0.25 ], [ 67.0, 0.5 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPMS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.4 ], [ 36.0, 0.8 ], [ 37.0, 0.2 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.5 ], [ 44.0, 0.5 ], [ 45.0, 0.65 ], [ 46.0, 1.25 ], [ 47.0, 15.199999999999978 ], [ 48.0, 147.40000000000018 ], [ 49.0, 499.2499999999802 ], [ 50.0, 3530.699999998981 ], [ 51.0, 4664.499999997949 ], [ 52.0, 1410.3500000001836 ], [ 53.0, 1506.950000000205 ], [ 54.0, 3051.349999999418 ], [ 55.0, 3083.949999999387 ], [ 56.0, 1351.9000000001704 ], [ 57.0, 245.3499999999946 ], [ 58.0, 105.85000000000096 ], [ 59.0, 3.0500000000000003 ], [ 60.0, 1.15 ], [ 61.0, 4.400000000000001 ], [ 62.0, 2.1999999999999997 ], [ 63.0, 1.0 ], [ 64.0, 6.000000000000003 ], [ 65.0, 0.2 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPMS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.2 ], [ 37.0, 0.0 ], [ 38.0, 0.25 ], [ 39.0, 0.0 ], [ 40.0, 0.2 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.2 ], [ 45.0, 0.6000000000000001 ], [ 46.0, 3.1000000000000005 ], [ 47.0, 28.99999999999993 ], [ 48.0, 428.9999999999842 ], [ 49.0, 1190.2500000001337 ], [ 50.0, 5154.649999997503 ], [ 51.0, 4527.049999998074 ], [ 52.0, 1303.8000000001593 ], [ 53.0, 1387.8000000001782 ], [ 54.0, 2744.6499999996945 ], [ 55.0, 2756.2499999996844 ], [ 56.0, 816.5000000000487 ], [ 57.0, 166.5499999999991 ], [ 58.0, 63.85000000000037 ], [ 59.0, 8.600000000000001 ], [ 60.0, 6.200000000000003 ], [ 61.0, 4.800000000000002 ], [ 62.0, 1.4 ], [ 63.0, 0.4 ], [ 64.0, 2.25 ], [ 65.0, 1.25 ], [ 66.0, 0.0 ], [ 67.0, 0.4 ], [ 68.0, 0.2 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.25 ], [ 74.0, 0.25 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVFS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.2 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.6000000000000001 ], [ 46.0, 1.8499999999999999 ], [ 47.0, 16.649999999999974 ], [ 48.0, 69.20000000000044 ], [ 49.0, 260.94999999999374 ], [ 50.0, 6388.3499999963815 ], [ 51.0, 3684.5499999988406 ], [ 52.0, 935.3000000000757 ], [ 53.0, 1192.5000000001337 ], [ 54.0, 2003.5500000003178 ], [ 55.0, 1485.4500000002006 ], [ 56.0, 745.2000000000323 ], [ 57.0, 152.44999999999987 ], [ 58.0, 68.90000000000043 ], [ 59.0, 10.699999999999994 ], [ 60.0, 7.400000000000004 ], [ 61.0, 4.200000000000001 ], [ 62.0, 2.45 ], [ 63.0, 2.05 ], [ 64.0, 4.400000000000001 ], [ 65.0, 0.2 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.25 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVFS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.25 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.2 ], [ 37.0, 0.6000000000000001 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.6000000000000001 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 4.3500000000000005 ], [ 44.0, 2.9 ], [ 45.0, 0.45 ], [ 46.0, 1.65 ], [ 47.0, 16.149999999999977 ], [ 48.0, 50.95000000000019 ], [ 49.0, 266.6999999999935 ], [ 50.0, 7612.599999995272 ], [ 51.0, 7451.099999995417 ], [ 52.0, 2008.6500000003196 ], [ 53.0, 912.7000000000695 ], [ 54.0, 2161.950000000224 ], [ 55.0, 1731.1000000002564 ], [ 56.0, 1132.8500000001202 ], [ 57.0, 137.65000000000072 ], [ 58.0, 60.70000000000033 ], [ 59.0, 15.449999999999978 ], [ 60.0, 2.7000000000000006 ], [ 61.0, 2.05 ], [ 62.0, 1.0 ], [ 63.0, 1.5999999999999999 ], [ 64.0, 5.200000000000002 ], [ 65.0, 1.0 ], [ 66.0, 0.2 ], [ 67.0, 0.0 ], [ 68.0, 0.2 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.25 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVMS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.2 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.8 ], [ 40.0, 0.8 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.2 ], [ 44.0, 0.2 ], [ 45.0, 1.3 ], [ 46.0, 1.9 ], [ 47.0, 175.84999999999854 ], [ 48.0, 578.5999999999946 ], [ 49.0, 1515.2500000002074 ], [ 50.0, 6758.0499999960475 ], [ 51.0, 4549.9499999980535 ], [ 52.0, 2777.749999999665 ], [ 53.0, 5130.649999997527 ], [ 54.0, 6774.399999996037 ], [ 55.0, 6158.899999996597 ], [ 56.0, 3790.4499999987447 ], [ 57.0, 648.2000000000104 ], [ 58.0, 362.74999999998795 ], [ 59.0, 18.649999999999967 ], [ 60.0, 6.600000000000003 ], [ 61.0, 11.59999999999999 ], [ 62.0, 3.2000000000000006 ], [ 63.0, 1.9999999999999998 ], [ 64.0, 13.599999999999984 ], [ 65.0, 3.600000000000001 ], [ 66.0, 0.6000000000000001 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVMS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.2 ], [ 43.0, 0.8500000000000001 ], [ 44.0, 1.7999999999999998 ], [ 45.0, 0.65 ], [ 46.0, 1.0999999999999999 ], [ 47.0, 39.85000000000003 ], [ 48.0, 182.59999999999818 ], [ 49.0, 773.550000000039 ], [ 50.0, 10195.200000002027 ], [ 51.0, 6869.499999995944 ], [ 52.0, 2387.50000000002 ], [ 53.0, 3575.6999999989393 ], [ 54.0, 5090.349999997565 ], [ 55.0, 5025.899999997623 ], [ 56.0, 3055.549999999412 ], [ 57.0, 519.3999999999811 ], [ 58.0, 263.94999999999357 ], [ 59.0, 17.19999999999997 ], [ 60.0, 4.400000000000001 ], [ 61.0, 15.799999999999976 ], [ 62.0, 7.400000000000004 ], [ 63.0, 10.399999999999995 ], [ 64.0, 21.999999999999954 ], [ 65.0, 1.2 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.25 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAFS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.0 ], [ 46.0, 0.0 ], [ 47.0, 0.0 ], [ 48.0, 1.0 ], [ 49.0, 52.80000000000021 ], [ 50.0, 732.2000000000295 ], [ 51.0, 152.59999999999988 ], [ 52.0, 136.5000000000008 ], [ 53.0, 2183.600000000205 ], [ 54.0, 14359.050000017176 ], [ 55.0, 16587.550000025283 ], [ 56.0, 2409.5999999999995 ], [ 57.0, 233.79999999999526 ], [ 58.0, 17.59999999999997 ], [ 59.0, 0.0 ], [ 60.0, 0.2 ], [ 61.0, 0.2 ], [ 62.0, 0.0 ], [ 63.0, 0.0 ], [ 64.0, 0.2 ], [ 65.0, 0.0 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAFS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.0 ], [ 46.0, 0.0 ], [ 47.0, 0.0 ], [ 48.0, 1.0 ], [ 49.0, 24.399999999999945 ], [ 50.0, 626.8000000000055 ], [ 51.0, 130.25000000000114 ], [ 52.0, 44.6000000000001 ], [ 53.0, 290.34999999999206 ], [ 54.0, 2170.550000000217 ], [ 55.0, 21742.900000044036 ], [ 56.0, 3495.399999999012 ], [ 57.0, 52.2000000000002 ], [ 58.0, 6.000000000000003 ], [ 59.0, 2.8500000000000005 ], [ 60.0, 0.6000000000000001 ], [ 61.0, 0.0 ], [ 62.0, 0.6000000000000001 ], [ 63.0, 0.2 ], [ 64.0, 0.2 ], [ 65.0, 0.0 ], [ 66.0, 0.2 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAMS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.0 ], [ 46.0, 0.0 ], [ 47.0, 0.2 ], [ 48.0, 1.4 ], [ 49.0, 21.199999999999957 ], [ 50.0, 302.99999999999136 ], [ 51.0, 70.20000000000046 ], [ 52.0, 90.95000000000074 ], [ 53.0, 1301.550000000159 ], [ 54.0, 8635.099999996353 ], [ 55.0, 20192.600000038397 ], [ 56.0, 3196.9999999992833 ], [ 57.0, 144.00000000000037 ], [ 58.0, 11.79999999999999 ], [ 59.0, 1.2 ], [ 60.0, 0.2 ], [ 61.0, 0.0 ], [ 62.0, 0.0 ], [ 63.0, 0.0 ], [ 64.0, 0.0 ], [ 65.0, 0.0 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAMS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.0 ], [ 46.0, 0.0 ], [ 47.0, 0.2 ], [ 48.0, 3.0000000000000004 ], [ 49.0, 296.5999999999917 ], [ 50.0, 747.600000000033 ], [ 51.0, 101.0000000000009 ], [ 52.0, 301.9999999999914 ], [ 53.0, 3267.749999999221 ], [ 54.0, 10477.350000003056 ], [ 55.0, 14760.950000018638 ], [ 56.0, 3559.3999999989537 ], [ 57.0, 2006.200000000319 ], [ 58.0, 241.7999999999948 ], [ 59.0, 2.8000000000000003 ], [ 60.0, 0.0 ], [ 61.0, 0.4 ], [ 62.0, 0.0 ], [ 63.0, 5.200000000000002 ], [ 64.0, 12.599999999999987 ], [ 65.0, 0.0 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICFS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.8 ], [ 44.0, 1.05 ], [ 45.0, 1.5 ], [ 46.0, 1.0 ], [ 47.0, 3.5000000000000013 ], [ 48.0, 33.399999999999935 ], [ 49.0, 308.39999999999105 ], [ 50.0, 3608.2999999989097 ], [ 51.0, 10914.600000004644 ], [ 52.0, 3565.199999998949 ], [ 53.0, 1702.0500000002498 ], [ 54.0, 5383.199999997297 ], [ 55.0, 4418.049999998174 ], [ 56.0, 2085.900000000294 ], [ 57.0, 398.9999999999859 ], [ 58.0, 294.9999999999918 ], [ 59.0, 23.799999999999947 ], [ 60.0, 4.200000000000001 ], [ 61.0, 4.200000000000001 ], [ 62.0, 1.25 ], [ 63.0, 2.1999999999999997 ], [ 64.0, 3.0000000000000004 ], [ 65.0, 0.6000000000000001 ], [ 66.0, 0.2 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.2 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICFS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.2 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.2 ], [ 44.0, 0.0 ], [ 45.0, 0.2 ], [ 46.0, 1.05 ], [ 47.0, 51.100000000000186 ], [ 48.0, 239.09999999999496 ], [ 49.0, 993.6000000000889 ], [ 50.0, 2206.0000000001846 ], [ 51.0, 3700.8499999988253 ], [ 52.0, 2772.0499999996705 ], [ 53.0, 6183.399999996568 ], [ 54.0, 10344.25000000257 ], [ 55.0, 7494.699999995379 ], [ 56.0, 4349.699999998236 ], [ 57.0, 1683.5000000002456 ], [ 58.0, 1699.7000000002492 ], [ 59.0, 31.19999999999992 ], [ 60.0, 3.2000000000000006 ], [ 61.0, 1.65 ], [ 62.0, 0.8 ], [ 63.0, 1.5999999999999999 ], [ 64.0, 6.200000000000003 ], [ 65.0, 0.4 ], [ 66.0, 0.4 ], [ 67.0, 0.25 ], [ 68.0, 0.2 ], [ 69.0, 0.2 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICMS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.2 ], [ 46.0, 0.8 ], [ 47.0, 3.0500000000000007 ], [ 48.0, 11.399999999999991 ], [ 49.0, 146.00000000000026 ], [ 50.0, 1820.6000000002769 ], [ 51.0, 8030.449999994888 ], [ 52.0, 2454.599999999959 ], [ 53.0, 1626.2500000002326 ], [ 54.0, 10706.400000003887 ], [ 55.0, 15590.050000021653 ], [ 56.0, 4049.849999998508 ], [ 57.0, 120.40000000000117 ], [ 58.0, 23.799999999999947 ], [ 59.0, 6.400000000000003 ], [ 60.0, 5.400000000000002 ], [ 61.0, 4.000000000000001 ], [ 62.0, 1.4 ], [ 63.0, 0.8 ], [ 64.0, 1.2 ], [ 65.0, 0.0 ], [ 66.0, 0.0 ], [ 67.0, 0.2 ], [ 68.0, 0.2 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICMS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.2 ], [ 40.0, 0.4 ], [ 41.0, 0.2 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.0 ], [ 46.0, 0.2 ], [ 47.0, 1.0 ], [ 48.0, 12.599999999999987 ], [ 49.0, 180.3999999999983 ], [ 50.0, 2099.2000000002818 ], [ 51.0, 656.2500000000123 ], [ 52.0, 224.19999999999584 ], [ 53.0, 2100.7000000002804 ], [ 54.0, 14143.45000001639 ], [ 55.0, 7056.049999995774 ], [ 56.0, 1743.2000000002593 ], [ 57.0, 86.00000000000068 ], [ 58.0, 22.199999999999953 ], [ 59.0, 7.0000000000000036 ], [ 60.0, 4.200000000000001 ], [ 61.0, 2.8000000000000003 ], [ 62.0, 2.1999999999999997 ], [ 63.0, 1.2 ], [ 64.0, 1.2 ], [ 65.0, 0.4 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPFS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.2 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.4 ], [ 46.0, 0.0 ], [ 47.0, 2.4 ], [ 48.0, 12.799999999999986 ], [ 49.0, 66.2000000000004 ], [ 50.0, 1025.8000000000961 ], [ 51.0, 23398.65000005006 ], [ 52.0, 7912.499999994995 ], [ 53.0, 1738.5000000002583 ], [ 54.0, 861.6500000000589 ], [ 55.0, 2004.6500000003186 ], [ 56.0, 588.5999999999968 ], [ 57.0, 34.199999999999946 ], [ 58.0, 22.399999999999952 ], [ 59.0, 7.600000000000004 ], [ 60.0, 5.200000000000002 ], [ 61.0, 2.6 ], [ 62.0, 1.5999999999999999 ], [ 63.0, 1.5999999999999999 ], [ 64.0, 1.0 ], [ 65.0, 0.4 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPFS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.2 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.45 ], [ 44.0, 0.0 ], [ 45.0, 0.25 ], [ 46.0, 0.45 ], [ 47.0, 13.349999999999985 ], [ 48.0, 452.0999999999829 ], [ 49.0, 1864.2000000002868 ], [ 50.0, 1375.3500000001757 ], [ 51.0, 1620.2500000002312 ], [ 52.0, 5617.649999997084 ], [ 53.0, 11812.400000007909 ], [ 54.0, 14399.800000017283 ], [ 55.0, 10349.65000000259 ], [ 56.0, 5415.299999997266 ], [ 57.0, 1001.4000000000907 ], [ 58.0, 344.64999999998895 ], [ 59.0, 17.19999999999997 ], [ 60.0, 6.200000000000003 ], [ 61.0, 3.0000000000000004 ], [ 62.0, 0.6000000000000001 ], [ 63.0, 2.8000000000000003 ], [ 64.0, 7.800000000000004 ], [ 65.0, 0.0 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.2 ], [ 69.0, 0.2 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPMS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.2 ], [ 37.0, 0.2 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.2 ], [ 46.0, 0.8500000000000001 ], [ 47.0, 34.24999999999995 ], [ 48.0, 253.99999999999412 ], [ 49.0, 855.0500000000575 ], [ 50.0, 2762.8499999996784 ], [ 51.0, 1306.85000000016 ], [ 52.0, 1080.200000000108 ], [ 53.0, 9462.849999999366 ], [ 54.0, 51092.149999817506 ], [ 55.0, 8553.999999996058 ], [ 56.0, 3005.6999999994578 ], [ 57.0, 343.0499999999891 ], [ 58.0, 141.05000000000055 ], [ 59.0, 19.599999999999962 ], [ 60.0, 6.200000000000003 ], [ 61.0, 8.200000000000003 ], [ 62.0, 3.0000000000000004 ], [ 63.0, 5.8000000000000025 ], [ 64.0, 14.79999999999998 ], [ 65.0, 1.7999999999999998 ], [ 66.0, 0.2 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPMS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.5 ], [ 44.0, 0.45 ], [ 45.0, 0.25 ], [ 46.0, 1.9499999999999997 ], [ 47.0, 5.850000000000003 ], [ 48.0, 111.20000000000104 ], [ 49.0, 838.2500000000535 ], [ 50.0, 2350.750000000053 ], [ 51.0, 10796.300000004214 ], [ 52.0, 5392.949999997288 ], [ 53.0, 7102.199999995734 ], [ 54.0, 12892.100000011838 ], [ 55.0, 10818.750000004295 ], [ 56.0, 7968.499999994944 ], [ 57.0, 341.6499999999892 ], [ 58.0, 71.40000000000047 ], [ 59.0, 12.799999999999986 ], [ 60.0, 5.000000000000002 ], [ 61.0, 3.800000000000001 ], [ 62.0, 0.8 ], [ 63.0, 0.8 ], [ 64.0, 1.9999999999999998 ], [ 65.0, 0.6000000000000001 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVFS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.25 ], [ 45.0, 0.0 ], [ 46.0, 0.0 ], [ 47.0, 3.800000000000001 ], [ 48.0, 17.64999999999997 ], [ 49.0, 153.4999999999998 ], [ 50.0, 572.9999999999935 ], [ 51.0, 741.5500000000317 ], [ 52.0, 9050.449999997863 ], [ 53.0, 7666.049999995221 ], [ 54.0, 31122.40000007816 ], [ 55.0, 2470.4499999999443 ], [ 56.0, 153.44999999999982 ], [ 57.0, 58.800000000000296 ], [ 58.0, 21.799999999999955 ], [ 59.0, 11.79999999999999 ], [ 60.0, 6.200000000000003 ], [ 61.0, 4.200000000000001 ], [ 62.0, 1.0 ], [ 63.0, 1.5999999999999999 ], [ 64.0, 0.8 ], [ 65.0, 0.2 ], [ 66.0, 0.2 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.2 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVFS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.2 ], [ 44.0, 0.0 ], [ 45.0, 0.2 ], [ 46.0, 0.4 ], [ 47.0, 1.2 ], [ 48.0, 6.400000000000003 ], [ 49.0, 35.14999999999996 ], [ 50.0, 886.0000000000645 ], [ 51.0, 21176.200000041976 ], [ 52.0, 6588.199999996199 ], [ 53.0, 158.84999999999954 ], [ 54.0, 456.9999999999826 ], [ 55.0, 258.1999999999939 ], [ 56.0, 124.40000000000123 ], [ 57.0, 11.99999999999999 ], [ 58.0, 13.449999999999985 ], [ 59.0, 7.650000000000004 ], [ 60.0, 3.0000000000000004 ], [ 61.0, 1.5999999999999999 ], [ 62.0, 0.8 ], [ 63.0, 1.0 ], [ 64.0, 0.4 ], [ 65.0, 0.2 ], [ 66.0, 0.2 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVMS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.25 ], [ 35.0, 0.25 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.2 ], [ 44.0, 0.65 ], [ 45.0, 1.05 ], [ 46.0, 3.800000000000001 ], [ 47.0, 6.800000000000003 ], [ 48.0, 42.40000000000007 ], [ 49.0, 703.8000000000218 ], [ 50.0, 6547.599999996243 ], [ 51.0, 4957.049999997683 ], [ 52.0, 6039.4999999966985 ], [ 53.0, 3706.44999999882 ], [ 54.0, 10789.600000004191 ], [ 55.0, 1765.7000000002643 ], [ 56.0, 790.6500000000428 ], [ 57.0, 116.25000000000111 ], [ 58.0, 60.650000000000325 ], [ 59.0, 10.999999999999993 ], [ 60.0, 6.000000000000003 ], [ 61.0, 6.000000000000003 ], [ 62.0, 4.000000000000001 ], [ 63.0, 2.6 ], [ 64.0, 6.000000000000003 ], [ 65.0, 0.4 ], [ 66.0, 0.4 ], [ 67.0, 0.2 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVMS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.0 ], [ 46.0, 0.0 ], [ 47.0, 3.2000000000000006 ], [ 48.0, 12.199999999999989 ], [ 49.0, 117.1500000000011 ], [ 50.0, 1483.8000000002003 ], [ 51.0, 15594.60000002167 ], [ 52.0, 5455.1999999972295 ], [ 53.0, 519.4499999999812 ], [ 54.0, 1647.9000000002377 ], [ 55.0, 416.1999999999849 ], [ 56.0, 281.5999999999926 ], [ 57.0, 35.99999999999997 ], [ 58.0, 15.799999999999976 ], [ 59.0, 3.600000000000001 ], [ 60.0, 2.4 ], [ 61.0, 3.800000000000001 ], [ 62.0, 1.4 ], [ 63.0, 0.4 ], [ 64.0, 1.5999999999999999 ], [ 65.0, 0.4 ], [ 66.0, 0.0 ], [ 67.0, 0.2 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAFS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.0 ], [ 46.0, 0.0 ], [ 47.0, 0.6000000000000001 ], [ 48.0, 15.599999999999977 ], [ 49.0, 519.1999999999811 ], [ 50.0, 6617.849999996172 ], [ 51.0, 1661.0500000002405 ], [ 52.0, 108.55000000000099 ], [ 53.0, 298.1499999999916 ], [ 54.0, 1646.6500000002375 ], [ 55.0, 16348.25000002441 ], [ 56.0, 3280.099999999208 ], [ 57.0, 66.2000000000004 ], [ 58.0, 11.59999999999999 ], [ 59.0, 1.5999999999999999 ], [ 60.0, 1.2 ], [ 61.0, 1.4 ], [ 62.0, 0.4 ], [ 63.0, 1.0 ], [ 64.0, 0.8 ], [ 65.0, 0.0 ], [ 66.0, 0.2 ], [ 67.0, 0.2 ], [ 68.0, 0.2 ], [ 69.0, 0.2 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAFS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.0 ], [ 46.0, 0.0 ], [ 47.0, 0.4 ], [ 48.0, 7.0000000000000036 ], [ 49.0, 443.3999999999834 ], [ 50.0, 2422.199999999988 ], [ 51.0, 426.7999999999843 ], [ 52.0, 49.850000000000165 ], [ 53.0, 188.64999999999785 ], [ 54.0, 970.4500000000836 ], [ 55.0, 11897.05000000822 ], [ 56.0, 2973.199999999487 ], [ 57.0, 62.80000000000035 ], [ 58.0, 6.600000000000003 ], [ 59.0, 1.9999999999999998 ], [ 60.0, 1.9999999999999998 ], [ 61.0, 0.8 ], [ 62.0, 0.2 ], [ 63.0, 0.4 ], [ 64.0, 1.7999999999999998 ], [ 65.0, 0.0 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.2 ], [ 70.0, 0.2 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAMS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.0 ], [ 46.0, 0.0 ], [ 47.0, 0.2 ], [ 48.0, 4.800000000000002 ], [ 49.0, 239.19999999999496 ], [ 50.0, 29145.85000007097 ], [ 51.0, 7503.449999995367 ], [ 52.0, 148.20000000000013 ], [ 53.0, 77.60000000000056 ], [ 54.0, 151.19999999999996 ], [ 55.0, 385.59999999998666 ], [ 56.0, 84.60000000000066 ], [ 57.0, 3.0000000000000004 ], [ 58.0, 0.4 ], [ 59.0, 0.2 ], [ 60.0, 0.0 ], [ 61.0, 0.2 ], [ 62.0, 0.0 ], [ 63.0, 0.2 ], [ 64.0, 0.2 ], [ 65.0, 0.0 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAMS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.45 ], [ 43.0, 1.0 ], [ 44.0, 0.6000000000000001 ], [ 45.0, 6.400000000000003 ], [ 46.0, 5.200000000000002 ], [ 47.0, 3.400000000000001 ], [ 48.0, 14.89999999999998 ], [ 49.0, 230.19999999999547 ], [ 50.0, 25702.800000058443 ], [ 51.0, 6382.399999996386 ], [ 52.0, 192.7999999999976 ], [ 53.0, 164.64999999999918 ], [ 54.0, 263.2499999999936 ], [ 55.0, 429.09999999998416 ], [ 56.0, 172.59999999999874 ], [ 57.0, 105.20000000000095 ], [ 58.0, 94.0500000000008 ], [ 59.0, 71.60000000000048 ], [ 60.0, 51.20000000000019 ], [ 61.0, 35.599999999999966 ], [ 62.0, 16.399999999999974 ], [ 63.0, 7.600000000000004 ], [ 64.0, 3.600000000000001 ], [ 65.0, 3.800000000000001 ], [ 66.0, 2.6 ], [ 67.0, 0.4 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCFS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.2 ], [ 42.0, 0.0 ], [ 43.0, 0.2 ], [ 44.0, 0.4 ], [ 45.0, 0.0 ], [ 46.0, 0.2 ], [ 47.0, 3.0000000000000004 ], [ 48.0, 10.599999999999994 ], [ 49.0, 42.65000000000007 ], [ 50.0, 988.0000000000877 ], [ 51.0, 31707.000000080287 ], [ 52.0, 9758.400000000438 ], [ 53.0, 122.6500000000012 ], [ 54.0, 611.1000000000021 ], [ 55.0, 485.24999999998096 ], [ 56.0, 190.7999999999977 ], [ 57.0, 25.199999999999942 ], [ 58.0, 11.199999999999992 ], [ 59.0, 6.400000000000003 ], [ 60.0, 3.400000000000001 ], [ 61.0, 2.4 ], [ 62.0, 0.8 ], [ 63.0, 0.4 ], [ 64.0, 0.8 ], [ 65.0, 0.2 ], [ 66.0, 0.2 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCFS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.2 ], [ 43.0, 0.45 ], [ 44.0, 0.0 ], [ 45.0, 0.4 ], [ 46.0, 1.2 ], [ 47.0, 1.5999999999999999 ], [ 48.0, 9.999999999999996 ], [ 49.0, 31.19999999999992 ], [ 50.0, 805.6500000000461 ], [ 51.0, 25695.200000058416 ], [ 52.0, 8160.199999994769 ], [ 53.0, 83.60000000000065 ], [ 54.0, 372.3999999999874 ], [ 55.0, 260.6499999999937 ], [ 56.0, 115.6000000000011 ], [ 57.0, 14.59999999999998 ], [ 58.0, 11.79999999999999 ], [ 59.0, 5.400000000000002 ], [ 60.0, 4.400000000000001 ], [ 61.0, 3.600000000000001 ], [ 62.0, 1.5999999999999999 ], [ 63.0, 1.2 ], [ 64.0, 0.6000000000000001 ], [ 65.0, 0.0 ], [ 66.0, 0.2 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCMS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.2 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.2 ], [ 45.0, 0.2 ], [ 46.0, 0.2 ], [ 47.0, 6.600000000000003 ], [ 48.0, 43.200000000000074 ], [ 49.0, 175.99999999999855 ], [ 50.0, 884.6000000000641 ], [ 51.0, 23528.800000050534 ], [ 52.0, 7547.5999999953265 ], [ 53.0, 1059.2000000001037 ], [ 54.0, 1865.1500000002868 ], [ 55.0, 1862.2500000002863 ], [ 56.0, 870.450000000061 ], [ 57.0, 135.45000000000084 ], [ 58.0, 59.2500000000003 ], [ 59.0, 12.999999999999986 ], [ 60.0, 4.800000000000002 ], [ 61.0, 9.399999999999999 ], [ 62.0, 4.400000000000001 ], [ 63.0, 1.7999999999999998 ], [ 64.0, 8.200000000000003 ], [ 65.0, 0.4 ], [ 66.0, 0.2 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCMS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.2 ], [ 37.0, 0.2 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.25 ], [ 44.0, 0.2 ], [ 45.0, 0.0 ], [ 46.0, 1.4 ], [ 47.0, 6.400000000000003 ], [ 48.0, 55.00000000000024 ], [ 49.0, 228.84999999999556 ], [ 50.0, 1213.850000000139 ], [ 51.0, 16072.400000023408 ], [ 52.0, 5510.49999999718 ], [ 53.0, 1246.5000000001462 ], [ 54.0, 2383.800000000023 ], [ 55.0, 2068.70000000031 ], [ 56.0, 1157.8000000001261 ], [ 57.0, 186.59999999999795 ], [ 58.0, 106.00000000000097 ], [ 59.0, 11.99999999999999 ], [ 60.0, 6.400000000000003 ], [ 61.0, 8.200000000000003 ], [ 62.0, 2.1999999999999997 ], [ 63.0, 1.5999999999999999 ], [ 64.0, 6.000000000000003 ], [ 65.0, 0.4 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.4 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPFS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.2 ], [ 43.0, 0.0 ], [ 44.0, 0.2 ], [ 45.0, 0.6000000000000001 ], [ 46.0, 0.4 ], [ 47.0, 1.9999999999999998 ], [ 48.0, 12.799999999999986 ], [ 49.0, 57.00000000000027 ], [ 50.0, 1737.0000000002578 ], [ 51.0, 39751.79999998252 ], [ 52.0, 11688.80000000746 ], [ 53.0, 93.00000000000078 ], [ 54.0, 272.99999999999307 ], [ 55.0, 633.0000000000069 ], [ 56.0, 150.99999999999997 ], [ 57.0, 13.499999999999986 ], [ 58.0, 14.099999999999984 ], [ 59.0, 8.400000000000002 ], [ 60.0, 6.600000000000003 ], [ 61.0, 3.2000000000000006 ], [ 62.0, 1.4 ], [ 63.0, 0.6000000000000001 ], [ 64.0, 0.8 ], [ 65.0, 0.6000000000000001 ], [ 66.0, 0.0 ], [ 67.0, 0.2 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPFS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.2 ], [ 41.0, 0.4 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.2 ], [ 45.0, 0.8 ], [ 46.0, 1.9999999999999998 ], [ 47.0, 3.600000000000001 ], [ 48.0, 10.399999999999995 ], [ 49.0, 71.80000000000048 ], [ 50.0, 2507.99999999991 ], [ 51.0, 32939.60000008165 ], [ 52.0, 10204.600000002061 ], [ 53.0, 127.80000000000128 ], [ 54.0, 339.8499999999893 ], [ 55.0, 901.800000000068 ], [ 56.0, 242.59999999999476 ], [ 57.0, 19.599999999999962 ], [ 58.0, 13.199999999999985 ], [ 59.0, 9.399999999999999 ], [ 60.0, 6.200000000000003 ], [ 61.0, 1.5999999999999999 ], [ 62.0, 1.4 ], [ 63.0, 0.6000000000000001 ], [ 64.0, 0.8 ], [ 65.0, 0.4 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPMS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.2 ], [ 42.0, 0.6000000000000001 ], [ 43.0, 0.2 ], [ 44.0, 0.8 ], [ 45.0, 0.4 ], [ 46.0, 1.2 ], [ 47.0, 36.049999999999976 ], [ 48.0, 353.6499999999885 ], [ 49.0, 1202.0000000001362 ], [ 50.0, 15797.850000022408 ], [ 51.0, 19261.60000003501 ], [ 52.0, 5092.999999997559 ], [ 53.0, 1429.6500000001881 ], [ 54.0, 2565.349999999858 ], [ 55.0, 2889.9499999995633 ], [ 56.0, 1243.4500000001458 ], [ 57.0, 225.79999999999572 ], [ 58.0, 109.20000000000101 ], [ 59.0, 11.99999999999999 ], [ 60.0, 6.000000000000003 ], [ 61.0, 5.000000000000002 ], [ 62.0, 2.1999999999999997 ], [ 63.0, 1.4 ], [ 64.0, 2.6 ], [ 65.0, 0.2 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.2 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPMS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.2 ], [ 43.0, 0.45 ], [ 44.0, 0.0 ], [ 45.0, 0.4 ], [ 46.0, 1.5999999999999999 ], [ 47.0, 19.99999999999996 ], [ 48.0, 116.40000000000111 ], [ 49.0, 427.79999999998427 ], [ 50.0, 7454.999999995411 ], [ 51.0, 15504.200000021341 ], [ 52.0, 4289.84999999829 ], [ 53.0, 635.1000000000074 ], [ 54.0, 1249.3500000001468 ], [ 55.0, 1281.450000000154 ], [ 56.0, 466.6499999999821 ], [ 57.0, 79.20000000000059 ], [ 58.0, 38.0 ], [ 59.0, 7.650000000000004 ], [ 60.0, 6.800000000000003 ], [ 61.0, 6.200000000000003 ], [ 62.0, 1.9999999999999998 ], [ 63.0, 1.4 ], [ 64.0, 2.1999999999999997 ], [ 65.0, 0.2 ], [ 66.0, 0.2 ], [ 67.0, 0.2 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVFS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.2 ], [ 46.0, 0.4 ], [ 47.0, 1.7999999999999998 ], [ 48.0, 8.200000000000003 ], [ 49.0, 44.100000000000094 ], [ 50.0, 1379.0000000001764 ], [ 51.0, 17573.200000028868 ], [ 52.0, 5501.599999997187 ], [ 53.0, 134.20000000000093 ], [ 54.0, 438.59999999998365 ], [ 55.0, 345.9999999999889 ], [ 56.0, 166.0499999999991 ], [ 57.0, 20.24999999999996 ], [ 58.0, 14.449999999999982 ], [ 59.0, 10.199999999999996 ], [ 60.0, 5.400000000000002 ], [ 61.0, 2.4 ], [ 62.0, 2.1999999999999997 ], [ 63.0, 1.7999999999999998 ], [ 64.0, 1.0 ], [ 65.0, 0.2 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVFS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.25 ], [ 42.0, 0.0 ], [ 43.0, 0.0 ], [ 44.0, 0.0 ], [ 45.0, 0.0 ], [ 46.0, 0.0 ], [ 47.0, 8.050000000000004 ], [ 48.0, 23.59999999999995 ], [ 49.0, 208.9499999999971 ], [ 50.0, 1462.1500000001943 ], [ 51.0, 1735.4500000002574 ], [ 52.0, 3833.8499999987043 ], [ 53.0, 4420.499999998171 ], [ 54.0, 19838.75000003711 ], [ 55.0, 2156.0500000002303 ], [ 56.0, 268.3999999999933 ], [ 57.0, 45.45000000000011 ], [ 58.0, 21.799999999999955 ], [ 59.0, 5.000000000000002 ], [ 60.0, 2.4 ], [ 61.0, 2.1999999999999997 ], [ 62.0, 0.6000000000000001 ], [ 63.0, 1.2 ], [ 64.0, 0.6000000000000001 ], [ 65.0, 0.2 ], [ 66.0, 0.2 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVMS1", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.25 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.2 ], [ 44.0, 0.6000000000000001 ], [ 45.0, 0.8500000000000001 ], [ 46.0, 1.4 ], [ 47.0, 29.799999999999926 ], [ 48.0, 96.00000000000082 ], [ 49.0, 295.34999999999184 ], [ 50.0, 2005.850000000319 ], [ 51.0, 52065.299999803334 ], [ 52.0, 17099.200000027144 ], [ 53.0, 1805.0000000002733 ], [ 54.0, 2299.2000000001 ], [ 55.0, 2815.2499999996307 ], [ 56.0, 2740.149999999699 ], [ 57.0, 364.99999999998784 ], [ 58.0, 110.60000000000103 ], [ 59.0, 24.799999999999944 ], [ 60.0, 12.199999999999989 ], [ 61.0, 11.99999999999999 ], [ 62.0, 8.200000000000003 ], [ 63.0, 4.600000000000001 ], [ 64.0, 10.399999999999995 ], [ 65.0, 0.6000000000000001 ], [ 66.0, 0.0 ], [ 67.0, 0.0 ], [ 68.0, 0.2 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVMS2", "pairs": [ [ 0.0, 0.0 ], [ 1.0, 0.0 ], [ 2.0, 0.0 ], [ 3.0, 0.0 ], [ 4.0, 0.0 ], [ 5.0, 0.0 ], [ 6.0, 0.0 ], [ 7.0, 0.0 ], [ 8.0, 0.0 ], [ 9.0, 0.0 ], [ 10.0, 0.0 ], [ 11.0, 0.0 ], [ 12.0, 0.0 ], [ 13.0, 0.0 ], [ 14.0, 0.0 ], [ 15.0, 0.0 ], [ 16.0, 0.0 ], [ 17.0, 0.0 ], [ 18.0, 0.0 ], [ 19.0, 0.0 ], [ 20.0, 0.0 ], [ 21.0, 0.0 ], [ 22.0, 0.0 ], [ 23.0, 0.0 ], [ 24.0, 0.0 ], [ 25.0, 0.0 ], [ 26.0, 0.0 ], [ 27.0, 0.0 ], [ 28.0, 0.0 ], [ 29.0, 0.0 ], [ 30.0, 0.0 ], [ 31.0, 0.0 ], [ 32.0, 0.0 ], [ 33.0, 0.0 ], [ 34.0, 0.0 ], [ 35.0, 0.0 ], [ 36.0, 0.0 ], [ 37.0, 0.0 ], [ 38.0, 0.0 ], [ 39.0, 0.0 ], [ 40.0, 0.0 ], [ 41.0, 0.0 ], [ 42.0, 0.0 ], [ 43.0, 0.2 ], [ 44.0, 0.0 ], [ 45.0, 0.2 ], [ 46.0, 0.8 ], [ 47.0, 18.399999999999967 ], [ 48.0, 45.650000000000105 ], [ 49.0, 204.84999999999692 ], [ 50.0, 1653.2000000002388 ], [ 51.0, 15008.200000019537 ], [ 52.0, 5506.799999997183 ], [ 53.0, 928.6000000000741 ], [ 54.0, 1245.850000000146 ], [ 55.0, 1428.7000000001879 ], [ 56.0, 1169.1000000001288 ], [ 57.0, 312.64999999999077 ], [ 58.0, 83.65000000000065 ], [ 59.0, 12.599999999999987 ], [ 60.0, 4.200000000000001 ], [ 61.0, 3.400000000000001 ], [ 62.0, 1.7999999999999998 ], [ 63.0, 2.1999999999999997 ], [ 64.0, 6.000000000000003 ], [ 65.0, 1.5999999999999999 ], [ 66.0, 0.8 ], [ 67.0, 0.0 ], [ 68.0, 0.0 ], [ 69.0, 0.0 ], [ 70.0, 0.0 ], [ 71.0, 0.0 ], [ 72.0, 0.0 ], [ 73.0, 0.0 ], [ 74.0, 0.0 ], [ 75.0, 0.0 ], [ 76.0, 0.0 ], [ 77.0, 0.0 ], [ 78.0, 0.0 ], [ 79.0, 0.0 ], [ 80.0, 0.0 ], [ 81.0, 0.0 ], [ 82.0, 0.0 ], [ 83.0, 0.0 ], [ 84.0, 0.0 ], [ 85.0, 0.0 ], [ 86.0, 0.0 ], [ 87.0, 0.0 ], [ 88.0, 0.0 ], [ 89.0, 0.0 ], [ 90.0, 0.0 ], [ 91.0, 0.0 ], [ 92.0, 0.0 ], [ 93.0, 0.0 ], [ 94.0, 0.0 ], [ 95.0, 0.0 ], [ 96.0, 0.0 ], [ 97.0, 0.0 ], [ 98.0, 0.0 ], [ 99.0, 0.0 ], [ 100.0, 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null } ] } ], "pconfig": { "id": "fastqc_per_sequence_gc_content_plot", "title": "FastQC: Per Sequence GC Content", "anchor": null, "table_title": null, "height": null, "width": null, "square": false, "logswitch": false, "logswitch_active": false, "logswitch_label": "Log10", "cpswitch": true, "cpswitch_c_active": true, "cpswitch_counts_label": "Counts", "cpswitch_percent_label": "Percentages", "xLog": null, "yLog": null, "xlog": false, "ylog": false, "data_labels": [ { "name": "Percentages", "ylab": "Percentage", "tt_suffix": "%", "title": "FastQC: Per Sequence GC Content
Percentages, 64 samples" }, { "name": "Counts", "ylab": "Count", "tt_suffix": "", "title": "FastQC: Per Sequence GC Content
Counts, 64 samples" } ], "xTitle": null, "yTitle": null, "xlab": "% GC", "ylab": "Percentage", "xsuffix": null, "ysuffix": null, "tt_suffix": null, "xLabFormat": null, "yLabFormat": null, "xLabelFormat": null, "yLabelFormat": null, "xlab_format": null, "ylab_format": null, "tt_label": "{point.x}% GC: {point.y}", "xDecimals": null, "yDecimals": null, "decimalPlaces": null, "x_decimals": null, "y_decimals": null, "tt_decimals": null, "xmin": 0, "xmax": 100, "ymin": 0, "ymax": null, "xFloor": null, "xCeiling": null, "yFloor": null, "yCeiling": null, "x_clipmin": null, "x_clipmax": null, "y_clipmin": null, "y_clipmax": null, "save_data_file": true, "showlegend": false, "xMinRange": null, "yMinRange": null, "x_minrange": null, "y_minrange": null, "xPlotBands": null, "yPlotBands": null, "xPlotLines": null, "yPlotLines": null, "x_bands": null, "y_bands": null, "x_lines": null, "y_lines": null, "categories": false, "smooth_points": 500, "smooth_points_sumcounts": null, "extra_series": null, "style": null, "hide_zero_cats": false, "hide_empty": false, "colors": { "CVFS2": "#d9534f", "JPFS1": "#d9534f", "CCMS1": "#d9534f", "ICFS1": "#d9534f", "CCFS2": "#d9534f", "IAFS2": "#d9534f", "DVMS1": "#d9534f", "DVMS2": "#d9534f", "DCMS2": "#d9534f", "JCMS1": "#d9534f", "JCFS1": "#d9534f", "DPMS1": "#d9534f", "CAFS2": "#d9534f", "DAMS1": "#d9534f", "JAMS2": "#d9534f", "IPMS1": "#d9534f", "DCMS1": "#d9534f", "CAFS1": "#d9534f", "IPFS1": "#d9534f", "JVFS1": "#d9534f", "IVFS2": "#d9534f", "DVFS1": "#d9534f", "DPFS2": "#d9534f", "CVMS1": "#d9534f", "JVFS2": "#d9534f", "CPMS1": "#d9534f", "ICMS1": "#d9534f", "CVMS2": "#d9534f", "ICMS2": "#d9534f", "DCFS2": "#d9534f", "CCFS1": "#d9534f", "CCMS2": "#d9534f", "JVMS1": "#d9534f", "CPFS2": "#f0ad4e", "IAFS1": "#d9534f", "CAMS1": "#d9534f", "JPMS2": "#d9534f", "IAMS1": "#d9534f", "DAFS1": "#d9534f", "DAFS2": "#d9534f", "IAMS2": "#d9534f", "JVMS2": "#d9534f", "ICFS2": "#f0ad4e", "IPMS2": "#d9534f", "DPFS1": "#d9534f", "DCFS1": "#d9534f", "JCMS2": "#d9534f", "JPMS1": "#d9534f", "JAFS1": "#d9534f", "JCFS2": "#d9534f", "DPMS2": "#d9534f", "CAMS2": "#d9534f", "DAMS2": "#d9534f", "IVMS1": "#d9534f", "CPMS2": "#f0ad4e", "CPFS1": "#d9534f", "IVFS1": "#d9534f", "CVFS1": "#d9534f", "IVMS2": "#d9534f", "IPFS2": "#f0ad4e", "JAFS2": "#d9534f", "JAMS1": "#d9534f", "DVFS2": "#d9534f", "JPFS2": "#d9534f" } }, "add_log_tab": false, "add_pct_tab": false, "l_active": false, "p_active": false, "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "yaxis" ], "square": false, "flat": false, "defer_render": false }, "fastqc_per_base_n_content_plot": { "id": "fastqc_per_base_n_content_plot", "anchor": "fastqc_per_base_n_content_plot", "plot_type": "xy_line", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 500, "hoverlabel": { "namelength": -1 }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "white", "plot_bgcolor": "white", "showlegend": false, "title": { "font": { "size": 20 }, "text": "FastQC: Per Base N Content", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "shapes": [ { "fillcolor": "#e6c3c3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 20, "y1": 100 }, { "fillcolor": "#e6dcc3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 5, "y1": 20 }, { "fillcolor": "#c3e6c3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 0, "y1": 5 }, { "fillcolor": "#e6c3c3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 20, "y1": 100 }, { "fillcolor": "#e6dcc3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 5, "y1": 20 }, { "fillcolor": "#c3e6c3", "layer": "below", "line": { "width": 0 }, "type": "rect", "x0": 0, "x1": 1, "xref": "paper", "y0": 0, "y1": 5 } ], "hoverdistance": -1 }, "datasets": [ { "plot_id": "fastqc_per_base_n_content_plot", "label": "1", "uid": "fastqc_per_base_n_content_plot", "dconfig": { "title": "FastQC: Per Base N Content
64 samples" }, "layout": { "title": { "text": "FastQC: Per Base N Content
64 samples" }, "xaxis": { "hoverformat": null, "ticksuffix": " bp", "title": { "text": "Position in Read (bp)" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": null } }, "yaxis": { "hoverformat": null, "ticksuffix": "%", "title": { "text": "Percentage N-Count" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": 100, "minallowed": 0, "maxallowed": null }, "range": [ 0, 5 ] } }, "trace_params": { "hovertemplate": "%{text}
Base %{x}: %{y:.2f}%", "mode": "lines", "line": { "width": 2 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "n_samples": 64, "lines": [ { "name": "CAFS1", "pairs": [ [ 1, 0.0 ], [ 2, 0.001247123820688537 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0 ], [ 210, 0.0 ], [ 220, 0.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 0.0 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 0.0 ], [ 350, 0.0 ], [ 360, 0.0 ], [ 370, 0.0 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ], [ 480, 0.0 ], [ 490, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAFS2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0006742679136127949 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0 ], [ 210, 0.0 ], [ 220, 0.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 6.742724600156431e-05 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 0.0 ], [ 350, 0.0 ], [ 360, 0.0 ], [ 370, 0.0 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAMS1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0 ], [ 210, 0.0 ], [ 220, 0.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 0.0 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 0.0 ], [ 350, 0.0 ], [ 360, 0.0 ], [ 370, 0.0 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ], [ 480, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAMS2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0012228451939126767 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0 ], [ 210, 0.0 ], [ 220, 0.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 6.114233446324367e-05 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 0.0 ], [ 350, 6.115572081190335e-05 ], [ 360, 0.0 ], [ 370, 6.115646882549002e-05 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCFS1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0009501503612946749 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.001852793204524616 ], [ 210, 0.0 ], [ 220, 0.00047507518064733746 ], [ 230, 0.0005225826987120712 ], [ 240, 0.0 ], [ 250, 0.00014252255419420123 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 4.7518128165895284e-05 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 0.0 ], [ 350, 0.0 ], [ 360, 0.0 ], [ 370, 4.755426060020134e-05 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCFS2", "pairs": [ [ 1, 0.0 ], [ 2, 0.001016203362616927 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0021340270614955466 ], [ 210, 0.0 ], [ 220, 0.00040648134504677076 ], [ 230, 0.00015243050439253905 ], [ 240, 0.0 ], [ 250, 0.00010162033626169269 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 5.0819179768274705e-05 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 0.0 ], [ 350, 0.0 ], [ 360, 0.0 ], [ 370, 5.0852698040747255e-05 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCMS1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0014708838541079336 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0019611784721439113 ], [ 210, 0.0 ], [ 220, 0.0006864124652503689 ], [ 230, 0.0008335008506611623 ], [ 240, 0.0 ], [ 250, 0.00014708838541079334 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 0.0 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 4.904388937660312e-05 ], [ 350, 0.0 ], [ 360, 0.0 ], [ 370, 4.905680925682368e-05 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCMS2", "pairs": [ [ 1, 0.000522722758303451 ], [ 2, 0.001045445516606902 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0019340742057227687 ], [ 210, 0.0 ], [ 220, 0.0002613613791517255 ], [ 230, 0.0004181782066427608 ], [ 240, 0.0 ], [ 250, 5.22722758303451e-05 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 0.0 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 0.0 ], [ 350, 0.00010459889982877161 ], [ 360, 0.0 ], [ 370, 0.0 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ], [ 480, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPFS1", "pairs": [ [ 1, 0.0 ], [ 2, 0.002084172791818927 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0014589209542732488 ], [ 210, 0.0 ], [ 220, 0.0002084172791818927 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0008336691167275708 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 6.947290903912018e-05 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 0.0 ], [ 350, 6.947387434955085e-05 ], [ 360, 0.0 ], [ 370, 0.0 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ], [ 480, 0.0 ], [ 490, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPFS2", "pairs": [ [ 1, 0.0 ], [ 2, 0.001155802126675913 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0029472954230235784 ], [ 210, 0.0 ], [ 220, 0.00023116042533518263 ], [ 230, 0.00034674063800277393 ], [ 240, 0.0 ], [ 250, 0.00017337031900138697 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 0.0 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 5.782091474999972e-05 ], [ 350, 0.0 ], [ 360, 0.0 ], [ 370, 0.0 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPMS1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0018263505862585383 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0021459619388537825 ], [ 210, 0.0 ], [ 220, 0.0006392227051904884 ], [ 230, 0.0005479051758775614 ], [ 240, 0.0 ], [ 250, 4.5658764656463455e-05 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 0.0 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 0.0 ], [ 350, 0.00013706152874774191 ], [ 360, 4.568761459024834e-05 ], [ 370, 0.0 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ], [ 480, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPMS2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0015159477705461455 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0023244532481707563 ], [ 210, 0.0 ], [ 220, 0.0006569107005699964 ], [ 230, 0.00035372114646076727 ], [ 240, 0.0 ], [ 250, 5.053159235153819e-05 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 0.0 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 0.00010108095978392935 ], [ 350, 0.0 ], [ 360, 0.0 ], [ 370, 0.0 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ], [ 480, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVFS1", "pairs": [ [ 1, 0.0004694416929945216 ], [ 2, 0.00281665015796713 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0022533201263737037 ], [ 210, 0.0 ], [ 220, 0.00028166501579671296 ], [ 230, 0.00042249752369506944 ], [ 240, 0.0 ], [ 250, 0.00018777667719780864 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 0.0 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 0.0 ], [ 350, 9.393759631539172e-05 ], [ 360, 0.0 ], [ 370, 4.696963647849848e-05 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ], [ 480, 0.0 ], [ 490, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVFS2", "pairs": [ [ 1, 0.0 ], [ 2, 0.002989030258949655 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0020923211812647583 ], [ 210, 0.0 ], [ 220, 0.0004981717098249425 ], [ 230, 0.00034872019687745976 ], [ 240, 0.0 ], [ 250, 9.963434196498849e-05 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 0.0 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 9.965573924876514e-05 ], [ 350, 0.0 ], [ 360, 0.0 ], [ 370, 0.0 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVMS1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0016837756986266003 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.002413411834698127 ], [ 210, 0.0 ], [ 220, 0.0003928809963462068 ], [ 230, 0.0008980137059341868 ], [ 240, 0.0 ], [ 250, 0.00011225171324177335 ], [ 260, 5.6125856620886674e-05 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 0.0 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 0.0 ], [ 350, 0.0 ], [ 360, 0.0 ], [ 370, 0.0 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ], [ 480, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVMS2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0018051356108127622 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0018953923913534003 ], [ 210, 0.0 ], [ 220, 0.0004964122929735096 ], [ 230, 0.0006769258540547859 ], [ 240, 0.0 ], [ 250, 0.0 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 0.0 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 4.514165224767058e-05 ], [ 350, 4.5148805949529054e-05 ], [ 360, 0.0 ], [ 370, 0.0 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAFS1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0 ], [ 210, 0.0 ], [ 220, 0.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 0.0 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 0.0 ], [ 350, 0.0 ], [ 360, 0.0 ], [ 370, 0.0 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAFS2", "pairs": [ [ 1, 0.0 ], [ 2, 0.002740627055470292 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0 ], [ 210, 0.0 ], [ 220, 0.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 0.0 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 0.0 ], [ 350, 0.0 ], [ 360, 0.0 ], [ 370, 0.0 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAMS1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0 ], [ 210, 0.0 ], [ 220, 0.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 0.0 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 0.0 ], [ 350, 0.0 ], [ 360, 0.0 ], [ 370, 0.0 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ], [ 480, 0.0 ], [ 490, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAMS2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0 ], [ 210, 0.0 ], [ 220, 0.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 0.0 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 0.0 ], [ 350, 0.0 ], [ 360, 0.0 ], [ 370, 0.0 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ], [ 480, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCFS1", "pairs": [ [ 1, 0.0 ], [ 2, 0.003437252947444403 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0019764204447805314 ], [ 210, 0.0 ], [ 220, 8.593132368611006e-05 ], [ 230, 0.0 ], [ 240, 8.593132368611006e-05 ], [ 250, 0.0010311758842333207 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 0.0002578152392869174 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 0.0 ], [ 350, 0.0002578524671324055 ], [ 360, 0.0 ], [ 370, 8.599886825489376e-05 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ], [ 480, 0.0 ], [ 490, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCFS2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0015408083080383967 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0001540808308038397 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0013867274772345571 ], [ 210, 0.0 ], [ 220, 0.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0006163233232153588 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 0.00015410125068575055 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 0.0 ], [ 350, 0.0 ], [ 360, 0.0 ], [ 370, 0.0 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ], [ 480, 0.0 ], [ 490, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCMS1", "pairs": [ [ 1, 0.0 ], [ 2, 0.001726467173384782 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0019854372493924993 ], [ 210, 0.0 ], [ 220, 0.00021580839667309775 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0007337485486885323 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 8.633125821765665e-05 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 8.633435135922644e-05 ], [ 350, 0.0 ], [ 360, 0.0 ], [ 370, 8.633901012324895e-05 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ], [ 480, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCMS2", "pairs": [ [ 1, 0.0 ], [ 2, 0.00348375409341106 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0018580021831525653 ], [ 210, 0.0 ], [ 220, 0.00011612513644703533 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0005806256822351766 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 0.0 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 0.00011619125079881485 ], [ 350, 0.0 ], [ 360, 0.0 ], [ 370, 0.00011628272050401582 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ], [ 480, 0.0 ], [ 490, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPFS1", "pairs": [ [ 1, 0.0007337995406414876 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.001247459219090529 ], [ 210, 0.0 ], [ 220, 0.0 ], [ 230, 0.0 ], [ 240, 7.337995406414876e-05 ], [ 250, 0.0010273193568980825 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 0.0 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 7.338205412513548e-05 ], [ 350, 7.338264647176236e-05 ], [ 360, 0.0 ], [ 370, 0.00022016797348590485 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ], [ 480, 0.0 ], [ 490, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPFS2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 8.078653773135244e-05 ], [ 30, 8.078653773135244e-05 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.00016157307546270488 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0020196634432838112 ], [ 210, 0.0 ], [ 220, 8.078653773135244e-05 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.001050224990507582 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 0.0 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 0.0 ], [ 350, 0.00016162491221746955 ], [ 360, 0.0 ], [ 370, 0.0002426854602287068 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ], [ 480, 0.0 ], [ 490, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPMS1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0011349735803372132 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0 ], [ 210, 0.0 ], [ 220, 0.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 0.0 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 0.0 ], [ 350, 0.0 ], [ 360, 0.0 ], [ 370, 0.0 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ], [ 480, 0.0 ], [ 490, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPMS2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0006015906055611036 ], [ 210, 0.0 ], [ 220, 0.00048127248444888285 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0007219087266733243 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 0.0 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 0.00012033129612448996 ], [ 350, 0.0001203362193969952 ], [ 360, 0.0 ], [ 370, 0.0 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ], [ 480, 0.0 ], [ 490, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVFS1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0014515684196774615 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0015967252616452077 ], [ 210, 0.0 ], [ 220, 0.0004354705259032384 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0007257842098387307 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 0.0 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 0.0 ], [ 350, 0.00014519688697874316 ], [ 360, 0.0 ], [ 370, 0.00029047517381308215 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ], [ 480, 0.0 ], [ 490, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVFS2", "pairs": [ [ 1, 0.0 ], [ 2, 0.004177196683305833 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0011487290879091043 ], [ 210, 0.0 ], [ 220, 0.00010442991708264584 ], [ 230, 0.0 ], [ 240, 0.00010442991708264584 ], [ 250, 0.0009398692537438126 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 0.0 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 0.00010447759634662742 ], [ 350, 0.0 ], [ 360, 0.00010449550094620677 ], [ 370, 0.0 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ], [ 480, 0.0 ], [ 490, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVMS1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0031696725728232273 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0014580493834986845 ], [ 210, 0.0 ], [ 220, 0.0004437541601952518 ], [ 230, 0.00019018035436939364 ], [ 240, 0.0 ], [ 250, 0.0004437541601952518 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 0.0 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 6.341737192069024e-05 ], [ 350, 0.0 ], [ 360, 0.0 ], [ 370, 0.0 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ], [ 480, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVMS2", "pairs": [ [ 1, 0.0006509314829521045 ], [ 2, 0.001301862965904209 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.001627328707380261 ], [ 210, 0.0 ], [ 220, 0.0001301862965904209 ], [ 230, 6.509314829521044e-05 ], [ 240, 6.509314829521044e-05 ], [ 250, 0.000585838334656894 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 0.0 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 6.510289512574625e-05 ], [ 350, 0.0 ], [ 360, 0.0 ], [ 370, 0.00013022020236219448 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ], [ 480, 0.0 ], [ 490, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAFS1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0018676577703901538 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0 ], [ 210, 0.0 ], [ 220, 0.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 0.0 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 0.0 ], [ 350, 0.0 ], [ 360, 0.0 ], [ 370, 0.0 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAFS2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0 ], [ 210, 0.0 ], [ 220, 0.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 8.003073180101158e-05 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 0.0 ], [ 350, 0.0 ], [ 360, 0.0 ], [ 370, 0.0 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ], [ 480, 0.0 ], [ 490, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAMS1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0 ], [ 210, 0.0 ], [ 220, 0.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 0.0001351159632754812 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 0.0 ], [ 350, 0.0 ], [ 360, 0.0 ], [ 370, 6.755889446625095e-05 ], [ 380, 0.0 ], [ 390, 6.75607201972773e-05 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ], [ 480, 0.0 ], [ 490, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAMS2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0006737954222339014 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0 ], [ 210, 0.0 ], [ 220, 0.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 0.0 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 0.0 ], [ 350, 0.0 ], [ 360, 0.0 ], [ 370, 0.0 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ], [ 480, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICFS1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.001636174326937379 ], [ 210, 0.0 ], [ 220, 0.00022311468094600627 ], [ 230, 7.437156031533541e-05 ], [ 240, 0.0 ], [ 250, 0.0007437156031533541 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 0.0 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 0.0 ], [ 350, 0.0 ], [ 360, 0.0 ], [ 370, 7.438151768048675e-05 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ], [ 480, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICFS2", "pairs": [ [ 1, 0.0 ], [ 2, 0.003591395017537979 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0018555540923946225 ], [ 210, 0.0 ], [ 220, 0.0007182790035075959 ], [ 230, 0.00023942633450253195 ], [ 240, 0.0 ], [ 250, 0.0002992829181281649 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 0.0 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 0.0 ], [ 350, 5.988059808741369e-05 ], [ 360, 0.0 ], [ 370, 5.988185310382615e-05 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICMS1", "pairs": [ [ 1, 0.000531191568927418 ], [ 2, 0.001593574706782254 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0012217406085330614 ], [ 210, 0.0 ], [ 220, 0.0001593574706782254 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0007436681964983852 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 0.0 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 0.00010623978106105918 ], [ 350, 0.0 ], [ 360, 0.0 ], [ 370, 0.0 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ], [ 480, 0.0 ], [ 490, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICMS2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0016508733119820387 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0020635916399775484 ], [ 210, 0.0 ], [ 220, 0.0003301746623964077 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0004127183279955097 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 0.0 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 0.0 ], [ 350, 0.0 ], [ 360, 0.00016509046544780376 ], [ 370, 0.0001650927821435647 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ], [ 480, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPFS1", "pairs": [ [ 1, 0.0 ], [ 2, 0.001288800964023121 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.001224360915821965 ], [ 210, 0.0 ], [ 220, 0.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.001159920867620809 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 6.444013125165933e-05 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 0.00012888134217029735 ], [ 350, 6.444087871582216e-05 ], [ 360, 0.0 ], [ 370, 6.444129398118314e-05 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ], [ 480, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPFS2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0018384465126967712 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0017465241870619327 ], [ 210, 0.0 ], [ 220, 0.0002298058140870964 ], [ 230, 0.0005055727909916121 ], [ 240, 0.0 ], [ 250, 0.00013788348845225783 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 0.0 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 9.198345769496814e-05 ], [ 350, 0.0 ], [ 360, 0.0 ], [ 370, 0.00013800298638462537 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ], [ 480, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPMS1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0011973251755578037 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0017361215045588157 ], [ 210, 0.0 ], [ 220, 0.0004489969408341764 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 2.9933129388945097e-05 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 0.0 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 2.9934267342342947e-05 ], [ 350, 0.0 ], [ 360, 0.0 ], [ 370, 2.993653454676087e-05 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPMS2", "pairs": [ [ 1, 0.0 ], [ 2, 0.002538457633142103 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0018615355976375422 ], [ 210, 0.0 ], [ 220, 0.0006346144082855258 ], [ 230, 0.00016923050887614018 ], [ 240, 0.0 ], [ 250, 0.0003807686449713154 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 0.0 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 4.2310562916653266e-05 ], [ 350, 0.0 ], [ 360, 0.0 ], [ 370, 0.0 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ], [ 480, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVFS1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0013549095146262481 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.00140007316511379 ], [ 210, 0.0 ], [ 220, 0.0005871274563380408 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0005419638058504993 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 0.0 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 4.5164119636139784e-05 ], [ 350, 0.0 ], [ 360, 0.0 ], [ 370, 4.516650632556921e-05 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ], [ 480, 0.0 ], [ 490, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVFS2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0016276571502978612 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0017090400078127541 ], [ 210, 0.0 ], [ 220, 0.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0009765942901787167 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 0.0 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 8.138418217035338e-05 ], [ 350, 0.0 ], [ 360, 0.0 ], [ 370, 0.0 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ], [ 480, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVMS1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0033380956831746624 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.00267047654653973 ], [ 210, 0.0 ], [ 220, 0.00046733339564445275 ], [ 230, 0.00013352382732698652 ], [ 240, 0.0 ], [ 250, 0.00020028574099047975 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 0.0 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 6.676369657235183e-05 ], [ 350, 0.0001335282846288915 ], [ 360, 0.0 ], [ 370, 0.0 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ], [ 480, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVMS2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0016049394371382983 ], [ 210, 0.0 ], [ 220, 0.0002832246065538174 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0008496738196614521 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 9.44082021846058e-05 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 9.440909348388437e-05 ], [ 350, 9.440909348388437e-05 ], [ 360, 0.0 ], [ 370, 0.0 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ], [ 480, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAFS1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0007736405201958859 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0 ], [ 210, 0.0 ], [ 220, 0.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 0.00023209215605876575 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 0.0 ], [ 350, 0.0 ], [ 360, 0.0 ], [ 370, 7.736644617229506e-05 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ], [ 480, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAFS2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0012152883271556176 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0 ], [ 210, 0.0 ], [ 220, 0.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 0.00012152883271556177 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 0.0 ], [ 350, 0.0 ], [ 360, 0.0 ], [ 370, 0.00012153178663879539 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ], [ 480, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAMS1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0006266017507252916 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0 ], [ 210, 0.0 ], [ 220, 0.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 6.266017507252915e-05 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 0.0 ], [ 350, 0.0 ], [ 360, 0.0 ], [ 370, 0.0 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ], [ 480, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAMS2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0 ], [ 210, 0.0 ], [ 220, 0.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 0.00020841583126654303 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 0.0 ], [ 350, 0.0 ], [ 360, 0.0 ], [ 370, 6.947290903912018e-05 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ], [ 480, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCFS1", "pairs": [ [ 1, 0.0 ], [ 2, 0.000550460735635727 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.001100921471271454 ], [ 210, 0.0 ], [ 220, 0.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0009357832505807361 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 0.00011009269254248614 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 0.0 ], [ 350, 5.504667958428747e-05 ], [ 360, 0.0 ], [ 370, 5.504704320312139e-05 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ], [ 480, 0.0 ], [ 490, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCFS2", "pairs": [ [ 1, 0.0 ], [ 2, 0.005458366310963129 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.001978657787724134 ], [ 210, 0.0 ], [ 220, 0.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0008187549466444693 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 6.823004441775892e-05 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 0.0 ], [ 350, 6.82305099548314e-05 ], [ 360, 0.0 ], [ 370, 6.823060306300824e-05 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ], [ 480, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCMS1", "pairs": [ [ 1, 0.0 ], [ 2, 0.001283771206295614 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0013479597666103947 ], [ 210, 0.0 ], [ 220, 0.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0017330911284990788 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 6.418897233455292e-05 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 0.00012838222984527372 ], [ 350, 0.00012838618564642445 ], [ 360, 0.0 ], [ 370, 0.0 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ], [ 480, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCMS2", "pairs": [ [ 1, 0.0 ], [ 2, 0.001623653382475909 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.001623653382475909 ], [ 210, 0.0 ], [ 220, 0.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0009741920294855454 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 8.118266912379544e-05 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 0.0 ], [ 350, 0.0 ], [ 360, 8.118774422288309e-05 ], [ 370, 0.0 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPFS1", "pairs": [ [ 1, 0.0 ], [ 2, 0.002209778712759704 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0014142583761662106 ], [ 210, 0.0 ], [ 220, 0.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0011932805048902402 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 0.00017678253141094116 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 4.4195769580935714e-05 ], [ 350, 0.0 ], [ 360, 0.0 ], [ 370, 4.419596490840386e-05 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ], [ 480, 0.0 ], [ 490, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPFS2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0005114644762348031 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0015855398763278898 ], [ 210, 0.0 ], [ 220, 5.1146447623480316e-05 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0008183431619756851 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 0.00010229289524696063 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 0.00010229315684354005 ], [ 350, 0.0 ], [ 360, 0.0 ], [ 370, 0.0 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ], [ 480, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPMS1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0009776939133665423 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.001271002087376505 ], [ 210, 0.0 ], [ 220, 4.888469566832712e-05 ], [ 230, 0.00019553878267330847 ], [ 240, 0.0 ], [ 250, 0.001222117391708178 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 4.888469566832712e-05 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 9.777369301015869e-05 ], [ 350, 0.0 ], [ 360, 0.0 ], [ 370, 0.0 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ], [ 480, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPMS2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0007708970929470625 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.001541794185894125 ], [ 210, 0.0 ], [ 220, 7.708970929470626e-05 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0012334353487153 ], [ 260, 7.708970929470626e-05 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 7.708970929470626e-05 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 0.00015418845221006018 ], [ 350, 0.0 ], [ 360, 0.0 ], [ 370, 7.709684134241019e-05 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ], [ 480, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVFS1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0018919327985469957 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0011351596791281974 ], [ 210, 0.0 ], [ 220, 0.0 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0010405630392008476 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 0.0 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 0.0 ], [ 350, 0.0 ], [ 360, 0.0 ], [ 370, 9.459842966606754e-05 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVFS2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0006918500069185001 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0024906600249066002 ], [ 210, 0.0 ], [ 220, 0.00076103500761035 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.00027674000276740006 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 6.918500069185002e-05 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 0.0 ], [ 350, 0.0 ], [ 360, 0.0 ], [ 370, 0.0 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVMS1", "pairs": [ [ 1, 0.0 ], [ 2, 0.0008933357155619082 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0013697814305282591 ], [ 210, 0.0 ], [ 220, 0.00011911142874158774 ], [ 230, 0.0 ], [ 240, 0.0 ], [ 250, 0.0009528914299327019 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 5.9555891715477684e-05 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 0.0 ], [ 350, 0.0 ], [ 360, 2.9778832610204014e-05 ], [ 370, 0.0 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ], [ 480, 0.0 ], [ 490, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVMS2", "pairs": [ [ 1, 0.0 ], [ 2, 0.0026575247814185866 ], [ 3, 0.0 ], [ 4, 0.0 ], [ 5, 0.0 ], [ 6, 0.0 ], [ 7, 0.0 ], [ 8, 0.0 ], [ 9, 0.0 ], [ 10, 0.0 ], [ 20, 0.0 ], [ 30, 0.0 ], [ 40, 0.0 ], [ 50, 0.0 ], [ 60, 0.0 ], [ 70, 0.0 ], [ 80, 0.0 ], [ 90, 0.0 ], [ 100, 0.0 ], [ 110, 0.0 ], [ 120, 0.0 ], [ 130, 0.0 ], [ 140, 0.0 ], [ 150, 0.0 ], [ 160, 0.0 ], [ 170, 0.0 ], [ 180, 0.0 ], [ 190, 0.0 ], [ 200, 0.0013287623907092933 ], [ 210, 0.0 ], [ 220, 0.0002657524781418587 ], [ 230, 0.00017716831876123912 ], [ 240, 0.0 ], [ 250, 0.0010630099125674348 ], [ 260, 0.0 ], [ 270, 0.0 ], [ 280, 0.0 ], [ 290, 0.0 ], [ 300, 0.0 ], [ 310, 0.0 ], [ 320, 0.0 ], [ 330, 0.0 ], [ 340, 8.858572883908402e-05 ], [ 350, 0.0 ], [ 360, 0.0 ], [ 370, 0.0 ], [ 380, 0.0 ], [ 390, 0.0 ], [ 400, 0.0 ], [ 410, 0.0 ], [ 420, 0.0 ], [ 430, 0.0 ], [ 440, 0.0 ], [ 450, 0.0 ], [ 460, 0.0 ], [ 470, 0.0 ], [ 480, 0.0 ] ], "color": "#5cb85c", "width": 2, "dash": null, "showlegend": true, "marker": null } ] } ], "pconfig": { "id": "fastqc_per_base_n_content_plot", "title": "FastQC: Per Base N Content", "anchor": null, "table_title": null, "height": null, "width": null, "square": false, "logswitch": false, "logswitch_active": false, "logswitch_label": "Log10", "cpswitch": true, "cpswitch_c_active": true, "cpswitch_counts_label": "Counts", "cpswitch_percent_label": "Percentages", "xLog": null, "yLog": null, "xlog": false, "ylog": false, "data_labels": [], "xTitle": null, "yTitle": null, "xlab": "Position in Read (bp)", "ylab": "Percentage N-Count", "xsuffix": null, "ysuffix": null, "tt_suffix": null, "xLabFormat": null, "yLabFormat": null, "xLabelFormat": null, "yLabelFormat": null, "xlab_format": null, "ylab_format": null, "tt_label": "Base {point.x}: {point.y:.2f}%", "xDecimals": null, "yDecimals": null, "decimalPlaces": null, "x_decimals": null, "y_decimals": null, "tt_decimals": null, "xmin": 0, "xmax": null, "ymin": 0, "ymax": null, "xFloor": null, "xCeiling": null, "yFloor": null, "yCeiling": null, "x_clipmin": null, "x_clipmax": null, "y_clipmin": null, "y_clipmax": 100, "save_data_file": true, "showlegend": false, "xMinRange": null, "yMinRange": null, "x_minrange": null, "y_minrange": 5, "xPlotBands": null, "yPlotBands": null, "xPlotLines": null, "yPlotLines": null, "x_bands": null, "y_bands": [ { "from_": 20, "to": 100, "color": "#e6c3c3" }, { "from_": 5, "to": 20, "color": "#e6dcc3" }, { "from_": 0, "to": 5, "color": "#c3e6c3" } ], "x_lines": null, "y_lines": null, "categories": false, "smooth_points": 500, "smooth_points_sumcounts": null, "extra_series": null, "style": null, "hide_zero_cats": false, "hide_empty": false, "colors": { "CVFS2": "#5cb85c", "JPFS1": "#5cb85c", "CCMS1": "#5cb85c", "ICFS1": "#5cb85c", "CCFS2": "#5cb85c", "IAFS2": "#5cb85c", "DVMS1": "#5cb85c", "DVMS2": "#5cb85c", "DCMS2": "#5cb85c", "JCMS1": "#5cb85c", "JCFS1": "#5cb85c", "DPMS1": "#5cb85c", "CAFS2": "#5cb85c", "DAMS1": "#5cb85c", "JAMS2": "#5cb85c", "IPMS1": "#5cb85c", "DCMS1": "#5cb85c", "CAFS1": "#5cb85c", "IPFS1": "#5cb85c", "JVFS1": "#5cb85c", "IVFS2": "#5cb85c", "DVFS1": "#5cb85c", "DPFS2": "#5cb85c", "CVMS1": "#5cb85c", "JVFS2": "#5cb85c", "CPMS1": "#5cb85c", "ICMS1": "#5cb85c", "CVMS2": "#5cb85c", "ICMS2": "#5cb85c", "DCFS2": "#5cb85c", "CCFS1": "#5cb85c", "CCMS2": "#5cb85c", "JVMS1": "#5cb85c", "CPFS2": "#5cb85c", "IAFS1": "#5cb85c", "CAMS1": "#5cb85c", "JPMS2": "#5cb85c", "IAMS1": "#5cb85c", "DAFS1": "#5cb85c", "DAFS2": "#5cb85c", "IAMS2": "#5cb85c", "JVMS2": "#5cb85c", "ICFS2": "#5cb85c", "IPMS2": "#5cb85c", "DPFS1": "#5cb85c", "DCFS1": "#5cb85c", "JCMS2": "#5cb85c", "JPMS1": "#5cb85c", "JAFS1": "#5cb85c", "JCFS2": "#5cb85c", "DPMS2": "#5cb85c", "CAMS2": "#5cb85c", "DAMS2": "#5cb85c", "IVMS1": "#5cb85c", "CPMS2": "#5cb85c", "CPFS1": "#5cb85c", "IVFS1": "#5cb85c", "CVFS1": "#5cb85c", "IVMS2": "#5cb85c", "IPFS2": "#5cb85c", "JAFS2": "#5cb85c", "JAMS1": "#5cb85c", "DVFS2": "#5cb85c", "JPFS2": "#5cb85c" } }, "add_log_tab": false, "add_pct_tab": false, "l_active": false, "p_active": false, "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "yaxis" ], "square": false, "flat": false, "defer_render": false }, "fastqc_sequence_length_distribution_plot": { "id": "fastqc_sequence_length_distribution_plot", "anchor": "fastqc_sequence_length_distribution_plot", "plot_type": "xy_line", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 500, "hoverlabel": { "namelength": -1 }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "white", "plot_bgcolor": "white", "showlegend": false, "title": { "font": { "size": 20 }, "text": "FastQC: Sequence Length Distribution", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "hoverdistance": -1 }, "datasets": [ { "plot_id": "fastqc_sequence_length_distribution_plot", "label": "1", "uid": "fastqc_sequence_length_distribution_plot", "dconfig": { "title": "FastQC: Sequence Length Distribution
64 samples" }, "layout": { "title": { "text": "FastQC: Sequence Length Distribution
64 samples" }, "xaxis": { "hoverformat": null, "ticksuffix": " bp", "title": { "text": "Sequence Length (bp)" }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "yaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "Read Count" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": null } } }, "trace_params": { "hovertemplate": "%{text}
%{x}: %{y}", "mode": "lines", "line": { "width": 2 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "n_samples": 64, "lines": [ { "name": "CAFS1", "pairs": [ [ 300, 3.0 ], [ 305, 0.0 ], [ 310, 0.0 ], [ 315, 0.0 ], [ 320, 0.0 ], [ 325, 0.0 ], [ 330, 1.0 ], [ 335, 0.0 ], [ 340, 20.0 ], [ 345, 1.0 ], [ 350, 0.0 ], [ 355, 0.0 ], [ 360, 1.0 ], [ 365, 0.0 ], [ 370, 0.0 ], [ 375, 0.0 ], [ 380, 0.0 ], [ 385, 4.0 ], [ 390, 0.0 ], [ 395, 1.0 ], [ 400, 1.0 ], [ 405, 0.0 ], [ 410, 10.0 ], [ 415, 0.0 ], [ 420, 1.0 ], [ 425, 0.0 ], [ 430, 6.0 ], [ 435, 5445.0 ], [ 440, 129181.0 ], [ 445, 26.0 ], [ 450, 4.0 ], [ 455, 1.0 ], [ 460, 1195.0 ], [ 465, 24467.0 ], [ 470, 0.0 ], [ 475, 0.0 ], [ 480, 0.0 ], [ 485, 0.0 ], [ 490, 1.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAFS2", "pairs": [ [ 300, 1.0 ], [ 305, 0.0 ], [ 310, 0.0 ], [ 315, 0.0 ], [ 320, 0.0 ], [ 325, 0.0 ], [ 330, 0.0 ], [ 335, 0.0 ], [ 340, 20.0 ], [ 345, 0.0 ], [ 350, 1.0 ], [ 355, 1.0 ], [ 360, 2.0 ], [ 365, 0.0 ], [ 370, 0.0 ], [ 375, 2.0 ], [ 380, 0.0 ], [ 385, 1.0 ], [ 390, 0.0 ], [ 395, 0.0 ], [ 400, 2.0 ], [ 405, 1.0 ], [ 410, 11.0 ], [ 415, 1.0 ], [ 420, 0.0 ], [ 425, 1.0 ], [ 430, 5.0 ], [ 435, 5244.0 ], [ 440, 118103.0 ], [ 445, 17.0 ], [ 450, 4.0 ], [ 455, 2.0 ], [ 460, 1264.0 ], [ 465, 23626.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAMS1", "pairs": [ [ 315, 1.0 ], [ 320, 0.0 ], [ 325, 0.0 ], [ 330, 0.0 ], [ 335, 0.0 ], [ 340, 40.0 ], [ 345, 1.0 ], [ 350, 2.0 ], [ 355, 0.0 ], [ 360, 1.0 ], [ 365, 0.0 ], [ 370, 0.0 ], [ 375, 2.0 ], [ 380, 0.0 ], [ 385, 8.0 ], [ 390, 0.0 ], [ 395, 0.0 ], [ 400, 2.0 ], [ 405, 1.0 ], [ 410, 22.0 ], [ 415, 1.0 ], [ 420, 2.0 ], [ 425, 1.0 ], [ 430, 7.0 ], [ 435, 8941.0 ], [ 440, 116558.0 ], [ 445, 16.0 ], [ 450, 39.0 ], [ 455, 1.0 ], [ 460, 1342.0 ], [ 465, 16685.0 ], [ 470, 3.0 ], [ 475, 0.0 ], [ 480, 1.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAMS2", "pairs": [ [ 315, 1.0 ], [ 320, 0.0 ], [ 325, 0.0 ], [ 330, 1.0 ], [ 335, 0.0 ], [ 340, 32.0 ], [ 345, 2.0 ], [ 350, 0.0 ], [ 355, 0.0 ], [ 360, 2.0 ], [ 365, 0.0 ], [ 370, 0.0 ], [ 375, 0.0 ], [ 380, 0.0 ], [ 385, 16.0 ], [ 390, 0.0 ], [ 395, 0.0 ], [ 400, 0.0 ], [ 405, 0.0 ], [ 410, 11.0 ], [ 415, 0.0 ], [ 420, 2.0 ], [ 425, 0.0 ], [ 430, 7.0 ], [ 435, 10114.0 ], [ 440, 129138.0 ], [ 445, 19.0 ], [ 450, 60.0 ], [ 455, 0.0 ], [ 460, 1100.0 ], [ 465, 23047.0 ], [ 470, 1.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCFS1", "pairs": [ [ 305, 1.0 ], [ 310, 0.0 ], [ 315, 154.0 ], [ 320, 0.0 ], [ 325, 0.0 ], [ 330, 0.0 ], [ 335, 0.0 ], [ 340, 49.0 ], [ 345, 0.0 ], [ 350, 0.0 ], [ 355, 2.0 ], [ 360, 0.0 ], [ 365, 0.0 ], [ 370, 1.0 ], [ 375, 0.0 ], [ 380, 0.0 ], [ 385, 10.0 ], [ 390, 0.0 ], [ 395, 0.0 ], [ 400, 0.0 ], [ 405, 2.0 ], [ 410, 11.0 ], [ 415, 3.0 ], [ 420, 65.0 ], [ 425, 2.0 ], [ 430, 22.0 ], [ 435, 11084.0 ], [ 440, 172366.0 ], [ 445, 589.0 ], [ 450, 11939.0 ], [ 455, 14.0 ], [ 460, 2997.0 ], [ 465, 11179.0 ], [ 470, 3.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCFS2", "pairs": [ [ 300, 1.0 ], [ 305, 0.0 ], [ 310, 1.0 ], [ 315, 110.0 ], [ 320, 2.0 ], [ 325, 1.0 ], [ 330, 0.0 ], [ 335, 0.0 ], [ 340, 46.0 ], [ 345, 0.0 ], [ 350, 1.0 ], [ 355, 0.0 ], [ 360, 0.0 ], [ 365, 1.0 ], [ 370, 2.0 ], [ 375, 0.0 ], [ 380, 1.0 ], [ 385, 4.0 ], [ 390, 1.0 ], [ 395, 4.0 ], [ 400, 2.0 ], [ 405, 2.0 ], [ 410, 13.0 ], [ 415, 3.0 ], [ 420, 47.0 ], [ 425, 6.0 ], [ 430, 24.0 ], [ 435, 11511.0 ], [ 440, 161939.0 ], [ 445, 541.0 ], [ 450, 8772.0 ], [ 455, 11.0 ], [ 460, 3268.0 ], [ 465, 10493.0 ], [ 470, 1.0 ], [ 475, 3.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCMS1", "pairs": [ [ 315, 8.0 ], [ 320, 1.0 ], [ 325, 0.0 ], [ 330, 0.0 ], [ 335, 0.0 ], [ 340, 100.0 ], [ 345, 0.0 ], [ 350, 0.0 ], [ 355, 1.0 ], [ 360, 2.0 ], [ 365, 1.0 ], [ 370, 1.0 ], [ 375, 0.0 ], [ 380, 2.0 ], [ 385, 4.0 ], [ 390, 0.0 ], [ 395, 2.0 ], [ 400, 2.0 ], [ 405, 1.0 ], [ 410, 26.0 ], [ 415, 5.0 ], [ 420, 54.0 ], [ 425, 3.0 ], [ 430, 13.0 ], [ 435, 13471.0 ], [ 440, 170969.0 ], [ 445, 514.0 ], [ 450, 10097.0 ], [ 455, 11.0 ], [ 460, 2390.0 ], [ 465, 6281.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCMS2", "pairs": [ [ 310, 1.0 ], [ 315, 16.0 ], [ 320, 0.0 ], [ 325, 0.0 ], [ 330, 0.0 ], [ 335, 0.0 ], [ 340, 80.0 ], [ 345, 0.0 ], [ 350, 3.0 ], [ 355, 1.0 ], [ 360, 1.0 ], [ 365, 0.0 ], [ 370, 2.0 ], [ 375, 0.0 ], [ 380, 1.0 ], [ 385, 7.0 ], [ 390, 0.0 ], [ 395, 5.0 ], [ 400, 2.0 ], [ 405, 5.0 ], [ 410, 27.0 ], [ 415, 1.0 ], [ 420, 57.0 ], [ 425, 6.0 ], [ 430, 15.0 ], [ 435, 12580.0 ], [ 440, 161215.0 ], [ 445, 460.0 ], [ 450, 9400.0 ], [ 455, 7.0 ], [ 460, 1764.0 ], [ 465, 5649.0 ], [ 470, 0.0 ], [ 475, 0.0 ], [ 480, 1.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPFS1", "pairs": [ [ 300, 1.0 ], [ 305, 0.0 ], [ 310, 0.0 ], [ 315, 0.0 ], [ 320, 0.0 ], [ 325, 0.0 ], [ 330, 0.0 ], [ 335, 0.0 ], [ 340, 1.0 ], [ 345, 1.0 ], [ 350, 0.0 ], [ 355, 0.0 ], [ 360, 1.0 ], [ 365, 0.0 ], [ 370, 0.0 ], [ 375, 1.0 ], [ 380, 0.0 ], [ 385, 6.0 ], [ 390, 0.0 ], [ 395, 0.0 ], [ 400, 0.0 ], [ 405, 1.0 ], [ 410, 0.0 ], [ 415, 0.0 ], [ 420, 0.0 ], [ 425, 2.0 ], [ 430, 3.0 ], [ 435, 3513.0 ], [ 440, 10896.0 ], [ 445, 51.0 ], [ 450, 29.0 ], [ 455, 23.0 ], [ 460, 7515.0 ], [ 465, 121878.0 ], [ 470, 8.0 ], [ 475, 5.0 ], [ 480, 3.0 ], [ 485, 2.0 ], [ 490, 2.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPFS2", "pairs": [ [ 310, 1.0 ], [ 315, 54.0 ], [ 320, 0.0 ], [ 325, 1.0 ], [ 330, 0.0 ], [ 335, 0.0 ], [ 340, 69.0 ], [ 345, 2.0 ], [ 350, 1.0 ], [ 355, 2.0 ], [ 360, 1.0 ], [ 365, 2.0 ], [ 370, 1.0 ], [ 375, 0.0 ], [ 380, 2.0 ], [ 385, 7.0 ], [ 390, 1.0 ], [ 395, 2.0 ], [ 400, 0.0 ], [ 405, 2.0 ], [ 410, 24.0 ], [ 415, 1.0 ], [ 420, 23.0 ], [ 425, 3.0 ], [ 430, 33.0 ], [ 435, 11734.0 ], [ 440, 143507.0 ], [ 445, 247.0 ], [ 450, 3404.0 ], [ 455, 7.0 ], [ 460, 5967.0 ], [ 465, 7942.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPMS1", "pairs": [ [ 305, 2.0 ], [ 310, 0.0 ], [ 315, 16.0 ], [ 320, 0.0 ], [ 325, 1.0 ], [ 330, 1.0 ], [ 335, 0.0 ], [ 340, 113.0 ], [ 345, 1.0 ], [ 350, 2.0 ], [ 355, 2.0 ], [ 360, 0.0 ], [ 365, 1.0 ], [ 370, 1.0 ], [ 375, 1.0 ], [ 380, 3.0 ], [ 385, 2.0 ], [ 390, 0.0 ], [ 395, 1.0 ], [ 400, 3.0 ], [ 405, 0.0 ], [ 410, 30.0 ], [ 415, 2.0 ], [ 420, 51.0 ], [ 425, 1.0 ], [ 430, 33.0 ], [ 435, 16603.0 ], [ 440, 181242.0 ], [ 445, 460.0 ], [ 450, 7472.0 ], [ 455, 5.0 ], [ 460, 4282.0 ], [ 465, 8679.0 ], [ 470, 2.0 ], [ 475, 3.0 ], [ 480, 0.0 ], [ 485, 1.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPMS2", "pairs": [ [ 315, 10.0 ], [ 320, 0.0 ], [ 325, 0.0 ], [ 330, 0.0 ], [ 335, 0.0 ], [ 340, 48.0 ], [ 345, 1.0 ], [ 350, 1.0 ], [ 355, 0.0 ], [ 360, 1.0 ], [ 365, 0.0 ], [ 370, 0.0 ], [ 375, 1.0 ], [ 380, 1.0 ], [ 385, 4.0 ], [ 390, 0.0 ], [ 395, 3.0 ], [ 400, 3.0 ], [ 405, 0.0 ], [ 410, 23.0 ], [ 415, 2.0 ], [ 420, 42.0 ], [ 425, 0.0 ], [ 430, 21.0 ], [ 435, 20953.0 ], [ 440, 158225.0 ], [ 445, 356.0 ], [ 450, 6846.0 ], [ 455, 7.0 ], [ 460, 2785.0 ], [ 465, 8560.0 ], [ 470, 1.0 ], [ 475, 0.0 ], [ 480, 2.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVFS1", "pairs": [ [ 315, 53.0 ], [ 320, 1.0 ], [ 325, 0.0 ], [ 330, 1.0 ], [ 335, 0.0 ], [ 340, 56.0 ], [ 345, 0.0 ], [ 350, 1.0 ], [ 355, 0.0 ], [ 360, 1.0 ], [ 365, 1.0 ], [ 370, 1.0 ], [ 375, 2.0 ], [ 380, 3.0 ], [ 385, 9.0 ], [ 390, 0.0 ], [ 395, 0.0 ], [ 400, 1.0 ], [ 405, 4.0 ], [ 410, 31.0 ], [ 415, 3.0 ], [ 420, 41.0 ], [ 425, 4.0 ], [ 430, 15.0 ], [ 435, 10966.0 ], [ 440, 181914.0 ], [ 445, 454.0 ], [ 450, 7024.0 ], [ 455, 12.0 ], [ 460, 2068.0 ], [ 465, 10350.0 ], [ 470, 1.0 ], [ 475, 0.0 ], [ 480, 0.0 ], [ 485, 1.0 ], [ 490, 1.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVFS2", "pairs": [ [ 315, 22.0 ], [ 320, 0.0 ], [ 325, 1.0 ], [ 330, 0.0 ], [ 335, 0.0 ], [ 340, 38.0 ], [ 345, 1.0 ], [ 350, 1.0 ], [ 355, 0.0 ], [ 360, 0.0 ], [ 365, 0.0 ], [ 370, 1.0 ], [ 375, 0.0 ], [ 380, 2.0 ], [ 385, 17.0 ], [ 390, 0.0 ], [ 395, 0.0 ], [ 400, 2.0 ], [ 405, 2.0 ], [ 410, 25.0 ], [ 415, 2.0 ], [ 420, 56.0 ], [ 425, 3.0 ], [ 430, 12.0 ], [ 435, 9411.0 ], [ 440, 169193.0 ], [ 445, 474.0 ], [ 450, 9000.0 ], [ 455, 6.0 ], [ 460, 2013.0 ], [ 465, 10450.0 ], [ 470, 0.0 ], [ 475, 2.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVMS1", "pairs": [ [ 315, 10.0 ], [ 320, 0.0 ], [ 325, 0.0 ], [ 330, 0.0 ], [ 335, 1.0 ], [ 340, 46.0 ], [ 345, 1.0 ], [ 350, 0.0 ], [ 355, 0.0 ], [ 360, 0.0 ], [ 365, 0.0 ], [ 370, 0.0 ], [ 375, 1.0 ], [ 380, 0.0 ], [ 385, 1.0 ], [ 390, 3.0 ], [ 395, 1.0 ], [ 400, 3.0 ], [ 405, 2.0 ], [ 410, 11.0 ], [ 415, 4.0 ], [ 420, 169.0 ], [ 425, 2.0 ], [ 430, 5.0 ], [ 435, 6588.0 ], [ 440, 131798.0 ], [ 445, 1216.0 ], [ 450, 33875.0 ], [ 455, 2.0 ], [ 460, 949.0 ], [ 465, 3481.0 ], [ 470, 1.0 ], [ 475, 0.0 ], [ 480, 1.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVMS2", "pairs": [ [ 315, 21.0 ], [ 320, 1.0 ], [ 325, 1.0 ], [ 330, 3.0 ], [ 335, 0.0 ], [ 340, 72.0 ], [ 345, 1.0 ], [ 350, 1.0 ], [ 355, 2.0 ], [ 360, 1.0 ], [ 365, 0.0 ], [ 370, 0.0 ], [ 375, 1.0 ], [ 380, 0.0 ], [ 385, 1.0 ], [ 390, 2.0 ], [ 395, 1.0 ], [ 400, 2.0 ], [ 405, 4.0 ], [ 410, 29.0 ], [ 415, 10.0 ], [ 420, 196.0 ], [ 425, 1.0 ], [ 430, 14.0 ], [ 435, 9304.0 ], [ 440, 167149.0 ], [ 445, 1803.0 ], [ 450, 36738.0 ], [ 455, 11.0 ], [ 460, 1565.0 ], [ 465, 4654.0 ], [ 470, 2.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAFS1", "pairs": [ [ 315, 2.0 ], [ 320, 1.0 ], [ 325, 0.0 ], [ 330, 0.0 ], [ 335, 0.0 ], [ 340, 5.0 ], [ 345, 3.0 ], [ 350, 0.0 ], [ 355, 0.0 ], [ 360, 2.0 ], [ 365, 9.0 ], [ 370, 1.0 ], [ 375, 0.0 ], [ 380, 2.0 ], [ 385, 8.0 ], [ 390, 6.0 ], [ 395, 1.0 ], [ 400, 0.0 ], [ 405, 1.0 ], [ 410, 3.0 ], [ 415, 1.0 ], [ 420, 1.0 ], [ 425, 1.0 ], [ 430, 4.0 ], [ 435, 8380.0 ], [ 440, 24214.0 ], [ 445, 25.0 ], [ 450, 5.0 ], [ 455, 15.0 ], [ 460, 3046.0 ], [ 465, 51581.0 ], [ 470, 1.0 ], [ 475, 2.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAFS2", "pairs": [ [ 320, 1.0 ], [ 325, 0.0 ], [ 330, 0.0 ], [ 335, 3.0 ], [ 340, 3.0 ], [ 345, 0.0 ], [ 350, 0.0 ], [ 355, 0.0 ], [ 360, 1.0 ], [ 365, 7.0 ], [ 370, 0.0 ], [ 375, 0.0 ], [ 380, 1.0 ], [ 385, 1.0 ], [ 390, 0.0 ], [ 395, 0.0 ], [ 400, 0.0 ], [ 405, 1.0 ], [ 410, 4.0 ], [ 415, 0.0 ], [ 420, 1.0 ], [ 425, 0.0 ], [ 430, 2.0 ], [ 435, 3016.0 ], [ 440, 13896.0 ], [ 445, 22.0 ], [ 450, 9.0 ], [ 455, 52.0 ], [ 460, 1778.0 ], [ 465, 17685.0 ], [ 470, 5.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAMS1", "pairs": [ [ 335, 4.0 ], [ 340, 3.0 ], [ 345, 3.0 ], [ 350, 0.0 ], [ 355, 0.0 ], [ 360, 0.0 ], [ 365, 4.0 ], [ 370, 0.0 ], [ 375, 1.0 ], [ 380, 4.0 ], [ 385, 0.0 ], [ 390, 6.0 ], [ 395, 0.0 ], [ 400, 0.0 ], [ 405, 0.0 ], [ 410, 1.0 ], [ 415, 0.0 ], [ 420, 2.0 ], [ 425, 0.0 ], [ 430, 0.0 ], [ 435, 854.0 ], [ 440, 6636.0 ], [ 445, 18.0 ], [ 450, 3.0 ], [ 455, 27.0 ], [ 460, 2263.0 ], [ 465, 51701.0 ], [ 470, 2.0 ], [ 475, 1.0 ], [ 480, 0.0 ], [ 485, 1.0 ], [ 490, 1.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAMS2", "pairs": [ [ 320, 1.0 ], [ 325, 0.0 ], [ 330, 0.0 ], [ 335, 0.0 ], [ 340, 1.0 ], [ 345, 0.0 ], [ 350, 0.0 ], [ 355, 0.0 ], [ 360, 1.0 ], [ 365, 23.0 ], [ 370, 0.0 ], [ 375, 1.0 ], [ 380, 0.0 ], [ 385, 4.0 ], [ 390, 0.0 ], [ 395, 3.0 ], [ 400, 0.0 ], [ 405, 1.0 ], [ 410, 0.0 ], [ 415, 0.0 ], [ 420, 2.0 ], [ 425, 2.0 ], [ 430, 0.0 ], [ 435, 1456.0 ], [ 440, 2484.0 ], [ 445, 9.0 ], [ 450, 1.0 ], [ 455, 9.0 ], [ 460, 1954.0 ], [ 465, 72071.0 ], [ 470, 3.0 ], [ 475, 0.0 ], [ 480, 3.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCFS1", "pairs": [ [ 300, 1.0 ], [ 305, 4.0 ], [ 310, 6.0 ], [ 315, 0.0 ], [ 320, 0.0 ], [ 325, 2.0 ], [ 330, 1.0 ], [ 335, 3.0 ], [ 340, 5.0 ], [ 345, 2.0 ], [ 350, 3.0 ], [ 355, 1.0 ], [ 360, 3.0 ], [ 365, 57.0 ], [ 370, 2.0 ], [ 375, 11.0 ], [ 380, 2.0 ], [ 385, 13.0 ], [ 390, 14.0 ], [ 395, 1.0 ], [ 400, 3.0 ], [ 405, 0.0 ], [ 410, 5.0 ], [ 415, 4.0 ], [ 420, 1.0 ], [ 425, 2.0 ], [ 430, 2.0 ], [ 435, 2007.0 ], [ 440, 7829.0 ], [ 445, 182.0 ], [ 450, 11.0 ], [ 455, 27.0 ], [ 460, 4836.0 ], [ 465, 101316.0 ], [ 470, 6.0 ], [ 475, 2.0 ], [ 480, 2.0 ], [ 485, 2.0 ], [ 490, 4.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCFS2", "pairs": [ [ 300, 5.0 ], [ 305, 1.0 ], [ 310, 2.0 ], [ 315, 3.0 ], [ 320, 3.0 ], [ 325, 10.0 ], [ 330, 7.0 ], [ 335, 14.0 ], [ 340, 2.0 ], [ 345, 13.0 ], [ 350, 0.0 ], [ 355, 2.0 ], [ 360, 5.0 ], [ 365, 90.0 ], [ 370, 2.0 ], [ 375, 19.0 ], [ 380, 5.0 ], [ 385, 17.0 ], [ 390, 14.0 ], [ 395, 4.0 ], [ 400, 4.0 ], [ 405, 0.0 ], [ 410, 9.0 ], [ 415, 4.0 ], [ 420, 0.0 ], [ 425, 2.0 ], [ 430, 0.0 ], [ 435, 855.0 ], [ 440, 3851.0 ], [ 445, 46.0 ], [ 450, 8.0 ], [ 455, 15.0 ], [ 460, 3516.0 ], [ 465, 56345.0 ], [ 470, 4.0 ], [ 475, 3.0 ], [ 480, 2.0 ], [ 485, 4.0 ], [ 490, 13.0 ], [ 495, 2.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCMS1", "pairs": [ [ 300, 19.0 ], [ 305, 2.0 ], [ 310, 0.0 ], [ 315, 3.0 ], [ 320, 0.0 ], [ 325, 0.0 ], [ 330, 0.0 ], [ 335, 0.0 ], [ 340, 11.0 ], [ 345, 0.0 ], [ 350, 0.0 ], [ 355, 0.0 ], [ 360, 1.0 ], [ 365, 6.0 ], [ 370, 0.0 ], [ 375, 0.0 ], [ 380, 1.0 ], [ 385, 2.0 ], [ 390, 0.0 ], [ 395, 0.0 ], [ 400, 1.0 ], [ 405, 0.0 ], [ 410, 3.0 ], [ 415, 0.0 ], [ 420, 0.0 ], [ 425, 0.0 ], [ 430, 5.0 ], [ 435, 5364.0 ], [ 440, 23978.0 ], [ 445, 294.0 ], [ 450, 235.0 ], [ 455, 25.0 ], [ 460, 10910.0 ], [ 465, 190804.0 ], [ 470, 11.0 ], [ 475, 10.0 ], [ 480, 2.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCMS2", "pairs": [ [ 300, 4.0 ], [ 305, 2.0 ], [ 310, 4.0 ], [ 315, 1.0 ], [ 320, 0.0 ], [ 325, 5.0 ], [ 330, 7.0 ], [ 335, 16.0 ], [ 340, 9.0 ], [ 345, 14.0 ], [ 350, 1.0 ], [ 355, 3.0 ], [ 360, 1.0 ], [ 365, 47.0 ], [ 370, 1.0 ], [ 375, 9.0 ], [ 380, 1.0 ], [ 385, 7.0 ], [ 390, 16.0 ], [ 395, 1.0 ], [ 400, 0.0 ], [ 405, 0.0 ], [ 410, 6.0 ], [ 415, 1.0 ], [ 420, 4.0 ], [ 425, 3.0 ], [ 430, 2.0 ], [ 435, 2002.0 ], [ 440, 8634.0 ], [ 445, 86.0 ], [ 450, 166.0 ], [ 455, 6.0 ], [ 460, 4304.0 ], [ 465, 70723.0 ], [ 470, 8.0 ], [ 475, 4.0 ], [ 480, 4.0 ], [ 485, 3.0 ], [ 490, 4.0 ], [ 495, 5.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPFS1", "pairs": [ [ 305, 1.0 ], [ 310, 1.0 ], [ 315, 0.0 ], [ 320, 0.0 ], [ 325, 0.0 ], [ 330, 0.0 ], [ 335, 1.0 ], [ 340, 1.0 ], [ 345, 1.0 ], [ 350, 0.0 ], [ 355, 0.0 ], [ 360, 1.0 ], [ 365, 11.0 ], [ 370, 0.0 ], [ 375, 1.0 ], [ 380, 0.0 ], [ 385, 0.0 ], [ 390, 0.0 ], [ 395, 0.0 ], [ 400, 0.0 ], [ 405, 0.0 ], [ 410, 0.0 ], [ 415, 0.0 ], [ 420, 1.0 ], [ 425, 3.0 ], [ 430, 0.0 ], [ 435, 3472.0 ], [ 440, 5065.0 ], [ 445, 95.0 ], [ 450, 65.0 ], [ 455, 11.0 ], [ 460, 5896.0 ], [ 465, 121639.0 ], [ 470, 1.0 ], [ 475, 4.0 ], [ 480, 2.0 ], [ 485, 2.0 ], [ 490, 3.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPFS2", "pairs": [ [ 300, 7.0 ], [ 305, 0.0 ], [ 310, 3.0 ], [ 315, 2.0 ], [ 320, 1.0 ], [ 325, 6.0 ], [ 330, 1.0 ], [ 335, 9.0 ], [ 340, 3.0 ], [ 345, 7.0 ], [ 350, 1.0 ], [ 355, 0.0 ], [ 360, 12.0 ], [ 365, 109.0 ], [ 370, 2.0 ], [ 375, 21.0 ], [ 380, 0.0 ], [ 385, 9.0 ], [ 390, 24.0 ], [ 395, 18.0 ], [ 400, 1.0 ], [ 405, 8.0 ], [ 410, 9.0 ], [ 415, 2.0 ], [ 420, 2.0 ], [ 425, 5.0 ], [ 430, 4.0 ], [ 435, 3218.0 ], [ 440, 4627.0 ], [ 445, 125.0 ], [ 450, 71.0 ], [ 455, 56.0 ], [ 460, 6073.0 ], [ 465, 109314.0 ], [ 470, 5.0 ], [ 475, 5.0 ], [ 480, 3.0 ], [ 485, 7.0 ], [ 490, 11.0 ], [ 495, 2.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPMS1", "pairs": [ [ 310, 1.0 ], [ 315, 1.0 ], [ 320, 1.0 ], [ 325, 1.0 ], [ 330, 0.0 ], [ 335, 2.0 ], [ 340, 10.0 ], [ 345, 2.0 ], [ 350, 0.0 ], [ 355, 0.0 ], [ 360, 0.0 ], [ 365, 20.0 ], [ 370, 2.0 ], [ 375, 5.0 ], [ 380, 3.0 ], [ 385, 5.0 ], [ 390, 3.0 ], [ 395, 0.0 ], [ 400, 1.0 ], [ 405, 3.0 ], [ 410, 3.0 ], [ 415, 0.0 ], [ 420, 3.0 ], [ 425, 0.0 ], [ 430, 7.0 ], [ 435, 2583.0 ], [ 440, 30055.0 ], [ 445, 72.0 ], [ 450, 1240.0 ], [ 455, 11.0 ], [ 460, 2805.0 ], [ 465, 42450.0 ], [ 470, 4.0 ], [ 475, 1.0 ], [ 480, 0.0 ], [ 485, 0.0 ], [ 490, 2.0 ], [ 495, 1.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPMS2", "pairs": [ [ 305, 1.0 ], [ 310, 1.0 ], [ 315, 1.0 ], [ 320, 1.0 ], [ 325, 0.0 ], [ 330, 0.0 ], [ 335, 2.0 ], [ 340, 5.0 ], [ 345, 1.0 ], [ 350, 1.0 ], [ 355, 0.0 ], [ 360, 0.0 ], [ 365, 12.0 ], [ 370, 0.0 ], [ 375, 0.0 ], [ 380, 0.0 ], [ 385, 1.0 ], [ 390, 1.0 ], [ 395, 1.0 ], [ 400, 0.0 ], [ 405, 3.0 ], [ 410, 2.0 ], [ 415, 1.0 ], [ 420, 20.0 ], [ 425, 2.0 ], [ 430, 2.0 ], [ 435, 2173.0 ], [ 440, 22317.0 ], [ 445, 311.0 ], [ 450, 4681.0 ], [ 455, 10.0 ], [ 460, 2550.0 ], [ 465, 51006.0 ], [ 470, 2.0 ], [ 475, 2.0 ], [ 480, 1.0 ], [ 485, 0.0 ], [ 490, 2.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVFS1", "pairs": [ [ 300, 3.0 ], [ 305, 0.0 ], [ 310, 0.0 ], [ 315, 3.0 ], [ 320, 1.0 ], [ 325, 1.0 ], [ 330, 0.0 ], [ 335, 3.0 ], [ 340, 6.0 ], [ 345, 2.0 ], [ 350, 0.0 ], [ 355, 0.0 ], [ 360, 0.0 ], [ 365, 19.0 ], [ 370, 0.0 ], [ 375, 2.0 ], [ 380, 0.0 ], [ 385, 2.0 ], [ 390, 0.0 ], [ 395, 0.0 ], [ 400, 0.0 ], [ 405, 1.0 ], [ 410, 3.0 ], [ 415, 0.0 ], [ 420, 5.0 ], [ 425, 1.0 ], [ 430, 7.0 ], [ 435, 2159.0 ], [ 440, 18408.0 ], [ 445, 150.0 ], [ 450, 385.0 ], [ 455, 18.0 ], [ 460, 3094.0 ], [ 465, 44612.0 ], [ 470, 2.0 ], [ 475, 3.0 ], [ 480, 0.0 ], [ 485, 0.0 ], [ 490, 1.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVFS2", "pairs": [ [ 300, 14.0 ], [ 305, 2.0 ], [ 310, 4.0 ], [ 315, 5.0 ], [ 320, 2.0 ], [ 325, 6.0 ], [ 330, 3.0 ], [ 335, 5.0 ], [ 340, 2.0 ], [ 345, 5.0 ], [ 350, 3.0 ], [ 355, 0.0 ], [ 360, 0.0 ], [ 365, 48.0 ], [ 370, 8.0 ], [ 375, 4.0 ], [ 380, 5.0 ], [ 385, 12.0 ], [ 390, 14.0 ], [ 395, 1.0 ], [ 400, 0.0 ], [ 405, 1.0 ], [ 410, 7.0 ], [ 415, 10.0 ], [ 420, 5.0 ], [ 425, 10.0 ], [ 430, 5.0 ], [ 435, 3290.0 ], [ 440, 16296.0 ], [ 445, 157.0 ], [ 450, 268.0 ], [ 455, 18.0 ], [ 460, 4670.0 ], [ 465, 70852.0 ], [ 470, 12.0 ], [ 475, 4.0 ], [ 480, 2.0 ], [ 485, 1.0 ], [ 490, 6.0 ], [ 495, 1.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVMS1", "pairs": [ [ 300, 2.0 ], [ 305, 0.0 ], [ 310, 0.0 ], [ 315, 10.0 ], [ 320, 1.0 ], [ 325, 0.0 ], [ 330, 5.0 ], [ 335, 7.0 ], [ 340, 61.0 ], [ 345, 3.0 ], [ 350, 6.0 ], [ 355, 0.0 ], [ 360, 1.0 ], [ 365, 14.0 ], [ 370, 0.0 ], [ 375, 3.0 ], [ 380, 1.0 ], [ 385, 5.0 ], [ 390, 0.0 ], [ 395, 3.0 ], [ 400, 2.0 ], [ 405, 2.0 ], [ 410, 9.0 ], [ 415, 5.0 ], [ 420, 26.0 ], [ 425, 2.0 ], [ 430, 14.0 ], [ 435, 8090.0 ], [ 440, 92132.0 ], [ 445, 412.0 ], [ 450, 4232.0 ], [ 455, 24.0 ], [ 460, 4892.0 ], [ 465, 47770.0 ], [ 470, 5.0 ], [ 475, 5.0 ], [ 480, 1.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVMS2", "pairs": [ [ 305, 1.0 ], [ 310, 0.0 ], [ 315, 2.0 ], [ 320, 0.0 ], [ 325, 0.0 ], [ 330, 1.0 ], [ 335, 3.0 ], [ 340, 30.0 ], [ 345, 0.0 ], [ 350, 0.0 ], [ 355, 0.0 ], [ 360, 1.0 ], [ 365, 2.0 ], [ 370, 0.0 ], [ 375, 0.0 ], [ 380, 2.0 ], [ 385, 5.0 ], [ 390, 1.0 ], [ 395, 0.0 ], [ 400, 1.0 ], [ 405, 0.0 ], [ 410, 5.0 ], [ 415, 1.0 ], [ 420, 6.0 ], [ 425, 2.0 ], [ 430, 20.0 ], [ 435, 6664.0 ], [ 440, 62233.0 ], [ 445, 221.0 ], [ 450, 914.0 ], [ 455, 33.0 ], [ 460, 7912.0 ], [ 465, 75555.0 ], [ 470, 4.0 ], [ 475, 6.0 ], [ 480, 0.0 ], [ 485, 0.0 ], [ 490, 1.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAFS1", "pairs": [ [ 350, 3.0 ], [ 355, 0.0 ], [ 360, 2.0 ], [ 365, 0.0 ], [ 370, 0.0 ], [ 375, 0.0 ], [ 380, 0.0 ], [ 385, 2.0 ], [ 390, 0.0 ], [ 395, 1.0 ], [ 400, 0.0 ], [ 405, 0.0 ], [ 410, 0.0 ], [ 415, 0.0 ], [ 420, 0.0 ], [ 425, 1.0 ], [ 430, 10.0 ], [ 435, 72774.0 ], [ 440, 3087.0 ], [ 445, 9.0 ], [ 450, 1.0 ], [ 455, 0.0 ], [ 460, 3112.0 ], [ 465, 81624.0 ], [ 470, 1.0 ], [ 475, 2.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAFS2", "pairs": [ [ 320, 1.0 ], [ 325, 0.0 ], [ 330, 0.0 ], [ 335, 0.0 ], [ 340, 0.0 ], [ 345, 0.0 ], [ 350, 0.0 ], [ 355, 0.0 ], [ 360, 2.0 ], [ 365, 0.0 ], [ 370, 0.0 ], [ 375, 0.0 ], [ 380, 3.0 ], [ 385, 6.0 ], [ 390, 0.0 ], [ 395, 0.0 ], [ 400, 2.0 ], [ 405, 0.0 ], [ 410, 0.0 ], [ 415, 0.0 ], [ 420, 0.0 ], [ 425, 0.0 ], [ 430, 0.0 ], [ 435, 7464.0 ], [ 440, 1523.0 ], [ 445, 5.0 ], [ 450, 1.0 ], [ 455, 8.0 ], [ 460, 2766.0 ], [ 465, 113164.0 ], [ 470, 0.0 ], [ 475, 4.0 ], [ 480, 1.0 ], [ 485, 0.0 ], [ 490, 0.0 ], [ 495, 2.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAMS1", "pairs": [ [ 320, 1.0 ], [ 325, 0.0 ], [ 330, 0.0 ], [ 335, 0.0 ], [ 340, 0.0 ], [ 345, 0.0 ], [ 350, 1.0 ], [ 355, 0.0 ], [ 360, 0.0 ], [ 365, 0.0 ], [ 370, 0.0 ], [ 375, 0.0 ], [ 380, 0.0 ], [ 385, 4.0 ], [ 390, 0.0 ], [ 395, 0.0 ], [ 400, 1.0 ], [ 405, 0.0 ], [ 410, 0.0 ], [ 415, 0.0 ], [ 420, 0.0 ], [ 425, 1.0 ], [ 430, 2.0 ], [ 435, 39578.0 ], [ 440, 3147.0 ], [ 445, 2.0 ], [ 450, 4.0 ], [ 455, 2.0 ], [ 460, 3614.0 ], [ 465, 101659.0 ], [ 470, 2.0 ], [ 475, 2.0 ], [ 480, 0.0 ], [ 485, 0.0 ], [ 490, 0.0 ], [ 495, 1.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAMS2", "pairs": [ [ 340, 4.0 ], [ 345, 0.0 ], [ 350, 1.0 ], [ 355, 0.0 ], [ 360, 49.0 ], [ 365, 0.0 ], [ 370, 0.0 ], [ 375, 0.0 ], [ 380, 0.0 ], [ 385, 2.0 ], [ 390, 0.0 ], [ 395, 1.0 ], [ 400, 4.0 ], [ 405, 0.0 ], [ 410, 7.0 ], [ 415, 0.0 ], [ 420, 1.0 ], [ 425, 0.0 ], [ 430, 2.0 ], [ 435, 31382.0 ], [ 440, 48812.0 ], [ 445, 6.0 ], [ 450, 3.0 ], [ 455, 1.0 ], [ 460, 3062.0 ], [ 465, 65074.0 ], [ 470, 0.0 ], [ 475, 1.0 ], [ 480, 0.0 ], [ 485, 1.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICFS1", "pairs": [ [ 315, 2.0 ], [ 320, 0.0 ], [ 325, 2.0 ], [ 330, 0.0 ], [ 335, 0.0 ], [ 340, 11.0 ], [ 345, 1.0 ], [ 350, 0.0 ], [ 355, 1.0 ], [ 360, 1.0 ], [ 365, 0.0 ], [ 370, 0.0 ], [ 375, 0.0 ], [ 380, 2.0 ], [ 385, 3.0 ], [ 390, 0.0 ], [ 395, 1.0 ], [ 400, 1.0 ], [ 405, 0.0 ], [ 410, 4.0 ], [ 415, 0.0 ], [ 420, 3.0 ], [ 425, 1.0 ], [ 430, 5.0 ], [ 435, 16746.0 ], [ 440, 33222.0 ], [ 445, 203.0 ], [ 450, 64.0 ], [ 455, 20.0 ], [ 460, 5768.0 ], [ 465, 78385.0 ], [ 470, 10.0 ], [ 475, 2.0 ], [ 480, 2.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICFS2", "pairs": [ [ 315, 8.0 ], [ 320, 2.0 ], [ 325, 0.0 ], [ 330, 0.0 ], [ 335, 0.0 ], [ 340, 56.0 ], [ 345, 1.0 ], [ 350, 0.0 ], [ 355, 0.0 ], [ 360, 3.0 ], [ 365, 0.0 ], [ 370, 1.0 ], [ 375, 0.0 ], [ 380, 1.0 ], [ 385, 8.0 ], [ 390, 0.0 ], [ 395, 2.0 ], [ 400, 2.0 ], [ 405, 3.0 ], [ 410, 20.0 ], [ 415, 4.0 ], [ 420, 10.0 ], [ 425, 2.0 ], [ 430, 9.0 ], [ 435, 24179.0 ], [ 440, 107979.0 ], [ 445, 119.0 ], [ 450, 950.0 ], [ 455, 6.0 ], [ 460, 4659.0 ], [ 465, 29040.0 ], [ 470, 1.0 ], [ 475, 1.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICMS1", "pairs": [ [ 320, 1.0 ], [ 325, 0.0 ], [ 330, 0.0 ], [ 335, 0.0 ], [ 340, 3.0 ], [ 345, 0.0 ], [ 350, 1.0 ], [ 355, 0.0 ], [ 360, 5.0 ], [ 365, 1.0 ], [ 370, 0.0 ], [ 375, 0.0 ], [ 380, 0.0 ], [ 385, 6.0 ], [ 390, 0.0 ], [ 395, 2.0 ], [ 400, 0.0 ], [ 405, 0.0 ], [ 410, 2.0 ], [ 415, 0.0 ], [ 420, 2.0 ], [ 425, 6.0 ], [ 430, 8.0 ], [ 435, 52207.0 ], [ 440, 10478.0 ], [ 445, 35.0 ], [ 450, 46.0 ], [ 455, 9.0 ], [ 460, 6252.0 ], [ 465, 119182.0 ], [ 470, 5.0 ], [ 475, 2.0 ], [ 480, 0.0 ], [ 485, 2.0 ], [ 490, 1.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICMS2", "pairs": [ [ 360, 3.0 ], [ 365, 1.0 ], [ 370, 0.0 ], [ 375, 0.0 ], [ 380, 0.0 ], [ 385, 4.0 ], [ 390, 0.0 ], [ 395, 4.0 ], [ 400, 0.0 ], [ 405, 0.0 ], [ 410, 2.0 ], [ 415, 0.0 ], [ 420, 4.0 ], [ 425, 0.0 ], [ 430, 6.0 ], [ 435, 71777.0 ], [ 440, 13737.0 ], [ 445, 41.0 ], [ 450, 53.0 ], [ 455, 9.0 ], [ 460, 1998.0 ], [ 465, 33501.0 ], [ 470, 3.0 ], [ 475, 3.0 ], [ 480, 2.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPFS1", "pairs": [ [ 315, 1.0 ], [ 320, 0.0 ], [ 325, 0.0 ], [ 330, 0.0 ], [ 335, 0.0 ], [ 340, 1.0 ], [ 345, 0.0 ], [ 350, 0.0 ], [ 355, 0.0 ], [ 360, 1.0 ], [ 365, 0.0 ], [ 370, 0.0 ], [ 375, 0.0 ], [ 380, 0.0 ], [ 385, 2.0 ], [ 390, 0.0 ], [ 395, 0.0 ], [ 400, 0.0 ], [ 405, 0.0 ], [ 410, 0.0 ], [ 415, 1.0 ], [ 420, 5.0 ], [ 425, 1.0 ], [ 430, 2.0 ], [ 435, 1002.0 ], [ 440, 3580.0 ], [ 445, 61.0 ], [ 450, 36.0 ], [ 455, 10.0 ], [ 460, 8303.0 ], [ 465, 142164.0 ], [ 470, 3.0 ], [ 475, 6.0 ], [ 480, 4.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPFS2", "pairs": [ [ 300, 1.0 ], [ 305, 0.0 ], [ 310, 1.0 ], [ 315, 101.0 ], [ 320, 0.0 ], [ 325, 0.0 ], [ 330, 2.0 ], [ 335, 3.0 ], [ 340, 70.0 ], [ 345, 3.0 ], [ 350, 3.0 ], [ 355, 2.0 ], [ 360, 1.0 ], [ 365, 0.0 ], [ 370, 2.0 ], [ 375, 0.0 ], [ 380, 0.0 ], [ 385, 8.0 ], [ 390, 0.0 ], [ 395, 1.0 ], [ 400, 6.0 ], [ 405, 3.0 ], [ 410, 37.0 ], [ 415, 3.0 ], [ 420, 34.0 ], [ 425, 7.0 ], [ 430, 16.0 ], [ 435, 15517.0 ], [ 440, 182287.0 ], [ 445, 232.0 ], [ 450, 4001.0 ], [ 455, 5.0 ], [ 460, 5262.0 ], [ 465, 9964.0 ], [ 470, 1.0 ], [ 475, 0.0 ], [ 480, 0.0 ], [ 485, 2.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPMS1", "pairs": [ [ 300, 1.0 ], [ 305, 0.0 ], [ 310, 0.0 ], [ 315, 3.0 ], [ 320, 0.0 ], [ 325, 0.0 ], [ 330, 0.0 ], [ 335, 0.0 ], [ 340, 14.0 ], [ 345, 1.0 ], [ 350, 0.0 ], [ 355, 0.0 ], [ 360, 19.0 ], [ 365, 0.0 ], [ 370, 0.0 ], [ 375, 0.0 ], [ 380, 0.0 ], [ 385, 4.0 ], [ 390, 0.0 ], [ 395, 5.0 ], [ 400, 0.0 ], [ 405, 0.0 ], [ 410, 3.0 ], [ 415, 1.0 ], [ 420, 19.0 ], [ 425, 2.0 ], [ 430, 29.0 ], [ 435, 251436.0 ], [ 440, 60859.0 ], [ 445, 339.0 ], [ 450, 2197.0 ], [ 455, 36.0 ], [ 460, 2231.0 ], [ 465, 16878.0 ], [ 470, 1.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPMS2", "pairs": [ [ 315, 5.0 ], [ 320, 1.0 ], [ 325, 1.0 ], [ 330, 0.0 ], [ 335, 0.0 ], [ 340, 16.0 ], [ 345, 3.0 ], [ 350, 2.0 ], [ 355, 0.0 ], [ 360, 10.0 ], [ 365, 2.0 ], [ 370, 0.0 ], [ 375, 0.0 ], [ 380, 0.0 ], [ 385, 1.0 ], [ 390, 1.0 ], [ 395, 1.0 ], [ 400, 0.0 ], [ 405, 2.0 ], [ 410, 4.0 ], [ 415, 2.0 ], [ 420, 4.0 ], [ 425, 2.0 ], [ 430, 7.0 ], [ 435, 48179.0 ], [ 440, 129436.0 ], [ 445, 61.0 ], [ 450, 66.0 ], [ 455, 14.0 ], [ 460, 3128.0 ], [ 465, 55410.0 ], [ 470, 4.0 ], [ 475, 0.0 ], [ 480, 2.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVFS1", "pairs": [ [ 315, 1.0 ], [ 320, 0.0 ], [ 325, 0.0 ], [ 330, 0.0 ], [ 335, 0.0 ], [ 340, 2.0 ], [ 345, 0.0 ], [ 350, 1.0 ], [ 355, 0.0 ], [ 360, 10.0 ], [ 365, 0.0 ], [ 370, 0.0 ], [ 375, 0.0 ], [ 380, 0.0 ], [ 385, 271.0 ], [ 390, 0.0 ], [ 395, 3.0 ], [ 400, 0.0 ], [ 405, 0.0 ], [ 410, 0.0 ], [ 415, 0.0 ], [ 420, 6.0 ], [ 425, 1.0 ], [ 430, 8.0 ], [ 435, 161451.0 ], [ 440, 6811.0 ], [ 445, 48.0 ], [ 450, 16.0 ], [ 455, 11.0 ], [ 460, 2706.0 ], [ 465, 50063.0 ], [ 470, 5.0 ], [ 475, 0.0 ], [ 480, 2.0 ], [ 485, 0.0 ], [ 490, 0.0 ], [ 495, 1.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVFS2", "pairs": [ [ 320, 1.0 ], [ 325, 1.0 ], [ 330, 0.0 ], [ 335, 0.0 ], [ 340, 0.0 ], [ 345, 0.0 ], [ 350, 0.0 ], [ 355, 0.0 ], [ 360, 0.0 ], [ 365, 0.0 ], [ 370, 0.0 ], [ 375, 0.0 ], [ 380, 0.0 ], [ 385, 3.0 ], [ 390, 0.0 ], [ 395, 0.0 ], [ 400, 0.0 ], [ 405, 0.0 ], [ 410, 0.0 ], [ 415, 0.0 ], [ 420, 0.0 ], [ 425, 3.0 ], [ 430, 0.0 ], [ 435, 1164.0 ], [ 440, 1601.0 ], [ 445, 41.0 ], [ 450, 19.0 ], [ 455, 15.0 ], [ 460, 6339.0 ], [ 465, 113676.0 ], [ 470, 4.0 ], [ 475, 4.0 ], [ 480, 3.0 ], [ 485, 2.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVMS1", "pairs": [ [ 300, 1.0 ], [ 305, 1.0 ], [ 310, 0.0 ], [ 315, 0.0 ], [ 320, 0.0 ], [ 325, 1.0 ], [ 330, 0.0 ], [ 335, 0.0 ], [ 340, 2.0 ], [ 345, 0.0 ], [ 350, 0.0 ], [ 355, 0.0 ], [ 360, 3.0 ], [ 365, 0.0 ], [ 370, 0.0 ], [ 375, 0.0 ], [ 380, 0.0 ], [ 385, 160.0 ], [ 390, 0.0 ], [ 395, 6.0 ], [ 400, 0.0 ], [ 405, 0.0 ], [ 410, 7.0 ], [ 415, 1.0 ], [ 420, 2.0 ], [ 425, 1.0 ], [ 430, 6.0 ], [ 435, 53084.0 ], [ 440, 44570.0 ], [ 445, 203.0 ], [ 450, 177.0 ], [ 455, 17.0 ], [ 460, 3649.0 ], [ 465, 47889.0 ], [ 470, 2.0 ], [ 475, 2.0 ], [ 480, 1.0 ], [ 485, 1.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVMS2", "pairs": [ [ 325, 1.0 ], [ 330, 0.0 ], [ 335, 0.0 ], [ 340, 0.0 ], [ 345, 0.0 ], [ 350, 0.0 ], [ 355, 0.0 ], [ 360, 1.0 ], [ 365, 1.0 ], [ 370, 1.0 ], [ 375, 0.0 ], [ 380, 0.0 ], [ 385, 10.0 ], [ 390, 0.0 ], [ 395, 0.0 ], [ 400, 0.0 ], [ 405, 1.0 ], [ 410, 0.0 ], [ 415, 0.0 ], [ 420, 0.0 ], [ 425, 1.0 ], [ 430, 2.0 ], [ 435, 7612.0 ], [ 440, 9680.0 ], [ 445, 36.0 ], [ 450, 39.0 ], [ 455, 10.0 ], [ 460, 3945.0 ], [ 465, 84576.0 ], [ 470, 3.0 ], [ 475, 2.0 ], [ 480, 1.0 ], [ 485, 1.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAFS1", "pairs": [ [ 315, 1.0 ], [ 320, 0.0 ], [ 325, 0.0 ], [ 330, 0.0 ], [ 335, 0.0 ], [ 340, 1.0 ], [ 345, 0.0 ], [ 350, 0.0 ], [ 355, 0.0 ], [ 360, 0.0 ], [ 365, 2.0 ], [ 370, 0.0 ], [ 375, 0.0 ], [ 380, 0.0 ], [ 385, 8.0 ], [ 390, 0.0 ], [ 395, 0.0 ], [ 400, 0.0 ], [ 405, 0.0 ], [ 410, 2.0 ], [ 415, 0.0 ], [ 420, 0.0 ], [ 425, 1.0 ], [ 430, 0.0 ], [ 435, 5326.0 ], [ 440, 10699.0 ], [ 445, 30.0 ], [ 450, 0.0 ], [ 455, 2.0 ], [ 460, 3891.0 ], [ 465, 109287.0 ], [ 470, 3.0 ], [ 475, 3.0 ], [ 480, 2.0 ], [ 485, 1.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAFS2", "pairs": [ [ 360, 1.0 ], [ 365, 1.0 ], [ 370, 0.0 ], [ 375, 0.0 ], [ 380, 0.0 ], [ 385, 1.0 ], [ 390, 0.0 ], [ 395, 0.0 ], [ 400, 0.0 ], [ 405, 0.0 ], [ 410, 0.0 ], [ 415, 0.0 ], [ 420, 0.0 ], [ 425, 2.0 ], [ 430, 0.0 ], [ 435, 2689.0 ], [ 440, 11683.0 ], [ 445, 14.0 ], [ 450, 3.0 ], [ 455, 2.0 ], [ 460, 2315.0 ], [ 465, 65572.0 ], [ 470, 1.0 ], [ 475, 0.0 ], [ 480, 1.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAMS1", "pairs": [ [ 320, 1.0 ], [ 325, 0.0 ], [ 330, 0.0 ], [ 335, 0.0 ], [ 340, 0.0 ], [ 345, 0.0 ], [ 350, 0.0 ], [ 355, 0.0 ], [ 360, 0.0 ], [ 365, 0.0 ], [ 370, 0.0 ], [ 375, 0.0 ], [ 380, 0.0 ], [ 385, 0.0 ], [ 390, 0.0 ], [ 395, 0.0 ], [ 400, 0.0 ], [ 405, 0.0 ], [ 410, 0.0 ], [ 415, 0.0 ], [ 420, 0.0 ], [ 425, 0.0 ], [ 430, 0.0 ], [ 435, 530.0 ], [ 440, 533.0 ], [ 445, 1.0 ], [ 450, 0.0 ], [ 455, 0.0 ], [ 460, 4073.0 ], [ 465, 154437.0 ], [ 470, 12.0 ], [ 475, 3.0 ], [ 480, 0.0 ], [ 485, 1.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAMS2", "pairs": [ [ 350, 1.0 ], [ 355, 0.0 ], [ 360, 0.0 ], [ 365, 1.0 ], [ 370, 0.0 ], [ 375, 0.0 ], [ 380, 5.0 ], [ 385, 0.0 ], [ 390, 0.0 ], [ 395, 0.0 ], [ 400, 0.0 ], [ 405, 0.0 ], [ 410, 1.0 ], [ 415, 0.0 ], [ 420, 18.0 ], [ 425, 2.0 ], [ 430, 0.0 ], [ 435, 821.0 ], [ 440, 1620.0 ], [ 445, 307.0 ], [ 450, 48.0 ], [ 455, 190.0 ], [ 460, 3919.0 ], [ 465, 136997.0 ], [ 470, 4.0 ], [ 475, 6.0 ], [ 480, 1.0 ], [ 485, 2.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCFS1", "pairs": [ [ 310, 1.0 ], [ 315, 0.0 ], [ 320, 0.0 ], [ 325, 0.0 ], [ 330, 0.0 ], [ 335, 0.0 ], [ 340, 1.0 ], [ 345, 0.0 ], [ 350, 0.0 ], [ 355, 0.0 ], [ 360, 1.0 ], [ 365, 0.0 ], [ 370, 0.0 ], [ 375, 1.0 ], [ 380, 0.0 ], [ 385, 0.0 ], [ 390, 0.0 ], [ 395, 0.0 ], [ 400, 0.0 ], [ 405, 1.0 ], [ 410, 0.0 ], [ 415, 3.0 ], [ 420, 2.0 ], [ 425, 2.0 ], [ 430, 0.0 ], [ 435, 381.0 ], [ 440, 1749.0 ], [ 445, 42.0 ], [ 450, 29.0 ], [ 455, 7.0 ], [ 460, 9429.0 ], [ 465, 170003.0 ], [ 470, 5.0 ], [ 475, 6.0 ], [ 480, 2.0 ], [ 485, 0.0 ], [ 490, 1.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCFS2", "pairs": [ [ 300, 1.0 ], [ 305, 0.0 ], [ 310, 0.0 ], [ 315, 0.0 ], [ 320, 0.0 ], [ 325, 0.0 ], [ 330, 0.0 ], [ 335, 0.0 ], [ 340, 0.0 ], [ 345, 1.0 ], [ 350, 0.0 ], [ 355, 0.0 ], [ 360, 0.0 ], [ 365, 0.0 ], [ 370, 0.0 ], [ 375, 1.0 ], [ 380, 0.0 ], [ 385, 0.0 ], [ 390, 0.0 ], [ 395, 0.0 ], [ 400, 0.0 ], [ 405, 0.0 ], [ 410, 0.0 ], [ 415, 1.0 ], [ 420, 0.0 ], [ 425, 4.0 ], [ 430, 0.0 ], [ 435, 429.0 ], [ 440, 1028.0 ], [ 445, 31.0 ], [ 450, 28.0 ], [ 455, 6.0 ], [ 460, 7881.0 ], [ 465, 137141.0 ], [ 470, 5.0 ], [ 475, 6.0 ], [ 480, 1.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCMS1", "pairs": [ [ 300, 1.0 ], [ 305, 0.0 ], [ 310, 0.0 ], [ 315, 0.0 ], [ 320, 0.0 ], [ 325, 0.0 ], [ 330, 0.0 ], [ 335, 0.0 ], [ 340, 7.0 ], [ 345, 3.0 ], [ 350, 0.0 ], [ 355, 0.0 ], [ 360, 0.0 ], [ 365, 0.0 ], [ 370, 0.0 ], [ 375, 0.0 ], [ 380, 0.0 ], [ 385, 0.0 ], [ 390, 0.0 ], [ 395, 1.0 ], [ 400, 0.0 ], [ 405, 0.0 ], [ 410, 6.0 ], [ 415, 1.0 ], [ 420, 6.0 ], [ 425, 1.0 ], [ 430, 4.0 ], [ 435, 1874.0 ], [ 440, 18136.0 ], [ 445, 74.0 ], [ 450, 200.0 ], [ 455, 5.0 ], [ 460, 8191.0 ], [ 465, 127268.0 ], [ 470, 6.0 ], [ 475, 6.0 ], [ 480, 1.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCMS2", "pairs": [ [ 315, 1.0 ], [ 320, 0.0 ], [ 325, 0.0 ], [ 330, 0.0 ], [ 335, 0.0 ], [ 340, 3.0 ], [ 345, 1.0 ], [ 350, 2.0 ], [ 355, 0.0 ], [ 360, 1.0 ], [ 365, 0.0 ], [ 370, 0.0 ], [ 375, 0.0 ], [ 380, 0.0 ], [ 385, 0.0 ], [ 390, 0.0 ], [ 395, 0.0 ], [ 400, 1.0 ], [ 405, 1.0 ], [ 410, 4.0 ], [ 415, 0.0 ], [ 420, 1.0 ], [ 425, 2.0 ], [ 430, 4.0 ], [ 435, 3472.0 ], [ 440, 21477.0 ], [ 445, 180.0 ], [ 450, 392.0 ], [ 455, 12.0 ], [ 460, 5349.0 ], [ 465, 92269.0 ], [ 470, 4.0 ], [ 475, 3.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPFS1", "pairs": [ [ 315, 1.0 ], [ 320, 0.0 ], [ 325, 0.0 ], [ 330, 0.0 ], [ 335, 0.0 ], [ 340, 0.0 ], [ 345, 0.0 ], [ 350, 0.0 ], [ 355, 1.0 ], [ 360, 0.0 ], [ 365, 0.0 ], [ 370, 0.0 ], [ 375, 0.0 ], [ 380, 0.0 ], [ 385, 0.0 ], [ 390, 0.0 ], [ 395, 0.0 ], [ 400, 0.0 ], [ 405, 0.0 ], [ 410, 0.0 ], [ 415, 2.0 ], [ 420, 3.0 ], [ 425, 1.0 ], [ 430, 0.0 ], [ 435, 370.0 ], [ 440, 670.0 ], [ 445, 32.0 ], [ 450, 23.0 ], [ 455, 14.0 ], [ 460, 8036.0 ], [ 465, 217091.0 ], [ 470, 10.0 ], [ 475, 8.0 ], [ 480, 2.0 ], [ 485, 2.0 ], [ 490, 0.0 ], [ 495, 1.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPFS2", "pairs": [ [ 340, 1.0 ], [ 345, 0.0 ], [ 350, 0.0 ], [ 355, 0.0 ], [ 360, 0.0 ], [ 365, 0.0 ], [ 370, 0.0 ], [ 375, 0.0 ], [ 380, 0.0 ], [ 385, 0.0 ], [ 390, 0.0 ], [ 395, 0.0 ], [ 400, 0.0 ], [ 405, 0.0 ], [ 410, 0.0 ], [ 415, 1.0 ], [ 420, 0.0 ], [ 425, 1.0 ], [ 430, 0.0 ], [ 435, 447.0 ], [ 440, 1326.0 ], [ 445, 34.0 ], [ 450, 18.0 ], [ 455, 11.0 ], [ 460, 7677.0 ], [ 465, 185980.0 ], [ 470, 14.0 ], [ 475, 3.0 ], [ 480, 3.0 ], [ 485, 1.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPMS1", "pairs": [ [ 340, 18.0 ], [ 345, 0.0 ], [ 350, 0.0 ], [ 355, 0.0 ], [ 360, 0.0 ], [ 365, 0.0 ], [ 370, 0.0 ], [ 375, 0.0 ], [ 380, 0.0 ], [ 385, 2.0 ], [ 390, 0.0 ], [ 395, 0.0 ], [ 400, 0.0 ], [ 405, 0.0 ], [ 410, 10.0 ], [ 415, 0.0 ], [ 420, 18.0 ], [ 425, 0.0 ], [ 430, 3.0 ], [ 435, 3063.0 ], [ 440, 29428.0 ], [ 445, 268.0 ], [ 450, 3496.0 ], [ 455, 18.0 ], [ 460, 7506.0 ], [ 465, 160726.0 ], [ 470, 3.0 ], [ 475, 3.0 ], [ 480, 1.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPMS2", "pairs": [ [ 335, 1.0 ], [ 340, 10.0 ], [ 345, 0.0 ], [ 350, 1.0 ], [ 355, 0.0 ], [ 360, 0.0 ], [ 365, 0.0 ], [ 370, 0.0 ], [ 375, 0.0 ], [ 380, 0.0 ], [ 385, 0.0 ], [ 390, 0.0 ], [ 395, 0.0 ], [ 400, 0.0 ], [ 405, 0.0 ], [ 410, 2.0 ], [ 415, 0.0 ], [ 420, 5.0 ], [ 425, 1.0 ], [ 430, 2.0 ], [ 435, 1916.0 ], [ 440, 10801.0 ], [ 445, 129.0 ], [ 450, 885.0 ], [ 455, 11.0 ], [ 460, 6462.0 ], [ 465, 109486.0 ], [ 470, 3.0 ], [ 475, 2.0 ], [ 480, 2.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVFS1", "pairs": [ [ 300, 1.0 ], [ 305, 0.0 ], [ 310, 0.0 ], [ 315, 0.0 ], [ 320, 0.0 ], [ 325, 0.0 ], [ 330, 0.0 ], [ 335, 0.0 ], [ 340, 0.0 ], [ 345, 0.0 ], [ 350, 0.0 ], [ 355, 0.0 ], [ 360, 0.0 ], [ 365, 1.0 ], [ 370, 0.0 ], [ 375, 0.0 ], [ 380, 0.0 ], [ 385, 2.0 ], [ 390, 0.0 ], [ 395, 0.0 ], [ 400, 1.0 ], [ 405, 2.0 ], [ 410, 0.0 ], [ 415, 0.0 ], [ 420, 0.0 ], [ 425, 0.0 ], [ 430, 1.0 ], [ 435, 638.0 ], [ 440, 1984.0 ], [ 445, 49.0 ], [ 450, 25.0 ], [ 455, 15.0 ], [ 460, 5768.0 ], [ 465, 97222.0 ], [ 470, 2.0 ], [ 475, 1.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVFS2", "pairs": [ [ 325, 2.0 ], [ 330, 0.0 ], [ 335, 0.0 ], [ 340, 1.0 ], [ 345, 1.0 ], [ 350, 0.0 ], [ 355, 0.0 ], [ 360, 1.0 ], [ 365, 1.0 ], [ 370, 0.0 ], [ 375, 0.0 ], [ 380, 0.0 ], [ 385, 98.0 ], [ 390, 0.0 ], [ 395, 1.0 ], [ 400, 0.0 ], [ 405, 0.0 ], [ 410, 1.0 ], [ 415, 0.0 ], [ 420, 1.0 ], [ 425, 1.0 ], [ 430, 15.0 ], [ 435, 102745.0 ], [ 440, 12254.0 ], [ 445, 17.0 ], [ 450, 22.0 ], [ 455, 11.0 ], [ 460, 1761.0 ], [ 465, 27605.0 ], [ 470, 0.0 ], [ 475, 2.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVMS1", "pairs": [ [ 305, 1.0 ], [ 310, 0.0 ], [ 315, 2.0 ], [ 320, 0.0 ], [ 325, 0.0 ], [ 330, 0.0 ], [ 335, 0.0 ], [ 340, 8.0 ], [ 345, 0.0 ], [ 350, 0.0 ], [ 355, 0.0 ], [ 360, 0.0 ], [ 365, 0.0 ], [ 370, 0.0 ], [ 375, 0.0 ], [ 380, 1.0 ], [ 385, 8.0 ], [ 390, 0.0 ], [ 395, 0.0 ], [ 400, 1.0 ], [ 405, 0.0 ], [ 410, 3.0 ], [ 415, 1.0 ], [ 420, 3.0 ], [ 425, 2.0 ], [ 430, 3.0 ], [ 435, 3394.0 ], [ 440, 36474.0 ], [ 445, 233.0 ], [ 450, 430.0 ], [ 455, 32.0 ], [ 460, 16292.0 ], [ 465, 278910.0 ], [ 470, 12.0 ], [ 475, 6.0 ], [ 480, 1.0 ], [ 485, 1.0 ], [ 490, 2.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVMS2", "pairs": [ [ 340, 4.0 ], [ 345, 0.0 ], [ 350, 0.0 ], [ 355, 1.0 ], [ 360, 0.0 ], [ 365, 0.0 ], [ 370, 0.0 ], [ 375, 0.0 ], [ 380, 0.0 ], [ 385, 0.0 ], [ 390, 0.0 ], [ 395, 0.0 ], [ 400, 0.0 ], [ 405, 0.0 ], [ 410, 2.0 ], [ 415, 1.0 ], [ 420, 1.0 ], [ 425, 1.0 ], [ 430, 7.0 ], [ 435, 1617.0 ], [ 440, 21677.0 ], [ 445, 99.0 ], [ 450, 139.0 ], [ 455, 26.0 ], [ 460, 4346.0 ], [ 465, 84962.0 ], [ 470, 1.0 ], [ 475, 2.0 ], [ 480, 1.0 ] ], "color": "#f0ad4e", "width": 2, "dash": null, "showlegend": true, "marker": null } ] } ], "pconfig": { "id": "fastqc_sequence_length_distribution_plot", "title": "FastQC: Sequence Length Distribution", "anchor": null, "table_title": null, "height": null, "width": null, "square": false, "logswitch": false, "logswitch_active": false, "logswitch_label": "Log10", "cpswitch": true, "cpswitch_c_active": true, "cpswitch_counts_label": "Counts", "cpswitch_percent_label": "Percentages", "xLog": null, "yLog": null, "xlog": false, "ylog": false, "data_labels": [], "xTitle": null, "yTitle": null, "xlab": "Sequence Length (bp)", "ylab": "Read Count", "xsuffix": null, "ysuffix": null, "tt_suffix": null, "xLabFormat": null, "yLabFormat": null, "xLabelFormat": null, "yLabelFormat": null, "xlab_format": null, "ylab_format": null, "tt_label": "{point.x} bp: {point.y}", "xDecimals": null, "yDecimals": null, "decimalPlaces": null, "x_decimals": null, "y_decimals": null, "tt_decimals": null, "xmin": null, "xmax": null, "ymin": 0, "ymax": null, "xFloor": null, "xCeiling": null, "yFloor": null, "yCeiling": null, "x_clipmin": null, "x_clipmax": null, "y_clipmin": null, "y_clipmax": null, "save_data_file": true, "showlegend": false, "xMinRange": null, "yMinRange": null, "x_minrange": null, "y_minrange": null, "xPlotBands": null, "yPlotBands": null, "xPlotLines": null, "yPlotLines": null, "x_bands": null, "y_bands": null, "x_lines": null, "y_lines": null, "categories": false, "smooth_points": 500, "smooth_points_sumcounts": null, "extra_series": null, "style": null, "hide_zero_cats": false, "hide_empty": false, "colors": { "CVFS2": "#f0ad4e", "JPFS1": "#f0ad4e", "CCMS1": "#f0ad4e", "ICFS1": "#f0ad4e", "CCFS2": "#f0ad4e", "IAFS2": "#f0ad4e", "DVMS1": "#f0ad4e", "DVMS2": "#f0ad4e", "DCMS2": "#f0ad4e", "JCMS1": "#f0ad4e", "JCFS1": "#f0ad4e", "DPMS1": "#f0ad4e", "CAFS2": "#f0ad4e", "DAMS1": "#f0ad4e", "JAMS2": "#f0ad4e", "IPMS1": "#f0ad4e", "DCMS1": "#f0ad4e", "CAFS1": "#f0ad4e", "IPFS1": "#f0ad4e", "JVFS1": "#f0ad4e", "IVFS2": "#f0ad4e", "DVFS1": "#f0ad4e", "DPFS2": "#f0ad4e", "CVMS1": "#f0ad4e", "JVFS2": "#f0ad4e", "CPMS1": "#f0ad4e", "ICMS1": "#f0ad4e", "CVMS2": "#f0ad4e", "ICMS2": "#f0ad4e", "DCFS2": "#f0ad4e", "CCFS1": "#f0ad4e", "CCMS2": "#f0ad4e", "JVMS1": "#f0ad4e", "CPFS2": "#f0ad4e", "IAFS1": "#f0ad4e", "CAMS1": "#f0ad4e", "JPMS2": "#f0ad4e", "IAMS1": "#f0ad4e", "DAFS1": "#f0ad4e", "DAFS2": "#f0ad4e", "IAMS2": "#f0ad4e", "JVMS2": "#f0ad4e", "ICFS2": "#f0ad4e", "IPMS2": "#f0ad4e", "DPFS1": "#f0ad4e", "DCFS1": "#f0ad4e", "JCMS2": "#f0ad4e", "JPMS1": "#f0ad4e", "JAFS1": "#f0ad4e", "JCFS2": "#f0ad4e", "DPMS2": "#f0ad4e", "CAMS2": "#f0ad4e", "DAMS2": "#f0ad4e", "IVMS1": "#f0ad4e", "CPMS2": "#f0ad4e", "CPFS1": "#f0ad4e", "IVFS1": "#f0ad4e", "CVFS1": "#f0ad4e", "IVMS2": "#f0ad4e", "IPFS2": "#f0ad4e", "JAFS2": "#f0ad4e", "JAMS1": "#f0ad4e", "DVFS2": "#f0ad4e", "JPFS2": "#f0ad4e" } }, "add_log_tab": false, "add_pct_tab": false, "l_active": false, "p_active": false, "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "yaxis" ], "square": false, "flat": false, "defer_render": false }, "fastqc_sequence_duplication_levels_plot": { "id": "fastqc_sequence_duplication_levels_plot", "anchor": "fastqc_sequence_duplication_levels_plot", "plot_type": "xy_line", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 500, "hoverlabel": { "namelength": -1 }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "white", "plot_bgcolor": "white", "showlegend": false, "title": { "font": { "size": 20 }, "text": "FastQC: Sequence Duplication Levels", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "hoverdistance": -1 }, "datasets": [ { "plot_id": "fastqc_sequence_duplication_levels_plot", "label": "1", "uid": "fastqc_sequence_duplication_levels_plot", "dconfig": { "title": "FastQC: Sequence Duplication Levels
64 samples" }, "layout": { "title": { "text": "FastQC: Sequence Duplication Levels
64 samples" }, "xaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "Sequence Duplication Level" }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null }, "type": "category" }, "yaxis": { "hoverformat": ",.2f", "ticksuffix": "%", "title": { "text": "% of Library" }, "rangemode": "tozero", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": 0, "maxallowed": 100 } } }, "trace_params": { "hovertemplate": "%{text}
%{x}: %{y}", "mode": "lines", "line": { "width": 2 } }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "n_samples": 64, "lines": [ { "name": "CAFS1", "pairs": [ [ 1.0, 2.249187810611777 ], [ 2.0, 1.2807961638471275 ], [ 3.0, 0.8941877794336811 ], [ 4.0, 0.5811597004408583 ], [ 5.0, 0.5424988619995136 ], [ 6.0, 0.5013437759167918 ], [ 7.0, 0.38411413677206946 ], [ 8.0, 0.3242521933790196 ], [ 9.0, 0.29743903123421606 ], [ ">10", 2.447480498101254 ], [ ">50", 0.645386577206318 ], [ ">100", 13.913536905511664 ], [ ">500", 13.349836938560443 ], [ ">1k", 39.25259869426136 ], [ ">5k", 23.336180932723906 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAFS2", "pairs": [ [ 1.0, 2.399719504547937 ], [ 2.0, 1.3202165748538524 ], [ 3.0, 0.9830826180474549 ], [ 4.0, 0.6796620569216972 ], [ 5.0, 0.6371831783640912 ], [ 6.0, 0.45715364542947495 ], [ 7.0, 0.37287015622787556 ], [ 8.0, 0.285889595371825 ], [ 9.0, 0.32769420601581833 ], [ ">10", 2.3801657350531658 ], [ ">50", 0.8731769481285694 ], [ ">100", 13.243970359182516 ], [ ">500", 14.223007369748295 ], [ ">1k", 61.81620805210743 ], [ ">5k", 0.0 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAMS1", "pairs": [ [ 1.0, 2.4568998517508023 ], [ 2.0, 1.2959624713767686 ], [ 3.0, 0.7997104616605303 ], [ 4.0, 0.693221601230538 ], [ 5.0, 0.42804345859114545 ], [ 6.0, 0.44683561043173226 ], [ 7.0, 0.34591479499154354 ], [ 8.0, 0.2616981145207653 ], [ 9.0, 0.2380339233141004 ], [ ">10", 4.712654078244952 ], [ ">50", 2.5870529033874594 ], [ ">100", 13.457964740355102 ], [ ">500", 1.845806914119866 ], [ ">1k", 31.785880829917108 ], [ ">5k", 38.64432024610759 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CAMS2", "pairs": [ [ 1.0, 2.167493106210219 ], [ 2.0, 1.1861598380952962 ], [ 3.0, 0.8877856107806034 ], [ 4.0, 0.6187596681198144 ], [ 5.0, 0.5197092074128875 ], [ 6.0, 0.47690962562594386 ], [ 7.0, 0.3466766124742438 ], [ 8.0, 0.27880870421209025 ], [ 9.0, 0.2586317585125311 ], [ ">10", 3.820168385783202 ], [ ">50", 2.2628750313354082 ], [ ">100", 11.107714318905797 ], [ ">500", 4.777656172616827 ], [ ">1k", 36.48908916375731 ], [ ">5k", 34.80156279615782 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCFS1", "pairs": [ [ 1.0, 3.396312466447815 ], [ 2.0, 1.659912681181797 ], [ 3.0, 1.0275876157401909 ], [ 4.0, 0.8209299121585991 ], [ 5.0, 0.5677148408735683 ], [ 6.0, 0.5501370591896168 ], [ 7.0, 0.385761046685638 ], [ 8.0, 0.31544991994983207 ], [ 9.0, 0.23516221442043203 ], [ ">10", 3.0599592385495007 ], [ ">50", 2.9473664207360817 ], [ ">100", 14.724480148983577 ], [ ">500", 9.673955903521732 ], [ ">1k", 38.56185241314438 ], [ ">5k", 22.07341811841724 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCFS2", "pairs": [ [ 1.0, 3.7640172551330973 ], [ 2.0, 1.7204322929104572 ], [ 3.0, 1.0990239366702066 ], [ 4.0, 0.8149950968187754 ], [ 5.0, 0.6427486268552063 ], [ 6.0, 0.5365553754617374 ], [ 7.0, 0.39123829460751686 ], [ 8.0, 0.3292498894878843 ], [ 9.0, 0.3612602954103175 ], [ ">10", 3.242196828429305 ], [ ">50", 3.1537871358816325 ], [ ">100", 15.401578163822144 ], [ ">500", 7.769382808887714 ], [ ">1k", 33.9071494987577 ], [ ">5k", 26.866384500866314 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCMS1", "pairs": [ [ 1.0, 3.5325727229492205 ], [ 2.0, 1.6062051686858634 ], [ 3.0, 1.1002211228727343 ], [ 4.0, 0.8295784937168744 ], [ 5.0, 0.6153197456351521 ], [ 6.0, 0.5648193999774465 ], [ 7.0, 0.4324398531077325 ], [ 8.0, 0.35301212498590406 ], [ 9.0, 0.3132982609249898 ], [ ">10", 3.225157997440662 ], [ ">50", 2.7049554077044893 ], [ ">100", 14.87504841659353 ], [ ">500", 5.0019856932030455 ], [ ">1k", 44.50012012218142 ], [ ">5k", 20.345265470020934 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CCMS2", "pairs": [ [ 1.0, 3.5837872309284604 ], [ 2.0, 1.6779400541540777 ], [ 3.0, 0.998923191117895 ], [ 4.0, 0.7966294836544593 ], [ 5.0, 0.6899940409605554 ], [ 6.0, 0.5394498865691614 ], [ 7.0, 0.4829958286723887 ], [ 8.0, 0.3178154370484982 ], [ 9.0, 0.24933875571074615 ], [ ">10", 2.986837840945919 ], [ ">50", 3.1290184312044578 ], [ ">100", 15.076892517746437 ], [ ">500", 2.4698650329838063 ], [ ">1k", 46.179942082318384 ], [ ">5k", 20.820570185984757 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPFS1", "pairs": [ [ 1.0, 2.4933653832793765 ], [ 2.0, 1.233830292756805 ], [ 3.0, 0.8753525725639495 ], [ 4.0, 0.7391866168317796 ], [ 5.0, 0.7259868558169262 ], [ 6.0, 0.6210834919620403 ], [ 7.0, 0.5592530324714121 ], [ 8.0, 0.48352808770199107 ], [ 9.0, 0.41891873115560435 ], [ ">10", 7.023662308429785 ], [ ">50", 0.8892470578427422 ], [ ">100", 3.752900473801948 ], [ ">500", 8.765336038126467 ], [ ">1k", 16.49066985313529 ], [ ">5k", 31.052785149574134 ], [ ">10k+", 23.87489405454975 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPFS2", "pairs": [ [ 1.0, 3.9048774849745724 ], [ 2.0, 1.8192325473878872 ], [ 3.0, 1.1910540915395285 ], [ 4.0, 0.8737864077669903 ], [ 5.0, 0.5952380952380952 ], [ 6.0, 0.45076282940360607 ], [ 7.0, 0.43284789644012944 ], [ 8.0, 0.37447988904299584 ], [ 9.0, 0.20804438280166435 ], [ ">10", 3.337956541840037 ], [ ">50", 2.1365002311604253 ], [ ">100", 18.406148867313917 ], [ ">500", 12.497688395746648 ], [ ">1k", 53.77138233934351 ], [ ">5k", 0.0 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPMS1", "pairs": [ [ 1.0, 3.5189209920736384 ], [ 2.0, 1.6135807429594184 ], [ 3.0, 1.051977937684918 ], [ 4.0, 0.7908098038499469 ], [ 5.0, 0.5981298169996713 ], [ 6.0, 0.5013332359279687 ], [ 7.0, 0.4666325747890565 ], [ 8.0, 0.3871863242868101 ], [ 9.0, 0.341070971983782 ], [ ">10", 3.6600065748621105 ], [ ">50", 1.823154472732586 ], [ ">100", 13.64283887935128 ], [ ">500", 12.438360667713773 ], [ ">1k", 33.758264236402816 ], [ ">5k", 25.407732768382218 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CPMS2", "pairs": [ [ 1.0, 3.458382180539273 ], [ 2.0, 1.6948296074705906 ], [ 3.0, 1.0960302381048632 ], [ 4.0, 0.7983991591543033 ], [ 5.0, 0.583639891660266 ], [ 6.0, 0.594251526054089 ], [ 7.0, 0.40677931842988235 ], [ 8.0, 0.34765735537858267 ], [ 9.0, 0.27287059869830615 ], [ ">10", 3.3507498888304967 ], [ ">50", 1.9424344099931279 ], [ ">100", 15.053361361523224 ], [ ">500", 12.488377733759146 ], [ ">1k", 40.93665359582811 ], [ ">5k", 16.975583134575736 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVFS1", "pairs": [ [ 1.0, 3.592637276487074 ], [ 2.0, 1.6599458264286284 ], [ 3.0, 1.0646937597115749 ], [ 4.0, 0.7285735075274975 ], [ 5.0, 0.6126214093578507 ], [ 6.0, 0.5098136785920504 ], [ 7.0, 0.33518136879808846 ], [ 8.0, 0.2929316164285815 ], [ 9.0, 0.2830733408756966 ], [ ">10", 3.2490059572150845 ], [ ">50", 1.5552603288908502 ], [ ">100", 19.071068777902443 ], [ ">500", 16.476464540721718 ], [ ">1k", 27.752923448143125 ], [ ">5k", 22.815805162919737 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVFS2", "pairs": [ [ 1.0, 3.5360227963374418 ], [ 2.0, 1.6668825410742574 ], [ 3.0, 1.0850179839987246 ], [ 4.0, 0.735301443701615 ], [ 5.0, 0.5305528709635637 ], [ 6.0, 0.49318999272669306 ], [ 7.0, 0.4359002460968247 ], [ 8.0, 0.28694690485916685 ], [ 9.0, 0.2196937240327996 ], [ ">10", 3.341735829505714 ], [ ">50", 2.0295515458268154 ], [ ">100", 20.623810615042792 ], [ ">500", 8.117209839887613 ], [ ">1k", 36.11495810375921 ], [ ">5k", 20.783225562186775 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVMS1", "pairs": [ [ 1.0, 3.265963596769396 ], [ 2.0, 1.5827491567090044 ], [ 3.0, 1.065830017230638 ], [ 4.0, 0.783516958427578 ], [ 5.0, 0.6678976937885515 ], [ 6.0, 0.5219704665742461 ], [ 7.0, 0.4596707657250619 ], [ 8.0, 0.48043733267478994 ], [ 9.0, 0.34854156961570626 ], [ ">10", 3.0341638089251335 ], [ ">50", 3.2996391107419276 ], [ ">100", 13.904058460692257 ], [ ">500", 7.059510245775126 ], [ ">1k", 63.52605081635059 ], [ ">5k", 0.0 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "CVMS2", "pairs": [ [ 1.0, 3.2289363238413284 ], [ 2.0, 1.5542217609097884 ], [ 3.0, 1.04381966695248 ], [ 4.0, 0.7852339907035516 ], [ 5.0, 0.6498488198925945 ], [ 6.0, 0.5767408276546776 ], [ 7.0, 0.4770070851572724 ], [ 8.0, 0.3538065797193014 ], [ 9.0, 0.42240173293018635 ], [ ">10", 3.1526693442844893 ], [ ">50", 2.5064307956135203 ], [ ">100", 13.844036283225778 ], [ ">500", 5.229026580621869 ], [ ">1k", 66.17582020849316 ], [ ">5k", 0.0 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAFS1", "pairs": [ [ 1.0, 2.98900595510765 ], [ 2.0, 1.4406779661016949 ], [ 3.0, 0.9276225377920293 ], [ 4.0, 0.783325698579936 ], [ 5.0, 0.6928538708199725 ], [ 6.0, 0.5428309665597801 ], [ 7.0, 0.39280806229958776 ], [ 8.0, 0.43060009161704077 ], [ 9.0, 0.391662849289968 ], [ ">10", 6.814017407237746 ], [ ">50", 0.7489693082913422 ], [ ">100", 11.598717361429225 ], [ ">500", 8.207741639945029 ], [ ">1k", 24.426248282180484 ], [ ">5k", 39.61291800274851 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAFS2", "pairs": [ [ 1.0, 4.9057224292918225 ], [ 2.0, 2.367901775926332 ], [ 3.0, 1.5950449462837097 ], [ 4.0, 1.1401008550756413 ], [ 5.0, 0.9181100635825477 ], [ 6.0, 0.6906380179785134 ], [ 7.0, 0.46042534531900897 ], [ 8.0, 0.6139004604253453 ], [ 9.0, 0.5426441569831177 ], [ ">10", 7.860118395088795 ], [ ">50", 4.719359789519842 ], [ ">100", 15.953190089892566 ], [ ">500", 14.423920192940146 ], [ ">1k", 43.80892348169262 ], [ ">5k", 0.0 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAMS1", "pairs": [ [ 1.0, 2.488014950840985 ], [ 2.0, 1.0498090517591616 ], [ 3.0, 0.892175184854148 ], [ 4.0, 0.7800438774681075 ], [ 5.0, 0.536280165759324 ], [ 6.0, 0.5752823596327293 ], [ 7.0, 0.5232794344681889 ], [ 8.0, 0.4290241326074592 ], [ 9.0, 0.4972779718859186 ], [ ">10", 8.167709433655643 ], [ ">50", 2.2913788900625662 ], [ ">100", 5.435930771105875 ], [ ">500", 2.6407735435118225 ], [ ">1k", 15.347363289185017 ], [ ">5k", 58.34565694320305 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DAMS2", "pairs": [ [ 1.0, 1.723718104807187 ], [ 2.0, 0.7023029899140064 ], [ 3.0, 0.5574850376142203 ], [ 4.0, 0.6049033051814069 ], [ 5.0, 0.4293275577029053 ], [ 6.0, 0.37678299093926615 ], [ 7.0, 0.4664932268771867 ], [ 8.0, 0.32808314857296644 ], [ 9.0, 0.32295684937651387 ], [ ">10", 7.695856668674467 ], [ ">50", 0.3460251957605505 ], [ ">100", 3.978008176447218 ], [ ">500", 0.0 ], [ ">1k", 0.0 ], [ ">5k", 82.4680567481321 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCFS1", "pairs": [ [ 1.0, 2.733475406455161 ], [ 2.0, 1.2030385316055408 ], [ 3.0, 1.0208641253909876 ], [ 4.0, 0.8730622486508781 ], [ 5.0, 0.7647887808063796 ], [ 6.0, 0.5774584951706596 ], [ 7.0, 0.6376104217509367 ], [ 8.0, 0.5362114598013268 ], [ 9.0, 0.4794967861684941 ], [ ">10", 6.3649331454301725 ], [ ">50", 0.8618911765716839 ], [ ">100", 5.492730210016155 ], [ ">500", 0.0 ], [ ">1k", 54.64802529818169 ], [ ">5k", 23.806413913999933 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCFS2", "pairs": [ [ 1.0, 3.830449453783455 ], [ 2.0, 1.8643780527264602 ], [ 3.0, 1.5069105252615522 ], [ 4.0, 1.3189319116808678 ], [ 5.0, 1.063157732546494 ], [ 6.0, 0.8967504352783471 ], [ 7.0, 0.7118534383137394 ], [ 8.0, 0.6039968567510515 ], [ 9.0, 0.651761914300242 ], [ ">10", 4.4359871188425455 ], [ ">50", 1.272707662439716 ], [ ">100", 3.18176915609929 ], [ ">500", 5.432890094143388 ], [ ">1k", 73.22845564783286 ], [ ">5k", 0.0 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCMS1", "pairs": [ [ 1.0, 2.3018123589152606 ], [ 2.0, 0.9616422155753236 ], [ 3.0, 0.7134625594012612 ], [ 4.0, 0.688860402180528 ], [ 5.0, 0.6193700984517906 ], [ 6.0, 0.6008105763379042 ], [ 7.0, 0.5257092542956661 ], [ 8.0, 0.44888146508004334 ], [ 9.0, 0.40010876743192325 ], [ ">10", 7.747089823770863 ], [ ">50", 1.4998683568780293 ], [ ">100", 4.779724369515769 ], [ ">500", 1.0721361146719497 ], [ ">1k", 13.819938106151833 ], [ ">5k", 54.168770798534226 ], [ ">10k+", 9.651814732807624 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DCMS2", "pairs": [ [ 1.0, 3.6927793390157233 ], [ 2.0, 1.8022621176579883 ], [ 3.0, 1.341245325963258 ], [ 4.0, 1.147316348096709 ], [ 5.0, 0.917388577931579 ], [ 6.0, 0.8570035069791208 ], [ 7.0, 0.7722321573727849 ], [ 8.0, 0.8268109715028915 ], [ 9.0, 0.5957219499732912 ], [ ">10", 5.599554079476043 ], [ ">50", 1.6919432380333048 ], [ ">100", 6.77474046032004 ], [ ">500", 0.0 ], [ ">1k", 73.98100192767727 ], [ ">5k", 0.0 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPFS1", "pairs": [ [ 1.0, 2.531608415213132 ], [ 2.0, 1.295889988772867 ], [ 3.0, 1.0060391702194793 ], [ 4.0, 0.8717538542820872 ], [ 5.0, 0.8071794947056362 ], [ 6.0, 0.6736279783088855 ], [ 7.0, 0.5855720334319071 ], [ 8.0, 0.4989836876362116 ], [ 9.0, 0.5481482568591912 ], [ ">10", 5.7551897972511865 ], [ ">50", 1.2247114333306428 ], [ ">100", 4.832803774664837 ], [ ">500", 0.6340028031142453 ], [ ">1k", 52.65085084056737 ], [ ">5k", 26.083638471642317 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPFS2", "pairs": [ [ 1.0, 2.854188378048682 ], [ 2.0, 1.4412318331273277 ], [ 3.0, 1.1560553549356536 ], [ 4.0, 0.9759013757947376 ], [ 5.0, 0.8886519150448768 ], [ 6.0, 0.8531058384430819 ], [ 7.0, 0.6333664558138031 ], [ 8.0, 0.6786069169433606 ], [ 9.0, 0.5598507064782724 ], [ ">10", 5.800473409111106 ], [ ">50", 0.0888651915044877 ], [ ">100", 3.808277388655954 ], [ ">500", 0.0 ], [ ">1k", 70.96127901246535 ], [ ">5k", 9.300146223633293 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPMS1", "pairs": [ [ 1.0, 4.217057391830712 ], [ 2.0, 2.0454746081188446 ], [ 3.0, 1.2900866363166323 ], [ 4.0, 1.0895746371237247 ], [ 5.0, 0.9016734554901195 ], [ 6.0, 0.824747468378375 ], [ 7.0, 0.5296543374906995 ], [ 8.0, 0.6557625130837231 ], [ 9.0, 0.43128996052814106 ], [ ">10", 5.870335573855253 ], [ ">50", 4.09851570677327 ], [ ">100", 11.577991601195507 ], [ ">500", 6.788403092172465 ], [ ">1k", 59.67943301764254 ], [ ">5k", 0.0 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DPMS2", "pairs": [ [ 1.0, 4.847617099611372 ], [ 2.0, 2.2331043278428164 ], [ 3.0, 1.4077220170129823 ], [ 4.0, 0.9721704185867434 ], [ 5.0, 0.7158928206177132 ], [ 6.0, 0.6208415049390589 ], [ 7.0, 0.6232478673613033 ], [ 8.0, 0.3465161888031957 ], [ 9.0, 0.4764597596043941 ], [ ">10", 5.912432471454525 ], [ ">50", 2.527883724567757 ], [ ">100", 13.88471117635027 ], [ ">500", 19.674419164270333 ], [ ">1k", 45.756981458977535 ], [ ">5k", 0.0 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVFS1", "pairs": [ [ 1.0, 4.607278164056263 ], [ 2.0, 1.997358145476187 ], [ 3.0, 1.2236721777881 ], [ 4.0, 1.1206108199910003 ], [ 5.0, 0.8636832097080895 ], [ 6.0, 0.679334020409052 ], [ 7.0, 0.4775660100738848 ], [ 8.0, 0.6154650099432436 ], [ 9.0, 0.4049875890900117 ], [ ">10", 9.250845538604462 ], [ ">50", 3.970039627817857 ], [ ">100", 9.324875528008013 ], [ ">500", 9.52083726466447 ], [ ">1k", 48.57673716450625 ], [ ">5k", 7.366709729863118 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVFS2", "pairs": [ [ 1.0, 3.7897616909292173 ], [ 2.0, 1.6750558700056393 ], [ 3.0, 1.2312287224043945 ], [ 4.0, 1.0025272039934001 ], [ 5.0, 0.8824327993483573 ], [ 6.0, 0.7393638129451325 ], [ 7.0, 0.6725286660122393 ], [ 8.0, 0.5597443555629817 ], [ 9.0, 0.592117629858602 ], [ ">10", 7.799870506902817 ], [ ">50", 1.9507508511038243 ], [ ">100", 8.970529877399278 ], [ ">500", 8.998725955011592 ], [ ">1k", 55.03456630255435 ], [ ">5k", 6.10079575596817 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVMS1", "pairs": [ [ 1.0, 4.218834194427715 ], [ 2.0, 1.9943579828203748 ], [ 3.0, 1.2494849282069163 ], [ 4.0, 0.9864021046625884 ], [ 5.0, 0.7321943643221654 ], [ 6.0, 0.5248977780595265 ], [ 7.0, 0.4570667850011094 ], [ 8.0, 0.3955751370883388 ], [ 9.0, 0.35373545912707216 ], [ ">10", 5.407461409236427 ], [ ">50", 3.636882310057371 ], [ ">100", 14.15385590668484 ], [ ">500", 13.790611429839297 ], [ ">1k", 48.43576658531173 ], [ ">5k", 3.6628736251545218 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "DVMS2", "pairs": [ [ 1.0, 3.8990795828831053 ], [ 2.0, 1.7405907854139275 ], [ 3.0, 1.0506034134846967 ], [ 4.0, 0.9191152539283715 ], [ 5.0, 0.8104096962753702 ], [ 6.0, 0.6209886347363076 ], [ 7.0, 0.47387811958913206 ], [ 8.0, 0.46346321586189837 ], [ 9.0, 0.35736138414070534 ], [ ">10", 6.515173212867613 ], [ ">50", 1.7933162355330479 ], [ ">100", 16.883209873328735 ], [ ">500", 3.8242224623436134 ], [ ">1k", 33.52687696093109 ], [ ">5k", 27.12171116868238 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAFS1", "pairs": [ [ 1.0, 0.9083042289997447 ], [ 2.0, 0.4146200250266141 ], [ 3.0, 0.3361783986702277 ], [ 4.0, 0.3635707126359499 ], [ 5.0, 0.28948695441047384 ], [ 6.0, 0.3175018209663262 ], [ 7.0, 0.3050507691637251 ], [ 8.0, 0.2789035603782629 ], [ 9.0, 0.3305754253590572 ], [ ">10", 4.73887031606995 ], [ ">50", 0.15003517422134235 ], [ ">100", 2.7952611296839303 ], [ ">500", 0.0 ], [ ">1k", 0.0 ], [ ">5k", 68.90163046523355 ], [ ">10k+", 19.870011019180843 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAFS2", "pairs": [ [ 1.0, 1.146040079390486 ], [ 2.0, 0.5410077469748383 ], [ 3.0, 0.32412446379409693 ], [ 4.0, 0.2721044881234394 ], [ 5.0, 0.21208143927268072 ], [ 6.0, 0.24969588321915615 ], [ 7.0, 0.19047314168640758 ], [ 8.0, 0.22408604904283247 ], [ 9.0, 0.25929957103527757 ], [ ">10", 5.616556757794993 ], [ ">50", 0.5017926883923427 ], [ ">100", 2.445739163838914 ], [ ">500", 4.578558166335873 ], [ ">1k", 0.8219156155963889 ], [ ">5k", 7.080318842435496 ], [ ">10k+", 75.53620590306677 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAMS1", "pairs": [ [ 1.0, 1.0593091520797726 ], [ 2.0, 0.4999290641192804 ], [ 3.0, 0.36683984029293143 ], [ 4.0, 0.33508758892319335 ], [ 5.0, 0.2972551192060586 ], [ 6.0, 0.3121178751663615 ], [ 7.0, 0.35940846231277995 ], [ 8.0, 0.3621107815782896 ], [ 9.0, 0.32833179075941926 ], [ ">10", 5.684328574999493 ], [ ">50", 0.36683984029293143 ], [ ">100", 2.040926625276143 ], [ ">500", 0.0 ], [ ">1k", 20.57140540869201 ], [ ">5k", 9.139919335769925 ], [ ">10k+", 58.27619054053142 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IAMS2", "pairs": [ [ 1.0, 1.7990337773645166 ], [ 2.0, 1.0053027699729808 ], [ 3.0, 0.7701481676133493 ], [ 4.0, 0.5983303349437044 ], [ 5.0, 0.49860861245308696 ], [ 6.0, 0.45683329627458513 ], [ 7.0, 0.4716567955637309 ], [ 8.0, 0.409667616718212 ], [ 9.0, 0.4669402276080936 ], [ ">10", 4.040751147136707 ], [ ">50", 1.2202435096655952 ], [ ">100", 5.807442744233995 ], [ ">500", 4.922075559418649 ], [ ">1k", 40.445917810434395 ], [ ">5k", 37.0870476305984 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICFS1", "pairs": [ [ 1.0, 3.510337646883831 ], [ 2.0, 1.7640934106797561 ], [ 3.0, 1.2695225345827756 ], [ 4.0, 1.0679756061282166 ], [ 5.0, 0.8403986315632902 ], [ 6.0, 0.7987505577867025 ], [ 7.0, 0.8121374386434628 ], [ 8.0, 0.48787743566860037 ], [ 9.0, 0.5823293172690763 ], [ ">10", 5.493083444890674 ], [ ">50", 1.6265060240963853 ], [ ">100", 6.176558084188606 ], [ ">500", 8.813773612970401 ], [ ">1k", 34.397590361445786 ], [ ">5k", 32.35906589320244 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICFS2", "pairs": [ [ 1.0, 4.176193839560413 ], [ 2.0, 1.93097338776292 ], [ 3.0, 1.362934409155663 ], [ 4.0, 0.9936192881855075 ], [ 5.0, 0.7601786120455389 ], [ 6.0, 0.6715908682796021 ], [ 7.0, 0.5782145978236146 ], [ 8.0, 0.38787066189410174 ], [ 9.0, 0.339386829157339 ], [ ">10", 4.470089665162271 ], [ ">50", 3.200531526462596 ], [ ">100", 10.482084924520848 ], [ ">500", 10.298325212790155 ], [ ">1k", 50.09098200711096 ], [ ">5k", 10.257024170088467 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICMS1", "pairs": [ [ 1.0, 1.916539180690124 ], [ 2.0, 0.8509688934217237 ], [ 3.0, 0.7171086180520142 ], [ 4.0, 0.6353051164371919 ], [ 5.0, 0.6666454190039096 ], [ 6.0, 0.5354411014788374 ], [ 7.0, 0.49825769165391803 ], [ 8.0, 0.45045045045045046 ], [ 9.0, 0.48285313615502296 ], [ ">10", 6.29727604963454 ], [ ">50", 0.644335373108958 ], [ ">100", 2.187978072412035 ], [ ">500", 2.7037650858405575 ], [ ">1k", 16.243306986231516 ], [ ">5k", 58.652579466258715 ], [ ">10k+", 6.517189359170492 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "ICMS2", "pairs": [ [ 1.0, 2.4243074586456235 ], [ 2.0, 1.1968831511869777 ], [ 3.0, 0.9409977878297618 ], [ 4.0, 0.7065737775283125 ], [ 5.0, 0.6727308746326808 ], [ 6.0, 0.5695512926338033 ], [ 7.0, 0.5373592630501536 ], [ 8.0, 0.4886585003466834 ], [ 9.0, 0.4160200746194737 ], [ ">10", 6.1684881302208865 ], [ ">50", 1.1754217981312114 ], [ ">100", 4.2064251989302335 ], [ ">500", 1.3867335820649123 ], [ ">1k", 27.764387360913922 ], [ ">5k", 42.08736421567009 ], [ ">10k+", 9.258097533595272 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPFS1", "pairs": [ [ 1.0, 2.1387651997963695 ], [ 2.0, 0.936958300844809 ], [ 3.0, 0.6186244627310982 ], [ 4.0, 0.435614725839815 ], [ 5.0, 0.4285263205376878 ], [ 6.0, 0.34024345450210397 ], [ 7.0, 0.32026703955974556 ], [ 8.0, 0.2577601928046242 ], [ 9.0, 0.3073790299195144 ], [ ">10", 6.577395719891999 ], [ ">50", 2.403613797903121 ], [ ">100", 4.642905472893294 ], [ ">500", 7.290747053478796 ], [ ">1k", 2.2296256677599993 ], [ ">5k", 0.0 ], [ ">10k+", 71.07157356153702 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPFS2", "pairs": [ [ 1.0, 3.4378949787429622 ], [ 2.0, 1.6867746753992874 ], [ 3.0, 1.0382626680455016 ], [ 4.0, 0.7813397678961278 ], [ 5.0, 0.6342640468803861 ], [ 6.0, 0.5432609445018959 ], [ 7.0, 0.39250833046076067 ], [ 8.0, 0.3382741583362059 ], [ 9.0, 0.30610134436401243 ], [ ">10", 3.3818223601057107 ], [ ">50", 1.196369068137424 ], [ ">100", 17.251522463518327 ], [ ">500", 9.563598759048604 ], [ ">1k", 40.62966793059864 ], [ ">5k", 18.81833850396415 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPMS1", "pairs": [ [ 1.0, 1.9238022258275014 ], [ 2.0, 0.7620974742425421 ], [ 3.0, 0.491202653272589 ], [ 4.0, 0.3568029023162255 ], [ 5.0, 0.3352510491561851 ], [ 6.0, 0.2891540298972096 ], [ 7.0, 0.21581786289429414 ], [ 8.0, 0.2418596854626764 ], [ 9.0, 0.2424583480504553 ], [ ">10", 5.369404749788972 ], [ ">50", 3.419560701393088 ], [ ">100", 7.478493046534044 ], [ ">500", 3.5297146175444056 ], [ ">1k", 11.080346505905807 ], [ ">5k", 4.447165033315573 ], [ ">10k+", 59.81686911439843 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IPMS2", "pairs": [ [ 1.0, 2.5291499551539154 ], [ 2.0, 1.106767528049957 ], [ 3.0, 0.8491140782860334 ], [ 4.0, 0.7259988830786414 ], [ 5.0, 0.5478837724865039 ], [ 6.0, 0.5127684418947047 ], [ 7.0, 0.47384542485319253 ], [ 8.0, 0.40953783148025924 ], [ 9.0, 0.3312687211250444 ], [ ">10", 6.063106056759913 ], [ ">50", 2.81303413379364 ], [ ">100", 6.726489651554382 ], [ ">500", 7.000219999661539 ], [ ">1k", 18.357702526611497 ], [ ">5k", 41.64974361577905 ], [ ">10k+", 9.903369379431725 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVFS1", "pairs": [ [ 1.0, 1.6042128653174776 ], [ 2.0, 0.6855842144008816 ], [ 3.0, 0.45931432545829814 ], [ 4.0, 0.4317644986608977 ], [ 5.0, 0.39066557671723495 ], [ 6.0, 0.2980800932177746 ], [ 7.0, 0.290853909139768 ], [ 8.0, 0.29988663923727626 ], [ 9.0, 0.3129840978786633 ], [ ">10", 5.552419190938365 ], [ ">50", 2.735562310030395 ], [ ">100", 2.8164052444030947 ], [ ">500", 2.1768879534995054 ], [ ">1k", 12.695502152047947 ], [ ">5k", 11.355948278587462 ], [ ">10k+", 57.893928650464964 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVFS2", "pairs": [ [ 1.0, 1.8254174940590513 ], [ 2.0, 0.5827012598066343 ], [ 3.0, 0.4516748592076565 ], [ 4.0, 0.36785051596731666 ], [ 5.0, 0.3784302874442527 ], [ 6.0, 0.39552068752238023 ], [ 7.0, 0.29623360135421073 ], [ 8.0, 0.3450633158631466 ], [ 9.0, 0.34424948728799765 ], [ ">10", 8.002376379439436 ], [ ">50", 2.4341612682704517 ], [ ">100", 3.796510303069761 ], [ ">500", 0.0 ], [ ">1k", 0.0 ], [ ">5k", 7.171457404212377 ], [ ">10k+", 73.60835313649532 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVMS1", "pairs": [ [ 1.0, 2.7272241731536995 ], [ 2.0, 1.3339030349965952 ], [ 3.0, 1.107580147677353 ], [ 4.0, 0.9827353691266206 ], [ 5.0, 0.9380048869720803 ], [ 6.0, 0.8612286862590629 ], [ 7.0, 0.7103467613795681 ], [ 8.0, 0.6729600897280119 ], [ 9.0, 0.534762928444581 ], [ ">10", 6.67418850893942 ], [ ">50", 1.5862630686445995 ], [ ">100", 1.9621326425700667 ], [ ">500", 0.0 ], [ ">1k", 52.3239822146262 ], [ ">5k", 27.58468748748214 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "IVMS2", "pairs": [ [ 1.0, 2.50748185002313 ], [ 2.0, 1.0063914352878978 ], [ 3.0, 0.7278872388433107 ], [ 4.0, 0.6608574152922405 ], [ 5.0, 0.5570083928891743 ], [ 6.0, 0.4701528468793369 ], [ 7.0, 0.46920876485749086 ], [ 8.0, 0.3474221840393493 ], [ 9.0, 0.2803923604882792 ], [ ">10", 7.004144520075904 ], [ ">50", 1.3292674867592498 ], [ ">100", 3.750837872794388 ], [ ">500", 11.887880819085563 ], [ ">1k", 5.0517828988982565 ], [ ">5k", 31.263276153432212 ], [ ">10k+", 32.686007760354215 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAFS1", "pairs": [ [ 1.0, 1.8714364183538477 ], [ 2.0, 0.9438414346389806 ], [ 3.0, 0.7218066053427614 ], [ 4.0, 0.535359239975553 ], [ 5.0, 0.48352532512242863 ], [ 6.0, 0.3667056065728499 ], [ 7.0, 0.4278232076683248 ], [ 8.0, 0.40848219466342767 ], [ 9.0, 0.36206376345167457 ], [ ">10", 5.745828143494844 ], [ ">50", 0.3148716917197255 ], [ ">100", 3.4798350598410943 ], [ ">500", 6.700500545416567 ], [ ">1k", 25.017987142094555 ], [ ">5k", 26.72231720808609 ], [ ">10k+", 25.89761641355728 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAFS2", "pairs": [ [ 1.0, 2.2932490733426505 ], [ 2.0, 1.2444552470073524 ], [ 3.0, 0.7583399161451054 ], [ 4.0, 0.6270887768122987 ], [ 5.0, 0.6015677219420307 ], [ 6.0, 0.5031293674424256 ], [ 7.0, 0.30625265844321564 ], [ 8.0, 0.3791699580725527 ], [ 9.0, 0.2515646837212128 ], [ ">10", 4.85872273196816 ], [ ">50", 0.52135869234976 ], [ ">100", 7.523850033420429 ], [ ">500", 14.735370966761865 ], [ ">1k", 5.5453606368110835 ], [ ">5k", 59.85051953575986 ], [ ">10k+", 0.0 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAMS1", "pairs": [ [ 1.0, 0.9524346611024432 ], [ 2.0, 0.3521501839076138 ], [ 3.0, 0.22557663026110497 ], [ 4.0, 0.17294208320018045 ], [ 5.0, 0.2443746827828637 ], [ 6.0, 0.19549974622629093 ], [ 7.0, 0.22808303726400614 ], [ 8.0, 0.16041004818567464 ], [ 9.0, 0.15226422542624585 ], [ ">10", 5.66260002130446 ], [ ">50", 2.3290787074459085 ], [ ">100", 1.5057240069928755 ], [ ">500", 0.0 ], [ ">1k", 0.0 ], [ ">5k", 0.0 ], [ ">10k+", 87.81886196590033 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JAMS2", "pairs": [ [ 1.0, 1.6437061892554692 ], [ 2.0, 0.6558151490520553 ], [ 3.0, 0.45017819553573285 ], [ 4.0, 0.3418019632771305 ], [ 5.0, 0.2883085665853845 ], [ 6.0, 0.30011879702382194 ], [ 7.0, 0.3355494883391342 ], [ 8.0, 0.24454124201941044 ], [ 9.0, 0.3063712719618182 ], [ ">10", 6.448385819386841 ], [ ">50", 1.3241352479801032 ], [ ">100", 1.9959289440959267 ], [ ">500", 0.0 ], [ ">1k", 0.0 ], [ ">5k", 0.0 ], [ ">10k+", 85.66515912548716 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCFS1", "pairs": [ [ 1.0, 1.4845926040095558 ], [ 2.0, 0.4271575308533242 ], [ 3.0, 0.2889918862087567 ], [ 4.0, 0.26642299604769193 ], [ 5.0, 0.23669811632336266 ], [ 6.0, 0.19156033600123304 ], [ 7.0, 0.20422093292085478 ], [ 8.0, 0.22018429425429087 ], [ 9.0, 0.16348683848381096 ], [ ">10", 6.160756553235058 ], [ ">50", 4.843504012858762 ], [ ">100", 3.131020664296016 ], [ ">500", 0.0 ], [ ">1k", 0.0 ], [ ">5k", 0.0 ], [ ">10k+", 82.38140323450727 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCFS2", "pairs": [ [ 1.0, 1.6777653448322918 ], [ 2.0, 0.4680549111650883 ], [ 3.0, 0.3131737670915095 ], [ 4.0, 0.21560546928304358 ], [ 5.0, 0.28656423132556424 ], [ 6.0, 0.31112687972489833 ], [ 7.0, 0.28656423132556424 ], [ 8.0, 0.2456264839933408 ], [ 9.0, 0.23334515979367376 ], [ ">10", 7.243934390436942 ], [ ">50", 4.359870090881799 ], [ ">100", 1.9500013645915777 ], [ ">500", 0.0 ], [ ">1k", 0.0 ], [ ">5k", 0.0 ], [ ">10k+", 82.4083676755547 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCMS1", "pairs": [ [ 1.0, 2.4102804398200153 ], [ 2.0, 0.8524240809802877 ], [ 3.0, 0.51222471131195 ], [ 4.0, 0.43904975255309997 ], [ 5.0, 0.36587479379425003 ], [ 6.0, 0.38898267550757104 ], [ 7.0, 0.39540153153904917 ], [ 8.0, 0.32351034398649475 ], [ 9.0, 0.3581721665564763 ], [ ">10", 8.279040509400415 ], [ ">50", 3.192097104454044 ], [ ">100", 5.094004146580996 ], [ ">500", 0.9044168148352602 ], [ ">1k", 5.583120976179625 ], [ ">5k", 6.29882342368943 ], [ ">10k+", 64.60257652881104 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JCMS2", "pairs": [ [ 1.0, 3.2400003247306763 ], [ 2.0, 1.3589978811323358 ], [ 3.0, 0.8645954261684216 ], [ 4.0, 0.6656978868151228 ], [ 5.0, 0.6088700184284659 ], [ 6.0, 0.47735409444791727 ], [ 7.0, 0.43757458657725745 ], [ 8.0, 0.38967681179421815 ], [ 9.0, 0.4383864132684955 ], [ ">10", 7.882837171920539 ], [ ">50", 2.624635692772307 ], [ ">100", 10.428725675642763 ], [ ">500", 5.819985549484896 ], [ ">1k", 9.399329431153038 ], [ ">5k", 26.653082100033288 ], [ ">10k+", 28.71025093563026 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPFS1", "pairs": [ [ 1.0, 1.2361502119177785 ], [ 2.0, 0.4649374411646418 ], [ 3.0, 0.3182081346373974 ], [ 4.0, 0.2298169861270092 ], [ 5.0, 0.17899207573353604 ], [ 6.0, 0.2280491631568015 ], [ 7.0, 0.15468450989317928 ], [ 8.0, 0.09899808633163476 ], [ 9.0, 0.15114886395276378 ], [ ">10", 4.165874829294594 ], [ ">50", 3.902027250991086 ], [ ">100", 2.421475513442084 ], [ ">500", 2.909394653219427 ], [ ">1k", 2.1532083777130557 ], [ ">5k", 3.8025872089168993 ], [ ">10k+", 77.58444669350811 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPFS2", "pairs": [ [ 1.0, 1.5446227182291055 ], [ 2.0, 0.5851153608126148 ], [ 3.0, 0.431164553465939 ], [ 4.0, 0.3396124122199093 ], [ 5.0, 0.24806027097387953 ], [ 6.0, 0.2516405223075231 ], [ 7.0, 0.23987683935412263 ], [ 8.0, 0.2782366750717329 ], [ 9.0, 0.18412721144452912 ], [ ">10", 4.931029015379737 ], [ ">50", 3.49279090820747 ], [ ">100", 2.5368638021246235 ], [ ">500", 2.3026130720090836 ], [ ">1k", 7.316499332538859 ], [ ">5k", 2.9260882685393086 ], [ ">10k+", 72.39165903732156 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPMS1", "pairs": [ [ 1.0, 2.589422329551287 ], [ 2.0, 1.070574835136364 ], [ 3.0, 0.7303373532848071 ], [ 4.0, 0.6355010436882526 ], [ 5.0, 0.535287417568182 ], [ 6.0, 0.47515924189613956 ], [ 7.0, 0.45511651667212544 ], [ 8.0, 0.3637021357723538 ], [ 9.0, 0.3035739601003114 ], [ ">10", 7.760934284303612 ], [ ">50", 1.4362323587354506 ], [ ">100", 9.083754149088545 ], [ ">500", 4.703685417206435 ], [ ">1k", 7.867014073903883 ], [ ">5k", 34.28234822524112 ], [ ">10k+", 27.70735665785113 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JPMS2", "pairs": [ [ 1.0, 2.98645533807692 ], [ 2.0, 1.1070082254719817 ], [ 3.0, 0.7978784912002096 ], [ 4.0, 0.592048967383344 ], [ 5.0, 0.7708970929470625 ], [ 6.0, 0.6706804708639443 ], [ 7.0, 0.4856651685566493 ], [ 8.0, 0.6043833208704971 ], [ 9.0, 0.5064793900662201 ], [ ">10", 7.730556048073142 ], [ ">50", 2.358174207325064 ], [ ">100", 7.805333066089008 ], [ ">500", 0.5064793900662201 ], [ ">1k", 24.72344066790524 ], [ ">5k", 40.09821228964145 ], [ ">10k+", 8.25630786546304 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVFS1", "pairs": [ [ 1.0, 2.170046919933404 ], [ 2.0, 0.9270470712880279 ], [ 3.0, 0.5448766459815347 ], [ 4.0, 0.49190252762221887 ], [ 5.0, 0.3878462237021341 ], [ 6.0, 0.431360678068715 ], [ 7.0, 0.4039276524897836 ], [ 8.0, 0.5675798395640987 ], [ 9.0, 0.4767670652338429 ], [ ">10", 7.996253973058877 ], [ ">50", 2.1028833055849856 ], [ ">100", 1.8786892689571666 ], [ ">500", 4.324012411079158 ], [ ">1k", 0.0 ], [ ">5k", 24.443771757227182 ], [ ">10k+", 52.85303466020886 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVFS2", "pairs": [ [ 1.0, 2.325999723259997 ], [ 2.0, 1.0004151100041512 ], [ 3.0, 0.7783312577833126 ], [ 4.0, 0.542410405424104 ], [ 5.0, 0.5500207555002076 ], [ 6.0, 0.5603985056039851 ], [ 7.0, 0.474609104746091 ], [ 8.0, 0.33208800332088 ], [ 9.0, 0.386052303860523 ], [ ">10", 6.023246160232461 ], [ ">50", 2.289331672893317 ], [ ">100", 3.2260965822609657 ], [ ">500", 7.546699875466999 ], [ ">1k", 17.700982427009823 ], [ ">5k", 12.743185277431854 ], [ ">10k+", 43.52013283520133 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVMS1", "pairs": [ [ 1.0, 1.897445059853493 ], [ 2.0, 0.6479661723542374 ], [ 3.0, 0.3725209933893157 ], [ 4.0, 0.30016080042880117 ], [ 5.0, 0.2739562861056518 ], [ 6.0, 0.20725388601036268 ], [ 7.0, 0.204276100291823 ], [ 8.0, 0.20487165743553093 ], [ 9.0, 0.19296051456137217 ], [ ">10", 5.332023107617176 ], [ ">50", 4.0232862843189805 ], [ ">100", 6.354892501935561 ], [ ">500", 2.794354118277649 ], [ ">1k", 4.918706449883866 ], [ ">5k", 0.0 ], [ ">10k+", 72.27532606753618 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null }, { "name": "JVMS2", "pairs": [ [ 1.0, 3.2191483518917146 ], [ 2.0, 1.1338772400719304 ], [ 3.0, 0.8158601078955061 ], [ 4.0, 0.5740253527864148 ], [ 5.0, 0.6156599076953059 ], [ 6.0, 0.5687103032235775 ], [ 7.0, 0.5146739660013997 ], [ 8.0, 0.46772436152967123 ], [ 9.0, 0.5182173323766244 ], [ ">10", 8.21706662414627 ], [ ">50", 4.42389291946814 ], [ ">100", 7.477388893318097 ], [ ">500", 1.8824133868381654 ], [ ">1k", 13.180437074242384 ], [ ">5k", 35.68967197285781 ], [ ">10k+", 20.701232205656982 ] ], "color": "#d9534f", "width": 2, "dash": null, "showlegend": true, "marker": null } ] } ], "pconfig": { "id": "fastqc_sequence_duplication_levels_plot", "title": "FastQC: Sequence Duplication Levels", "anchor": null, "table_title": null, "height": null, "width": null, "square": false, "logswitch": false, "logswitch_active": false, "logswitch_label": "Log10", "cpswitch": true, "cpswitch_c_active": true, "cpswitch_counts_label": "Counts", "cpswitch_percent_label": "Percentages", "xLog": null, "yLog": null, "xlog": false, "ylog": false, "data_labels": [], "xTitle": null, "yTitle": null, "xlab": "Sequence Duplication Level", "ylab": "% of Library", "xsuffix": null, "ysuffix": null, "tt_suffix": "%", "xLabFormat": null, "yLabFormat": null, "xLabelFormat": null, "yLabelFormat": null, "xlab_format": null, "ylab_format": null, "tt_label": null, "xDecimals": null, "yDecimals": null, "decimalPlaces": null, "x_decimals": null, "y_decimals": null, "tt_decimals": 2, "xmin": null, "xmax": null, "ymin": 0, "ymax": 100, "xFloor": null, "xCeiling": null, "yFloor": null, "yCeiling": null, "x_clipmin": null, "x_clipmax": null, "y_clipmin": null, "y_clipmax": null, "save_data_file": true, "showlegend": false, "xMinRange": null, "yMinRange": null, "x_minrange": null, "y_minrange": null, "xPlotBands": null, "yPlotBands": null, "xPlotLines": null, "yPlotLines": null, "x_bands": null, "y_bands": null, "x_lines": null, "y_lines": null, "categories": true, "smooth_points": 500, "smooth_points_sumcounts": null, "extra_series": null, "style": null, "hide_zero_cats": false, "hide_empty": false, "colors": { "CVFS2": "#d9534f", "JPFS1": "#d9534f", "CCMS1": "#d9534f", "ICFS1": "#d9534f", "CCFS2": "#d9534f", "IAFS2": "#d9534f", "DVMS1": "#d9534f", "DVMS2": "#d9534f", "DCMS2": "#d9534f", "JCMS1": "#d9534f", "JCFS1": "#d9534f", "DPMS1": "#d9534f", "CAFS2": "#d9534f", "DAMS1": "#d9534f", "JAMS2": "#d9534f", "IPMS1": "#d9534f", "DCMS1": "#d9534f", "CAFS1": "#d9534f", "IPFS1": "#d9534f", "JVFS1": "#d9534f", "IVFS2": "#d9534f", "DVFS1": "#d9534f", "DPFS2": "#d9534f", "CVMS1": "#d9534f", "JVFS2": "#d9534f", "CPMS1": "#d9534f", "ICMS1": "#d9534f", "CVMS2": "#d9534f", "ICMS2": "#d9534f", "DCFS2": "#d9534f", "CCFS1": "#d9534f", "CCMS2": "#d9534f", "JVMS1": "#d9534f", "CPFS2": "#d9534f", "IAFS1": "#d9534f", "CAMS1": "#d9534f", "JPMS2": "#d9534f", "IAMS1": "#d9534f", "DAFS1": "#d9534f", "DAFS2": "#d9534f", "IAMS2": "#d9534f", "JVMS2": "#d9534f", "ICFS2": "#d9534f", "IPMS2": "#d9534f", "DPFS1": "#d9534f", "DCFS1": "#d9534f", "JCMS2": "#d9534f", "JPMS1": "#d9534f", "JAFS1": "#d9534f", "JCFS2": "#d9534f", "DPMS2": "#d9534f", "CAMS2": "#d9534f", "DAMS2": "#d9534f", "IVMS1": "#d9534f", "CPMS2": "#d9534f", "CPFS1": "#d9534f", "IVFS1": "#d9534f", "CVFS1": "#d9534f", "IVMS2": "#d9534f", "IPFS2": "#d9534f", "JAFS2": "#d9534f", "JAMS1": "#d9534f", "DVFS2": "#d9534f", "JPFS2": "#d9534f" } }, "add_log_tab": false, "add_pct_tab": false, "l_active": false, "p_active": false, "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "yaxis" ], "square": false, "flat": false, "defer_render": false }, "fastqc_overrepresented_sequences_plot": { "id": "fastqc_overrepresented_sequences_plot", "anchor": "fastqc_overrepresented_sequences_plot", "plot_type": "bar_graph", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 800, "hoverlabel": { "namelength": -1, "bgcolor": "rgba(255, 255, 255, 0.8)", "font": { "color": "black" } }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "white", "plot_bgcolor": "white", "showlegend": true, "title": { "font": { "size": 20 }, "text": "FastQC: Overrepresented sequences sample summary", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)", "showgrid": false, "categoryorder": "trace", "type": "category" }, "barmode": "relative", "bargroupgap": 0, "bargap": 0.2, "legend": { "tracegroupgap": 0, "traceorder": "normal" }, "hovermode": "y unified" }, "datasets": [ { "plot_id": "fastqc_overrepresented_sequences_plot", "label": "1", "uid": "fastqc_overrepresented_sequences_plot", "dconfig": { "title": "FastQC: Overrepresented sequences sample summary
64 samples" }, "layout": { "title": { "text": "FastQC: Overrepresented sequences sample summary
64 samples" }, "xaxis": { "title": { "text": "Percentage of Total Sequences" }, "hoverformat": ",.2f", "ticksuffix": "%", "autorangeoptions": { "minallowed": 0, "maxallowed": 90.97921296901556 } }, "yaxis": { "title": null, "hoverformat": null, "ticksuffix": "" }, "showlegend": true }, "trace_params": { "hovertemplate": "%{meta}: %{x}", "orientation": "h", "marker": { "line": { "width": 0 } }, "textposition": "inside", "insidetextanchor": "start" }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "n_samples": 64, "cats": [ { "name": "Top overrepresented sequence", "color": "124,181,236", "data": [ 11.119083685455367, 12.822643082603777, 11.113186661131866, 12.817844710155896, 8.25630786546304, 6.316391527304546, 14.3711288532455, 14.670278918269124, 11.122025669959976, 11.881944399869056, 13.336153489260663, 13.223718252177072, 12.66959838269315, 13.584099353973594, 11.211034818010573, 10.078215056591803, 12.709232178091634, 4.9110063690865635, 13.544548976203652, 11.50182686966222, 5.329914877054035, 11.932842030902963, 2.8757899574859245, 11.757731194782933, 9.258097533595272, 6.517189359170492, 3.7434307399470867, 5.9259259259259265, 6.21913174721891, 9.529728889819687, 13.025801907932646, 6.896637593460708, 5.0180308020777735, 3.6628736251545218, 6.10079575596817, 7.366709729863118, 4.224369232250069, 3.1842314337238484, 4.824572033316368, 5.524042941949118, 4.86564321713078, 4.8919447357857795, 6.483721360225575, 5.513353727700822, 12.039113662868933, 11.151377264971154, 5.9087919315939486, 7.545808520384792, 2.221670653007807, 2.548113890588255, 3.1643867008080346, 3.1217872584135686, 3.035938068480414, 3.5065931256163934, 2.8496301433194637, 9.080046129691127, 3.1771089249683757, 3.339396643443045, 3.678148070991967, 3.4381190823447807, 4.8730380977420165, 5.406571685099216, 3.310655455838823, 3.5418316507554457 ], "data_pct": [] }, { "name": "Sum of remaining overrepresented sequences", "color": "67,67,72", "data": [ 67.23892033626545, 67.8047763682926, 72.59443752594441, 70.68166338731649, 71.67261542256725, 75.40562076230798, 72.14257583739521, 73.4097327493625, 69.3584133659146, 68.96547297340669, 70.77795365847, 71.85659396915219, 74.4225144675323, 75.56065191646144, 76.67375584857504, 77.39112943779543, 71.93055332647297, 76.09522919364962, 70.56870340831408, 74.92152815727789, 75.72388350171765, 69.66127670783472, 77.67206710329772, 73.00799700998176, 74.99092019678407, 78.9393166751657, 73.38656578837102, 75.73553473151867, 81.25703273971959, 79.9825700407375, 77.08640117805238, 84.08257537555485, 72.19155611680317, 73.3348125138673, 73.3129346895299, 70.08317487044754, 76.18062156341365, 76.62963289910088, 79.24513059143825, 78.24651261768307, 76.09912441647118, 76.43933410161121, 76.53657108519127, 78.3453064311003, 74.527419292827, 71.04087104899651, 73.56665204998907, 76.29981676591844, 75.90414729906585, 76.70552446806718, 76.7373738380145, 77.79775512982413, 77.54931883413506, 75.7629579574095, 76.96486361534903, 74.85653943949647, 74.84187636561323, 74.04919616197378, 74.69501196579466, 75.28183835091906, 80.15689103837902, 78.31246476471532, 84.29967163152605, 84.28499273550372 ], "data_pct": [] } ], "samples": [ "JVMS2", "JVMS1", "JVFS2", "JVFS1", "JPMS2", "JPMS1", "JPFS2", "JPFS1", "JCMS2", "JCMS1", "JCFS2", "JCFS1", "JAMS2", "JAMS1", "JAFS2", "JAFS1", "IVMS2", "IVMS1", "IVFS2", "IVFS1", "IPMS2", "IPMS1", "IPFS2", "IPFS1", "ICMS2", "ICMS1", "ICFS2", "ICFS1", "IAMS2", "IAMS1", "IAFS2", "IAFS1", "DVMS2", "DVMS1", "DVFS2", "DVFS1", "DPMS2", "DPMS1", "DPFS2", "DPFS1", "DCMS2", "DCMS1", "DCFS2", "DCFS1", "DAMS2", "DAMS1", "DAFS2", "DAFS1", "CVMS2", "CVMS1", "CVFS2", "CVFS1", "CPMS2", "CPMS1", "CPFS2", "CPFS1", "CCMS2", "CCMS1", "CCFS2", "CCFS1", "CAMS2", "CAMS1", "CAFS2", "CAFS1" ] } ], "pconfig": { "id": "fastqc_overrepresented_sequences_plot", "title": "FastQC: Overrepresented sequences sample summary", "anchor": null, "table_title": null, "height": null, "width": null, "square": false, "logswitch": false, "logswitch_active": false, "logswitch_label": "Log10", "cpswitch": false, "cpswitch_c_active": true, "cpswitch_counts_label": "Counts", "cpswitch_percent_label": "Percentages", "xLog": null, "yLog": null, "xlog": false, "ylog": false, "data_labels": [], "xTitle": null, "yTitle": null, "xlab": null, "ylab": "Percentage of Total Sequences", "xsuffix": null, "ysuffix": null, "tt_suffix": "%", "xLabFormat": null, "yLabFormat": null, "xLabelFormat": null, "yLabelFormat": null, "xlab_format": null, "ylab_format": null, "tt_label": null, "xDecimals": null, "yDecimals": null, "decimalPlaces": null, "x_decimals": null, "y_decimals": null, "tt_decimals": 2, "xmin": null, "xmax": null, "ymin": 0, "ymax": null, "xFloor": null, "xCeiling": null, "yFloor": null, "yCeiling": null, "x_clipmin": null, "x_clipmax": null, "y_clipmin": null, "y_clipmax": 100, "save_data_file": true, "showlegend": null, "xMinRange": null, "yMinRange": null, "x_minrange": null, "y_minrange": null, "xPlotBands": null, "yPlotBands": null, "xPlotLines": null, "yPlotLines": null, "x_bands": null, "y_bands": null, "x_lines": null, "y_lines": null, "stacking": "relative", "hide_zero_cats": true, "sort_samples": true, "use_legend": true, "suffix": null, "lab_format": null }, "add_log_tab": false, "add_pct_tab": false, "l_active": false, "p_active": false, "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [ "xaxis" ], "square": false, "flat": false, "defer_render": false }, "fastqc_top_overrepresented_sequences_table": { "id": "fastqc_top_overrepresented_sequences_table", "anchor": "fastqc_top_overrepresented_sequences_table", "plot_type": "violin", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 500, "hoverlabel": { "namelength": -1 }, "margin": { "b": 40, "l": 60, "pad": 0, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "white", "plot_bgcolor": "white", "showlegend": false, "title": { "font": { "size": 20 }, "text": "FastQC: Top overrepresented sequences", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": false, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.1)", "tickfont": { "color": "rgba(0,0,0,0.5)", "size": 9 }, "zerolinecolor": "rgba(0,0,0,0.1)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.1)", "tickfont": { "color": "rgba(0,0,0,0.5)", "size": 9 }, "zerolinecolor": "rgba(0,0,0,0.1)" }, "violingap": 0, "grid": { "columns": 1, "roworder": "top to bottom", "ygap": 0.4 } }, "datasets": [ { "plot_id": "fastqc_top_overrepresented_sequences_table", "label": "1", "uid": "fastqc_top_overrepresented_sequences_table", "dconfig": { "ylab": "", "title": "FastQC: Top overrepresented sequences
20 samples" }, "layout": { "title": { "text": "FastQC: Top overrepresented sequences
20 samples" }, "xaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": null }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "yaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "" }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } } }, "trace_params": { "hovertemplate": "%{text}: %{x}", "orientation": "h", "box": { "visible": true }, "meanline": { "visible": true }, "fillcolor": "#b5b5b5", "line": { "width": 2, "color": "#b5b5b5" }, "opacity": 0.5, "points": false, "hoveron": "points" }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "n_samples": 20, "metrics": [ "fastqc-samples", "fastqc-total_count", "fastqc-total_percent" ], "header_by_metric": { "fastqc-samples": { "title": "Reports", "description": "Number of FastQC reports where this sequence is founds as overrepresented", "suffix": "", "dmin": 0.0, "dmax": 56, "hidden": false, "xaxis": { "ticksuffix": null, "tickvals": null, "range": [ -0.28, 56.2814 ] }, "show_only_outliers": false, "show_points": true, "namespace": "", "color": null, "hoverformat": null }, "fastqc-total_count": { "title": "Occurrences", "description": "Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)", "suffix": "", "dmin": 0.0, "dmax": 175128, "hidden": false, "xaxis": { "ticksuffix": null, "tickvals": null, "range": [ -875.64, 176008.0182 ] }, "show_only_outliers": false, "show_points": true, "namespace": "", "color": null, "hoverformat": null }, "fastqc-total_percent": { "title": "% of all reads", "description": "Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)", "suffix": "%", "dmin": 0.0, "dmax": 100.0, "hidden": false, "xaxis": { "ticksuffix": "%", "tickvals": null, "range": [ -0.5, 100.5025 ] }, "show_only_outliers": false, "show_points": true, "namespace": "", "color": null, "hoverformat": ".2f" } }, "violin_value_by_sample_by_metric": { "fastqc-samples": { "CCTACGGGGGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": 56, "CCTACGGGTGGCTGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": 55, "CCTACGGGGGGCTGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": 55, "CCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": 55, "CCTACGGGTGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": 55, "CCTACGGGCGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": 55, "CCTACGGGCGGCTGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": 54, "CCTACGGGAGGCTGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": 53, "CCTACGGGGGGCAGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": 50, "CCTACGGGTGGCTGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": 48, "CCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": 47, "CCTACGGGGGGCTGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": 46, "CCTACGGGTGGCAGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": 45, "CCTACGGGCGGCTGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": 45, "CCTACGGGCGGCAGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": 45, "CCTACGGGGGGCAGCAGTAGGGAATCTTCCACAATGGACGAAAGTCTGAT": 45, "CCTACGGGGGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGAT": 41, "CCTACGGGTGGCTGCAGTAGGGAATCTTCCACAATGGACGAAAGTCTGAT": 41, "CCTACGGGAGGCAGCAGTAGGGAATCTTCCACAATGGACGAAAGTCTGAT": 41, "CCTACGGGAGGCTGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": 41 }, "fastqc-total_count": { "CCTACGGGGGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": 175128, "CCTACGGGTGGCTGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": 164964, "CCTACGGGGGGCTGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": 156131, "CCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": 152021, "CCTACGGGTGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": 149619, "CCTACGGGCGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": 131055, "CCTACGGGCGGCTGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": 143332, "CCTACGGGAGGCTGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": 115567, "CCTACGGGGGGCAGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": 157913, "CCTACGGGTGGCTGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": 131827, "CCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": 124070, "CCTACGGGGGGCTGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": 107921, "CCTACGGGTGGCAGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": 113444, "CCTACGGGCGGCTGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": 101099, "CCTACGGGCGGCAGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": 106030, "CCTACGGGGGGCAGCAGTAGGGAATCTTCCACAATGGACGAAAGTCTGAT": 156090, "CCTACGGGGGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGAT": 137509, "CCTACGGGTGGCTGCAGTAGGGAATCTTCCACAATGGACGAAAGTCTGAT": 130724, "CCTACGGGAGGCAGCAGTAGGGAATCTTCCACAATGGACGAAAGTCTGAT": 125665, "CCTACGGGAGGCTGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": 53766 }, "fastqc-total_percent": { "CCTACGGGGGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": 1.7618030735781751, "CCTACGGGTGGCTGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": 1.659552340172617, "CCTACGGGGGGCTGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": 1.570691583760644, "CCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": 1.5293446224957046, "CCTACGGGTGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": 1.5051802913622778, "CCTACGGGCGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": 1.3184248196050188, "CCTACGGGCGGCTGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": 1.441932518741189, "CCTACGGGAGGCTGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": 1.1626141782251207, "CCTACGGGGGGCAGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": 1.5886186603966834, "CCTACGGGTGGCTGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": 1.3261912074630562, "CCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": 1.2481551056304199, "CCTACGGGGGGCTGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": 1.085694746149275, "CCTACGGGTGGCAGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": 1.1412566116155183, "CCTACGGGCGGCTGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": 1.017064826502215, "CCTACGGGCGGCAGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": 1.0666711199322432, "CCTACGGGGGGCAGCAGTAGGGAATCTTCCACAATGGACGAAAGTCTGAT": 1.5702791201567843, "CCTACGGGGGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGAT": 1.3833526269052423, "CCTACGGGTGGCTGCAGTAGGGAATCTTCCACAATGGACGAAAGTCTGAT": 1.3150949305104458, "CCTACGGGAGGCAGCAGTAGGGAATCTTCCACAATGGACGAAAGTCTGAT": 1.264200945829344, "CCTACGGGAGGCTGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": 0.5408906859782797 } }, "scatter_value_by_sample_by_metric": { "fastqc-samples": {}, "fastqc-total_count": {}, "fastqc-total_percent": {} }, "all_samples": [ "CCTACGGGAGGCAGCAGTAGGGAATCTTCCACAATGGACGAAAGTCTGAT", "CCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT", "CCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT", "CCTACGGGAGGCTGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT", "CCTACGGGAGGCTGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT", "CCTACGGGCGGCAGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT", "CCTACGGGCGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT", "CCTACGGGCGGCTGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT", "CCTACGGGCGGCTGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT", "CCTACGGGGGGCAGCAGTAGGGAATCTTCCACAATGGACGAAAGTCTGAT", "CCTACGGGGGGCAGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT", "CCTACGGGGGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGAT", "CCTACGGGGGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT", "CCTACGGGGGGCTGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT", "CCTACGGGGGGCTGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT", "CCTACGGGTGGCAGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT", "CCTACGGGTGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT", "CCTACGGGTGGCTGCAGTAGGGAATCTTCCACAATGGACGAAAGTCTGAT", "CCTACGGGTGGCTGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT", "CCTACGGGTGGCTGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT" ], "scatter_trace_params": { "mode": "markers", "marker": { "size": 4, "color": "#0b79e6" }, "showlegend": false, "hovertemplate": "%{text}: %{x}", "hoverlabel": { "bgcolor": "white" } } } ], "pconfig": { "id": "fastqc_top_overrepresented_sequences_table", "title": "FastQC: Top overrepresented sequences", "anchor": null, "table_title": null, "height": null, "width": null, "square": false, "logswitch": false, "logswitch_active": false, "logswitch_label": "Log10", "cpswitch": true, "cpswitch_c_active": true, "cpswitch_counts_label": "Counts", "cpswitch_percent_label": "Percentages", "xLog": null, "yLog": null, "xlog": false, "ylog": false, "data_labels": [], "xTitle": null, "yTitle": null, "xlab": null, "ylab": null, "xsuffix": null, "ysuffix": null, "tt_suffix": null, "xLabFormat": null, "yLabFormat": null, "xLabelFormat": null, "yLabelFormat": null, "xlab_format": null, "ylab_format": null, "tt_label": null, "xDecimals": null, "yDecimals": null, "decimalPlaces": null, "x_decimals": null, "y_decimals": null, "tt_decimals": null, "xmin": null, "xmax": null, "ymin": null, "ymax": null, "xFloor": null, "xCeiling": null, "yFloor": null, "yCeiling": null, "x_clipmin": null, "x_clipmax": null, "y_clipmin": null, "y_clipmax": null, "save_data_file": true, "showlegend": null, "xMinRange": null, "yMinRange": null, "x_minrange": null, "y_minrange": null, "xPlotBands": null, "yPlotBands": null, "xPlotLines": null, "yPlotLines": null, "x_bands": null, "y_bands": null, "x_lines": null, "y_lines": null, "namespace": "FastQC", "save_file": false, "raw_data_fn": null, "defaultsort": null, "sortRows": true, "sort_rows": false, "only_defined_headers": true, "col1_header": "Overrepresented sequence", "no_beeswarm": false, "no_violin": false, "scale": "GnBu", "min": null }, "add_log_tab": false, "add_pct_tab": false, "l_active": false, "p_active": false, "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [], "square": false, "flat": false, "defer_render": false, "violin_height": 70, "extra_height": 63, "no_violin": false, "show_table": true, "show_table_by_default": true, "n_samples": 20, "main_table_dt": { "id": "fastqc_top_overrepresented_sequences_table", "anchor": "fastqc_top_overrepresented_sequences_table_table", "pconfig": { "id": "fastqc_top_overrepresented_sequences_table", "title": "FastQC: Top overrepresented sequences", "anchor": null, "table_title": null, "height": null, "width": null, "square": false, "logswitch": false, "logswitch_active": false, "logswitch_label": "Log10", "cpswitch": true, "cpswitch_c_active": true, "cpswitch_counts_label": "Counts", "cpswitch_percent_label": "Percentages", "xLog": null, "yLog": null, "xlog": false, "ylog": false, "data_labels": [], "xTitle": null, "yTitle": null, "xlab": null, "ylab": null, "xsuffix": null, "ysuffix": null, "tt_suffix": null, "xLabFormat": null, "yLabFormat": null, "xLabelFormat": null, "yLabelFormat": null, "xlab_format": null, "ylab_format": null, "tt_label": null, "xDecimals": null, "yDecimals": null, "decimalPlaces": null, "x_decimals": null, "y_decimals": null, "tt_decimals": null, "xmin": null, "xmax": null, "ymin": null, "ymax": null, "xFloor": null, "xCeiling": null, "yFloor": null, "yCeiling": null, "x_clipmin": null, "x_clipmax": null, "y_clipmin": null, "y_clipmax": null, "save_data_file": true, "showlegend": null, "xMinRange": null, "yMinRange": null, "x_minrange": null, "y_minrange": null, "xPlotBands": null, "yPlotBands": null, "xPlotLines": null, "yPlotLines": null, "x_bands": null, "y_bands": null, "x_lines": null, "y_lines": null, "namespace": "FastQC", "save_file": false, "raw_data_fn": null, "defaultsort": null, "sortRows": true, "sort_rows": false, "only_defined_headers": true, "col1_header": "Overrepresented sequence", "no_beeswarm": false, "no_violin": false, "scale": "GnBu", "min": null }, "sections": [ { "column_by_key": { "samples": { "rid": "fastqc-samples", "title": "Reports", "description": "Number of FastQC reports where this sequence is founds as overrepresented", "scale": "Greens", "hidden": false, "placement": 1000.0, "namespace": "", "colour": null, "color": null, "max": null, "dmax": 56, "min": 0.0, "dmin": 0.0, "ceiling": null, "floor": null, "minRange": null, "minrange": null, "shared_key": null, "tt_decimals": null, "suffix": null, "cond_formatting_colours": [ { "blue": "#337ab7" }, { "lbue": "#5bc0de" }, { "pass": "#5cb85c" }, { "warn": "#f0ad4e" }, { "fail": "#d9534f" } ], "cond_formatting_rules": {}, "bgcols": {}, "bars_zero_centrepoint": false }, "total_count": { "rid": "fastqc-total_count", "title": "Occurrences", "description": "Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)", "scale": "Blues", "hidden": false, "placement": 1000.0, "namespace": "", "colour": null, "color": null, "max": null, "dmax": 175128, "min": 0.0, "dmin": 0.0, "ceiling": null, "floor": null, "minRange": null, "minrange": null, "shared_key": null, "tt_decimals": null, "suffix": null, "cond_formatting_colours": [ { "blue": "#337ab7" }, { "lbue": "#5bc0de" }, { "pass": "#5cb85c" }, { "warn": "#f0ad4e" }, { "fail": "#d9534f" } ], "cond_formatting_rules": {}, "bgcols": {}, "bars_zero_centrepoint": false }, "total_percent": { "rid": "fastqc-total_percent", "title": "% of all reads", "description": "Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)", "scale": "Blues", "hidden": false, "placement": 1000.0, "namespace": "", "colour": null, "color": null, "max": 100.0, "dmax": 100.0, "min": 0.0, "dmin": 0.0, "ceiling": null, "floor": null, "minRange": null, "minrange": null, "shared_key": null, "tt_decimals": null, "suffix": "%", "cond_formatting_colours": [ { "blue": "#337ab7" }, { "lbue": "#5bc0de" }, { "pass": "#5cb85c" }, { "warn": "#f0ad4e" }, { "fail": "#d9534f" } ], "cond_formatting_rules": {}, "bgcols": {}, "bars_zero_centrepoint": false } }, "rows_by_sgroup": { "CCTACGGGGGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": [ { "sample": "CCTACGGGGGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT", "raw_data": { "total_percent": 1.7618030735781751, "total_count": 175128, "samples": 56 }, "formatted_data": { "total_percent": "1.7618", "total_count": "175,128", "samples": "56" } } ], "CCTACGGGTGGCTGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": [ { "sample": "CCTACGGGTGGCTGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT", "raw_data": { "total_percent": 1.659552340172617, "total_count": 164964, "samples": 55 }, "formatted_data": { "total_percent": "1.6596", "total_count": "164,964", "samples": "55" } } ], "CCTACGGGGGGCTGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": [ { "sample": "CCTACGGGGGGCTGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT", "raw_data": { "total_percent": 1.570691583760644, "total_count": 156131, "samples": 55 }, "formatted_data": { "total_percent": "1.5707", "total_count": "156,131", "samples": "55" } } ], "CCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": [ { "sample": "CCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT", "raw_data": { "total_percent": 1.5293446224957046, "total_count": 152021, "samples": 55 }, "formatted_data": { "total_percent": "1.5293", "total_count": "152,021", "samples": "55" } } ], "CCTACGGGTGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": [ { "sample": "CCTACGGGTGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT", "raw_data": { "total_percent": 1.5051802913622778, "total_count": 149619, "samples": 55 }, "formatted_data": { "total_percent": "1.5052", "total_count": "149,619", "samples": "55" } } ], "CCTACGGGCGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": [ { "sample": "CCTACGGGCGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT", "raw_data": { "total_percent": 1.3184248196050188, "total_count": 131055, "samples": 55 }, "formatted_data": { "total_percent": "1.3184", "total_count": "131,055", "samples": "55" } } ], "CCTACGGGCGGCTGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": [ { "sample": "CCTACGGGCGGCTGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT", "raw_data": { "total_percent": 1.441932518741189, "total_count": 143332, "samples": 54 }, "formatted_data": { "total_percent": "1.4419", "total_count": "143,332", "samples": "54" } } ], "CCTACGGGAGGCTGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT": [ { "sample": "CCTACGGGAGGCTGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGAT", "raw_data": { "total_percent": 1.1626141782251207, "total_count": 115567, "samples": 53 }, "formatted_data": { "total_percent": "1.1626", "total_count": "115,567", "samples": "53" } } ], "CCTACGGGGGGCAGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": [ { "sample": "CCTACGGGGGGCAGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT", "raw_data": { "total_percent": 1.5886186603966834, "total_count": 157913, "samples": 50 }, "formatted_data": { "total_percent": "1.5886", "total_count": "157,913", "samples": "50" } } ], "CCTACGGGTGGCTGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": [ { "sample": "CCTACGGGTGGCTGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT", "raw_data": { "total_percent": 1.3261912074630562, "total_count": 131827, "samples": 48 }, "formatted_data": { "total_percent": "1.3262", "total_count": "131,827", "samples": "48" } } ], "CCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": [ { "sample": "CCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT", "raw_data": { "total_percent": 1.2481551056304199, "total_count": 124070, "samples": 47 }, "formatted_data": { "total_percent": "1.2482", "total_count": "124,070", "samples": "47" } } ], "CCTACGGGGGGCTGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": [ { "sample": "CCTACGGGGGGCTGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT", "raw_data": { "total_percent": 1.085694746149275, "total_count": 107921, "samples": 46 }, "formatted_data": { "total_percent": "1.0857", "total_count": "107,921", "samples": "46" } } ], "CCTACGGGTGGCAGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": [ { "sample": "CCTACGGGTGGCAGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT", "raw_data": { "total_percent": 1.1412566116155183, "total_count": 113444, "samples": 45 }, "formatted_data": { "total_percent": "1.1413", "total_count": "113,444", "samples": "45" } } ], "CCTACGGGCGGCTGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": [ { "sample": "CCTACGGGCGGCTGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT", "raw_data": { "total_percent": 1.017064826502215, "total_count": 101099, "samples": 45 }, "formatted_data": { "total_percent": "1.0171", "total_count": "101,099", "samples": "45" } } ], "CCTACGGGCGGCAGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": [ { "sample": "CCTACGGGCGGCAGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT", "raw_data": { "total_percent": 1.0666711199322432, "total_count": 106030, "samples": 45 }, "formatted_data": { "total_percent": "1.0667", "total_count": "106,030", "samples": "45" } } ], "CCTACGGGGGGCAGCAGTAGGGAATCTTCCACAATGGACGAAAGTCTGAT": [ { "sample": "CCTACGGGGGGCAGCAGTAGGGAATCTTCCACAATGGACGAAAGTCTGAT", "raw_data": { "total_percent": 1.5702791201567843, "total_count": 156090, "samples": 45 }, "formatted_data": { "total_percent": "1.5703", "total_count": "156,090", "samples": "45" } } ], "CCTACGGGGGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGAT": [ { "sample": "CCTACGGGGGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGAT", "raw_data": { "total_percent": 1.3833526269052423, "total_count": 137509, "samples": 41 }, "formatted_data": { "total_percent": "1.3834", "total_count": "137,509", "samples": "41" } } ], "CCTACGGGTGGCTGCAGTAGGGAATCTTCCACAATGGACGAAAGTCTGAT": [ { "sample": "CCTACGGGTGGCTGCAGTAGGGAATCTTCCACAATGGACGAAAGTCTGAT", "raw_data": { "total_percent": 1.3150949305104458, "total_count": 130724, "samples": 41 }, "formatted_data": { "total_percent": "1.3151", "total_count": "130,724", "samples": "41" } } ], "CCTACGGGAGGCAGCAGTAGGGAATCTTCCACAATGGACGAAAGTCTGAT": [ { "sample": "CCTACGGGAGGCAGCAGTAGGGAATCTTCCACAATGGACGAAAGTCTGAT", "raw_data": { "total_percent": 1.264200945829344, "total_count": 125665, "samples": 41 }, "formatted_data": { "total_percent": "1.2642", "total_count": "125,665", "samples": "41" } } ], "CCTACGGGAGGCTGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT": [ { "sample": "CCTACGGGAGGCTGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGAT", "raw_data": { "total_percent": 0.5408906859782797, "total_count": 53766, "samples": 41 }, "formatted_data": { "total_percent": "0.5409", "total_count": "53,766", "samples": "41" } } ] } } ], "headers_in_order": { "1000.0": [ [ 0, "samples" ], [ 0, "total_count" ], [ 0, "total_percent" ] ] } } }, "fastqc-status-check-heatmap": { "id": "fastqc-status-check-heatmap", "anchor": "fastqc-status-check-heatmap", "plot_type": "heatmap", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 700, "hoverlabel": { "namelength": -1 }, "margin": { "b": 65, "l": 60, "pad": 5, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "white", "plot_bgcolor": "white", "showlegend": false, "title": { "font": { "size": 20 }, "text": "FastQC: Status Checks", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)", "type": "category", "tickmode": "array", "tickvals": [ 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 ], "ticktext": [ "Basic
Statistics", "Per Base
Sequence
Quality", "Per Tile
Sequence
Quality", "Per
Sequence
Quality
Scores", "Per Base
Sequence
Content", "Per
Sequence
GC Content", "Per Base N
Content", "Sequence
Length
Distribution", "Sequence
Duplication
Levels", "Overrepresented
Sequences", "Adapter
Content" ], "tickangle": 0, "showgrid": false }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.05)", "tickfont": { "color": "rgba(0,0,0,1)", "size": 10 }, "zerolinecolor": "rgba(0,0,0,0.05)", "type": "category", "showgrid": false, "autorange": "reversed", "ticklabelposition": "outside right" } }, "datasets": [ { "plot_id": "fastqc-status-check-heatmap", "label": "1", "uid": "fastqc-status-check-heatmap", "dconfig": { "title": "FastQC: Status Checks
64 samples" }, "layout": { "title": { "text": "FastQC: Status Checks
64 samples" }, "xaxis": { "hoverformat": null, "ticksuffix": "", "title": null, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "yaxis": { "hoverformat": ",.1f", "ticksuffix": "", "title": null, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } } }, "trace_params": { "colorscale": [ [ 0.0, "#ffffff" ], [ 0.25, "#d9534f" ], [ 0.5, "#fee391" ], [ 1.0, "#5cb85c" ] ], "reversescale": false, "showscale": false, "zmin": 0, "zmax": 1, "hovertemplate": "Section Name: %{x}
Sample: %{y}
z: %{z}" }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "n_samples": 64, "rows": [ [ 1, 1, 1, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 1, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.25, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 1, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.25, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.25, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 1, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 1, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.25, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 1, 1, 0.25, 0.5, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.25, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 1, 1, 0.25, 0.5, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 1, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 1, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 1, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.25, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 1, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 1, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 1, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 1, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 1, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.25, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.25, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.25, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.25, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.25, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.25, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.25, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.25, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.25, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.25, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.25, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 1, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 1, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 1, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 1, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.25, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 1, 1, 0.25, 0.5, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.25, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.25, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 1, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 1, 1, 0.25, 0.5, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 1, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 1, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.25, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.25, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 1, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.25, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 1, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 1, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.25, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.25, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.25, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 1, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.25, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 1, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.25, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.25, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.25, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 1, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 1, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 1, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.25, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ], [ 1, 1, 0.25, 1, 0.25, 0.25, 1, 0.5, 0.25, 0.25, 1 ] ], "xcats": [ "Basic Statistics", "Per Base Sequence Quality", "Per Tile Sequence Quality", "Per Sequence Quality Scores", "Per Base Sequence Content", "Per Sequence GC Content", "Per Base N Content", "Sequence Length Distribution", "Sequence Duplication Levels", "Overrepresented Sequences", "Adapter Content" ], "ycats": [ "CAFS1", "CAFS2", "CAMS1", "CAMS2", "CCFS1", "CCFS2", "CCMS1", "CCMS2", "CPFS1", "CPFS2", "CPMS1", "CPMS2", "CVFS1", "CVFS2", "CVMS1", "CVMS2", "DAFS1", "DAFS2", "DAMS1", "DAMS2", "DCFS1", "DCFS2", "DCMS1", "DCMS2", "DPFS1", "DPFS2", "DPMS1", "DPMS2", "DVFS1", "DVFS2", "DVMS1", "DVMS2", "IAFS1", "IAFS2", "IAMS1", "IAMS2", "ICFS1", "ICFS2", "ICMS1", "ICMS2", "IPFS1", "IPFS2", "IPMS1", "IPMS2", "IVFS1", "IVFS2", "IVMS1", "IVMS2", "JAFS1", "JAFS2", "JAMS1", "JAMS2", "JCFS1", "JCFS2", "JCMS1", "JCMS2", "JPFS1", "JPFS2", "JPMS1", "JPMS2", "JVFS1", "JVFS2", "JVMS1", "JVMS2" ] } ], "pconfig": { "id": "fastqc-status-check-heatmap", "title": "FastQC: Status Checks", "anchor": null, "table_title": null, "height": null, "width": null, "square": false, "logswitch": false, "logswitch_active": false, "logswitch_label": "Log10", "cpswitch": true, "cpswitch_c_active": true, "cpswitch_counts_label": "Counts", "cpswitch_percent_label": "Percentages", "xLog": null, "yLog": null, "xlog": false, "ylog": false, "data_labels": [], "xTitle": null, "yTitle": null, "xlab": "Section Name", "ylab": "Sample", "xsuffix": null, "ysuffix": null, "tt_suffix": null, "xLabFormat": null, "yLabFormat": null, "xLabelFormat": null, "yLabelFormat": null, "xlab_format": null, "ylab_format": null, "tt_label": null, "xDecimals": null, "yDecimals": null, "decimalPlaces": 2, "x_decimals": null, "y_decimals": null, "tt_decimals": 1, "xmin": null, "xmax": null, "ymin": null, "ymax": null, "xFloor": null, "xCeiling": null, "yFloor": null, "yCeiling": null, "x_clipmin": null, "x_clipmax": null, "y_clipmin": null, "y_clipmax": null, "save_data_file": true, "showlegend": null, "xMinRange": null, "yMinRange": null, "x_minrange": null, "y_minrange": null, "xPlotBands": null, "yPlotBands": null, "xPlotLines": null, "yPlotLines": null, "x_bands": null, "y_bands": null, "x_lines": null, "y_lines": null, "zlab": "z", "min": 0, "max": 1, "xcats_samples": false, "ycats_samples": true, "colstops": [ [ 0, "#ffffff" ], [ 0.25, "#d9534f" ], [ 0.5, "#fee391" ], [ 1, "#5cb85c" ] ], "reverseColors": false, "reverse_colors": false, "legend": false, "datalabels": null, "display_values": false, "angled_xticks": false }, "add_log_tab": false, "add_pct_tab": false, "l_active": false, "p_active": false, "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [], "square": false, "flat": false, "defer_render": false, "xcats_samples": false, "ycats_samples": true, "min": 0.0, "max": 1.0 }, "general_stats_table": { "id": "general_stats_table", "anchor": "general_stats_table", "plot_type": "violin", "layout": { "autosize": true, "colorway": [ "#7cb5ec", "#434348", "#90ed7d", "#f7a35c", "#8085e9", "#f15c80", "#e4d354", "#2b908f", "#f45b5b", "#91e8e1" ], "font": { "family": "'Lucida Grande', 'Open Sans', verdana, arial, sans-serif" }, "height": 500, "hoverlabel": { "namelength": -1 }, "margin": { "b": 40, "l": 60, "pad": 0, "r": 15, "t": 50 }, "modebar": { "activecolor": "rgba(0, 0, 0, 1)", "bgcolor": "rgba(0, 0, 0, 0)", "color": "rgba(0, 0, 0, 0.5)" }, "paper_bgcolor": "white", "plot_bgcolor": "white", "showlegend": false, "title": { "font": { "size": 20 }, "text": "General Statistics", "x": 0.5, "xanchor": "center" }, "xaxis": { "automargin": false, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.1)", "tickfont": { "color": "rgba(0,0,0,0.5)", "size": 9 }, "zerolinecolor": "rgba(0,0,0,0.1)" }, "yaxis": { "automargin": true, "color": "rgba(0,0,0,0.3)", "gridcolor": "rgba(0,0,0,0.1)", "tickfont": { "color": "rgba(0,0,0,0.5)", "size": 9 }, "zerolinecolor": "rgba(0,0,0,0.1)" }, "violingap": 0, "grid": { "columns": 1, "roworder": "top to bottom", "ygap": 0.4 } }, "datasets": [ { "plot_id": "general_stats_table", "label": "1", "uid": "general_stats_table", "dconfig": { "ylab": "", "title": "General Statistics
64 samples" }, "layout": { "title": { "text": "General Statistics
64 samples" }, "xaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": null }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } }, "yaxis": { "hoverformat": null, "ticksuffix": "", "title": { "text": "" }, "rangemode": "normal", "autorangeoptions": { "clipmin": null, "clipmax": null, "minallowed": null, "maxallowed": null } } }, "trace_params": { "hovertemplate": "%{text}: %{x}", "orientation": "h", "box": { "visible": true }, "meanline": { "visible": true }, "fillcolor": "#b5b5b5", "line": { "width": 2, "color": "#b5b5b5" }, "opacity": 0.5, "points": false, "hoveron": "points" }, "pct_range": { "xaxis": { "min": 0, "max": 100 }, "yaxis": { "min": 0, "max": 100 } }, "n_samples": 64, "metrics": [ "fastqc-percent_duplicates", "fastqc-percent_gc", "fastqc-avg_sequence_length", "fastqc-median_sequence_length", "fastqc-percent_fails", "fastqc-total_sequences" ], "header_by_metric": { "fastqc-percent_duplicates": { "title": "Dups", "description": "% duplicate reads", "suffix": "%", "dmin": 0.0, "dmax": 100.0, "hidden": false, "xaxis": { "ticksuffix": "%", "tickvals": null, "range": [ -0.5, 100.5025 ] }, "show_only_outliers": false, "show_points": true, "namespace": "FastQC", "color": null, "hoverformat": ".2f" }, "fastqc-percent_gc": { "title": "GC", "description": "Average % GC content", "suffix": "%", "dmin": 0.0, "dmax": 100.0, "hidden": false, "xaxis": { "ticksuffix": "%", "tickvals": null, "range": [ -0.5, 100.5025 ] }, "show_only_outliers": false, "show_points": true, "namespace": "FastQC", "color": null, "hoverformat": ".2f" }, "fastqc-avg_sequence_length": { "title": "Avg len", "description": "Average read length", "suffix": " bp", "dmin": 0.0, "dmax": 466.69301091188726, "hidden": true, "xaxis": { "ticksuffix": " bp", "tickvals": null, "range": [ -2.3334650545594364, 469.0381432917195 ] }, "show_only_outliers": false, "show_points": true, "namespace": "FastQC", "color": null, "hoverformat": ".2f" }, "fastqc-median_sequence_length": { "title": "Median len", "description": "Median read length", "suffix": " bp", "dmin": 0.0, "dmax": 467, "hidden": false, "xaxis": { "ticksuffix": " bp", "tickvals": null, "range": [ -2.335, 469.346675 ] }, "show_only_outliers": false, "show_points": true, "namespace": "FastQC", "color": null, "hoverformat": null }, "fastqc-percent_fails": { "title": "Failed", "description": "Percentage of modules failed in FastQC report (includes those not plotted here)", "suffix": "%", "dmin": 0.0, "dmax": 100.0, "hidden": true, "xaxis": { "ticksuffix": "%", "tickvals": null, "range": [ -0.5, 100.5025 ] }, "show_only_outliers": false, "show_points": true, "namespace": "FastQC", "color": null, "hoverformat": ".2f" }, "fastqc-total_sequences": { "title": "Seqs", "description": "Total sequences (millions)", "suffix": "M", "dmin": 0.0, "dmax": 0.33582, "hidden": false, "xaxis": { "ticksuffix": "M", "tickvals": null, "range": [ -0.0016791, 0.33750749550000003 ] }, "show_only_outliers": false, "show_points": true, "namespace": "FastQC", "color": null, "hoverformat": ".2f" } }, "violin_value_by_sample_by_metric": { "fastqc-percent_duplicates": { "CVFS2": 94.45933424332699, "JPFS1": 97.96479380554831, "CCMS1": 94.4140734167161, "ICFS1": 93.99003421091774, "CCFS2": 94.11719873381061, "IAFS2": 97.94080927075997, "DVMS1": 93.29297283590606, "DVMS2": 93.72567143582467, "DCMS2": 93.62473000905776, "JCMS1": 96.14740260990686, "JCFS1": 97.59833981042132, "DPMS1": 93.10692712208532, "CAFS2": 95.8633663499855, "DAMS1": 95.57812626960266, "JAMS2": 97.25863709940741, "IPMS1": 96.89802980142362, "DCMS1": 95.98035280356689, "CAFS1": 96.10585586990004, "IPFS1": 96.4267993272459, "JVFS1": 96.30505524443772, "IVFS2": 96.94407370031577, "DVFS1": 92.64925752275333, "DPFS2": 94.82885371981612, "CVMS1": 94.7017191349883, "JVFS2": 96.05783866057838, "CPMS1": 94.4433283413084, "ICMS1": 96.47448155702872, "CVMS2": 94.74163996570242, "ICMS2": 95.67966454254301, "DCFS2": 93.4346157994484, "CCFS1": 94.58889369242682, "CCMS2": 94.36975317031353, "JVMS1": 97.08266333154666, "CPFS2": 93.91643550624133, "IAFS1": 98.1584894383953, "CAMS1": 95.84345441511168, "JPMS2": 95.07550937025417, "IAMS1": 97.9219164848231, "DAFS1": 94.95648190563445, "DAFS2": 91.96722210041658, "IAMS2": 96.6512367514975, "JVMS2": 94.88337895417541, "ICFS2": 93.34993355919218, "IPMS2": 95.7074681423567, "DPFS1": 95.38660228798696, "DCFS1": 95.22049977657856, "JCMS2": 94.80268552269462, "JPMS1": 95.72063374119465, "JAFS1": 96.61919092674398, "JCFS2": 97.28241587292923, "DPMS2": 92.43800608809693, "CAMS2": 96.1841115723955, "DAMS2": 96.90243371054352, "IVMS1": 94.98017171164194, "CPMS2": 94.4743703763593, "CPFS1": 95.57043809312084, "IVFS1": 97.20301512530655, "CVFS1": 94.4122355282862, "IVMS2": 95.85075951398657, "IPFS2": 94.52878317821441, "JAFS2": 96.01628486358389, "JAMS1": 98.31632109580114, "DVFS2": 93.66945842645, "JPFS2": 97.44523494120716 }, "fastqc-percent_gc": { "CVFS2": 53.0, "JPFS1": 51.0, "CCMS1": 53.0, "ICFS1": 52.0, "CCFS2": 53.0, "IAFS2": 54.0, "DVMS1": 52.0, "DVMS2": 52.0, "DCMS2": 52.0, "JCMS1": 51.0, "JCFS1": 51.0, "DPMS1": 52.0, "CAFS2": 53.0, "DAMS1": 51.0, "JAMS2": 50.0, "IPMS1": 53.0, "DCMS1": 52.0, "CAFS1": 53.0, "IPFS1": 51.0, "JVFS1": 51.0, "IVFS2": 51.0, "DVFS1": 51.0, "DPFS2": 52.0, "CVMS1": 52.0, "JVFS2": 53.0, "CPMS1": 53.0, "ICMS1": 53.0, "CVMS2": 52.0, "ICMS2": 53.0, "DCFS2": 51.0, "CCFS1": 53.0, "CCMS2": 53.0, "JVMS1": 51.0, "CPFS2": 53.0, "IAFS1": 54.0, "CAMS1": 53.0, "JPMS2": 51.0, "IAMS1": 54.0, "DAFS1": 54.0, "DAFS2": 54.0, "IAMS2": 54.0, "JVMS2": 52.0, "ICFS2": 53.0, "IPMS2": 53.0, "DPFS1": 52.0, "DCFS1": 51.0, "JCMS2": 52.0, "JPMS1": 51.0, "JAFS1": 53.0, "JCFS2": 51.0, "DPMS2": 52.0, "CAMS2": 53.0, "DAMS2": 50.0, "IVMS1": 52.0, "CPMS2": 53.0, "CPFS1": 54.0, "IVFS1": 53.0, "CVFS1": 53.0, "IVMS2": 51.0, "IPFS2": 53.0, "JAFS2": 54.0, "JAMS1": 50.0, "DVFS2": 51.0, "JPFS2": 51.0 }, "fastqc-avg_sequence_length": { "CVFS2": 443.6777127940459, "JPFS1": 466.69301091188726, "CCMS1": 443.09737496261505, "ICFS1": 456.80890227576975, "CCFS2": 443.7233716611368, "IAFS2": 464.7821323388181, "DVMS1": 450.1387999619639, "DVMS2": 455.1479274341583, "DCMS2": 463.30315628120866, "JCMS1": 463.42276190537325, "JCFS1": 466.4255336716832, "DPMS1": 456.0338726559643, "CAFS2": 445.95572756879216, "DAMS1": 463.6502559518973, "JAMS2": 466.340468101957, "IPMS1": 439.6916618274774, "DCMS1": 463.4131565430948, "CAFS1": 445.7737561498793, "IPFS1": 465.9449553108266, "JVFS1": 466.0567721734524, "IVFS2": 466.1178505159673, "DVFS1": 458.94500733042054, "DPFS2": 464.8087297932673, "CVMS1": 444.28740086770574, "JVFS2": 443.42470596374704, "CPMS1": 443.2770025934178, "ICMS1": 457.1018241118477, "CVMS2": 444.08152443702335, "ICMS2": 446.28260474791165, "DCFS2": 464.471533566509, "CCFS1": 443.8030528331108, "CCMS2": 443.0256029607017, "JVMS1": 463.6972187481389, "CPFS2": 443.6046000924642, "IAFS1": 452.8225911883906, "CAMS1": 444.7415591917983, "JPMS2": 464.088645456718, "IAMS1": 458.31947156146765, "DAFS1": 456.9547984425103, "DAFS2": 454.6640265292699, "IAMS2": 452.2845404378323, "JVMS2": 461.5294719498259, "ICFS2": 446.1869380963212, "IPMS2": 447.0931825489499, "DPFS1": 465.0538572172854, "DCFS1": 464.4373045062386, "JCMS2": 461.4879281371013, "JPMS1": 462.4688042314593, "JAFS1": 463.53022226692144, "JCFS2": 466.4571654703747, "DPMS2": 458.37495939263414, "CAMS2": 445.3213973452031, "DAMS2": 465.47108126465804, "IVMS1": 448.661433645334, "CPMS2": 443.1454703480616, "CPFS1": 464.0949618596379, "IVFS1": 444.1805913728395, "CVFS1": 443.4191457100071, "IVMS2": 462.34728057173606, "IPFS2": 443.3502654257153, "JAFS2": 462.32100018229323, "JAMS1": 466.6889204278437, "DVFS2": 461.2144781637043, "JPFS2": 466.55985924497617 }, "fastqc-median_sequence_length": { "CVFS2": 442, "JPFS1": 467, "CCMS1": 442, "ICFS1": 467, "CCFS2": 442, "IAFS2": 467, "DVMS1": 442, "DVMS2": 462, "DCMS2": 467, "JCMS1": 467, "JCFS1": 467, "DPMS1": 467, "CAFS2": 442, "DAMS1": 467, "JAMS2": 467, "IPMS1": 437, "DCMS1": 467, "CAFS1": 442, "IPFS1": 467, "JVFS1": 467, "IVFS2": 467, "DVFS1": 467, "DPFS2": 467, "CVMS1": 442, "JVFS2": 437, "CPMS1": 442, "ICMS1": 467, "CVMS2": 442, "ICMS2": 437, "DCFS2": 467, "CCFS1": 442, "CCMS2": 442, "JVMS1": 467, "CPFS2": 442, "IAFS1": 467, "CAMS1": 442, "JPMS2": 467, "IAMS1": 467, "DAFS1": 467, "DAFS2": 462, "IAMS2": 442, "JVMS2": 467, "ICFS2": 442, "IPMS2": 442, "DPFS1": 467, "DCFS1": 467, "JCMS2": 467, "JPMS1": 467, "JAFS1": 467, "JCFS2": 467, "DPMS2": 467, "CAMS2": 442, "DAMS2": 467, "IVMS1": 442, "CPMS2": 442, "CPFS1": 467, "IVFS1": 437, "CVFS1": 442, "IVMS2": 467, "IPFS2": 442, "JAFS2": 467, "JAMS1": 467, "DVFS2": 467, "JPFS2": 467 }, "fastqc-percent_fails": { "CVFS2": 36.36363636363637, "JPFS1": 45.45454545454545, "CCMS1": 36.36363636363637, "ICFS1": 45.45454545454545, "CCFS2": 45.45454545454545, "IAFS2": 36.36363636363637, "DVMS1": 45.45454545454545, "DVMS2": 45.45454545454545, "DCMS2": 45.45454545454545, "JCMS1": 45.45454545454545, "JCFS1": 45.45454545454545, "DPMS1": 45.45454545454545, "CAFS2": 36.36363636363637, "DAMS1": 36.36363636363637, "JAMS2": 45.45454545454545, "IPMS1": 36.36363636363637, "DCMS1": 45.45454545454545, "CAFS1": 36.36363636363637, "IPFS1": 36.36363636363637, "JVFS1": 36.36363636363637, "IVFS2": 45.45454545454545, "DVFS1": 45.45454545454545, "DPFS2": 45.45454545454545, "CVMS1": 36.36363636363637, "JVFS2": 36.36363636363637, "CPMS1": 45.45454545454545, "ICMS1": 45.45454545454545, "CVMS2": 45.45454545454545, "ICMS2": 45.45454545454545, "DCFS2": 45.45454545454545, "CCFS1": 45.45454545454545, "CCMS2": 36.36363636363637, "JVMS1": 45.45454545454545, "CPFS2": 27.27272727272727, "IAFS1": 36.36363636363637, "CAMS1": 45.45454545454545, "JPMS2": 36.36363636363637, "IAMS1": 36.36363636363637, "DAFS1": 36.36363636363637, "DAFS2": 36.36363636363637, "IAMS2": 36.36363636363637, "JVMS2": 45.45454545454545, "ICFS2": 27.27272727272727, "IPMS2": 36.36363636363637, "DPFS1": 45.45454545454545, "DCFS1": 36.36363636363637, "JCMS2": 36.36363636363637, "JPMS1": 45.45454545454545, "JAFS1": 36.36363636363637, "JCFS2": 36.36363636363637, "DPMS2": 45.45454545454545, "CAMS2": 36.36363636363637, "DAMS2": 36.36363636363637, "IVMS1": 36.36363636363637, "CPMS2": 27.27272727272727, "CPFS1": 45.45454545454545, "IVFS1": 45.45454545454545, "CVFS1": 36.36363636363637, "IVMS2": 45.45454545454545, "IPFS2": 27.27272727272727, "JAFS2": 36.36363636363637, "JAMS1": 45.45454545454545, "DVFS2": 45.45454545454545, "JPFS2": 45.45454545454545 }, "fastqc-total_sequences": { "CVFS2": 0.200734, "JPFS1": 0.226267, "CCMS1": 0.203959, "ICFS1": 0.13446, "CCFS2": 0.19681099999999999, "IAFS2": 0.124952, "DVMS1": 0.157745, "DVMS2": 0.15362599999999998, "DCMS2": 0.086114, "JCMS1": 0.15579099999999999, "JCFS1": 0.181666, "DPMS1": 0.07929699999999999, "CAFS2": 0.148309, "DAMS1": 0.061535, "JAMS2": 0.143943, "IPMS1": 0.334078, "DCMS1": 0.23168699999999998, "CAFS1": 0.16036899999999998, "IPFS1": 0.155183, "JVFS1": 0.105712, "IVFS2": 0.122876, "DVFS1": 0.068891, "DPFS2": 0.12378299999999999, "CVMS1": 0.178171, "JVFS2": 0.14454, "CPMS1": 0.219016, "ICMS1": 0.18825599999999998, "CVMS2": 0.22158999999999998, "ICMS2": 0.12114799999999999, "DCFS2": 0.064901, "CCFS1": 0.21049299999999999, "CCMS2": 0.191306, "JVMS1": 0.33582, "CPFS2": 0.17304, "IAFS1": 0.160629, "CAMS1": 0.143677, "JPMS2": 0.129719, "IAMS1": 0.14802099999999999, "DAFS1": 0.08732, "DAFS2": 0.036488, "IAMS2": 0.148413, "JVMS2": 0.112887, "ICFS2": 0.167066, "IPMS2": 0.236364, "DPFS1": 0.13627699999999998, "DCFS1": 0.11637199999999999, "JCMS2": 0.123179, "JPMS1": 0.204563, "JAFS1": 0.12925899999999999, "JCFS2": 0.146564, "DPMS2": 0.08311299999999999, "CAMS2": 0.163553, "DAMS2": 0.078029, "IVMS1": 0.149786, "CPMS2": 0.197896, "CPFS1": 0.143942, "IVFS1": 0.221417, "CVFS1": 0.213019, "IVMS2": 0.10592299999999999, "IPFS2": 0.217575, "JAFS2": 0.082285, "JAMS1": 0.15959099999999998, "DVFS2": 0.095758, "JPFS2": 0.195517 } }, "scatter_value_by_sample_by_metric": { "fastqc-percent_duplicates": {}, "fastqc-percent_gc": {}, "fastqc-avg_sequence_length": {}, "fastqc-median_sequence_length": {}, "fastqc-percent_fails": {}, "fastqc-total_sequences": {} }, "all_samples": [ "CAFS1", "CAFS2", "CAMS1", "CAMS2", "CCFS1", "CCFS2", "CCMS1", "CCMS2", "CPFS1", "CPFS2", "CPMS1", "CPMS2", "CVFS1", "CVFS2", "CVMS1", "CVMS2", "DAFS1", "DAFS2", "DAMS1", "DAMS2", "DCFS1", "DCFS2", "DCMS1", "DCMS2", "DPFS1", "DPFS2", "DPMS1", "DPMS2", "DVFS1", "DVFS2", "DVMS1", "DVMS2", "IAFS1", "IAFS2", "IAMS1", "IAMS2", "ICFS1", "ICFS2", "ICMS1", "ICMS2", "IPFS1", "IPFS2", "IPMS1", "IPMS2", "IVFS1", "IVFS2", "IVMS1", "IVMS2", "JAFS1", "JAFS2", "JAMS1", "JAMS2", "JCFS1", "JCFS2", "JCMS1", "JCMS2", "JPFS1", "JPFS2", "JPMS1", "JPMS2", "JVFS1", "JVFS2", "JVMS1", "JVMS2" ], "scatter_trace_params": { "mode": "markers", "marker": { "size": 4, "color": "#0b79e6" }, "showlegend": false, "hovertemplate": "%{text}: %{x}", "hoverlabel": { "bgcolor": "white" } } } ], "pconfig": { "id": "general_stats_table", "title": "General Statistics", "anchor": null, "table_title": null, "height": null, "width": null, "square": false, "logswitch": false, "logswitch_active": false, "logswitch_label": "Log10", "cpswitch": true, "cpswitch_c_active": true, "cpswitch_counts_label": "Counts", "cpswitch_percent_label": "Percentages", "xLog": null, "yLog": null, "xlog": false, "ylog": false, "data_labels": [], "xTitle": null, "yTitle": null, "xlab": null, "ylab": null, "xsuffix": null, "ysuffix": null, "tt_suffix": null, "xLabFormat": null, "yLabFormat": null, "xLabelFormat": null, "yLabelFormat": null, "xlab_format": null, "ylab_format": null, "tt_label": null, "xDecimals": null, "yDecimals": null, "decimalPlaces": null, "x_decimals": null, "y_decimals": null, "tt_decimals": null, "xmin": null, "xmax": null, "ymin": null, "ymax": null, "xFloor": null, "xCeiling": null, "yFloor": null, "yCeiling": null, "x_clipmin": null, "x_clipmax": null, "y_clipmin": null, "y_clipmax": null, "save_data_file": true, "showlegend": null, "xMinRange": null, "yMinRange": null, "x_minrange": null, "y_minrange": null, "xPlotBands": null, "yPlotBands": null, "xPlotLines": null, "yPlotLines": null, "x_bands": null, "y_bands": null, "x_lines": null, "y_lines": null, "namespace": "", "save_file": true, "raw_data_fn": "multiqc_general_stats", "defaultsort": null, "sortRows": true, "sort_rows": true, "only_defined_headers": true, "col1_header": "Sample Name", "no_beeswarm": false, "no_violin": false, "scale": "GnBu", "min": null }, "add_log_tab": false, "add_pct_tab": false, "l_active": false, "p_active": false, "pct_axis_update": { "ticksuffix": "%", "hoverformat": ".1f" }, "axis_controlled_by_switches": [], "square": false, "flat": false, "defer_render": false, "violin_height": 70, "extra_height": 63, "no_violin": false, "show_table": true, "show_table_by_default": true, "n_samples": 64, "main_table_dt": { "id": "general_stats_table", "anchor": "general_stats_table_table", "pconfig": { "id": "general_stats_table", "title": "General Statistics", "anchor": null, "table_title": null, "height": null, "width": null, "square": false, "logswitch": false, "logswitch_active": false, "logswitch_label": "Log10", "cpswitch": true, "cpswitch_c_active": true, "cpswitch_counts_label": "Counts", "cpswitch_percent_label": "Percentages", "xLog": null, "yLog": null, "xlog": false, "ylog": false, "data_labels": [], "xTitle": null, "yTitle": null, "xlab": null, "ylab": null, "xsuffix": null, "ysuffix": null, "tt_suffix": null, "xLabFormat": null, "yLabFormat": null, "xLabelFormat": null, "yLabelFormat": null, "xlab_format": null, "ylab_format": null, "tt_label": null, "xDecimals": null, "yDecimals": null, "decimalPlaces": null, "x_decimals": null, "y_decimals": null, "tt_decimals": null, "xmin": null, "xmax": null, "ymin": null, "ymax": null, "xFloor": null, "xCeiling": null, "yFloor": null, "yCeiling": null, "x_clipmin": null, "x_clipmax": null, "y_clipmin": null, "y_clipmax": null, "save_data_file": true, "showlegend": null, "xMinRange": null, "yMinRange": null, "x_minrange": null, "y_minrange": null, "xPlotBands": null, "yPlotBands": null, "xPlotLines": null, "yPlotLines": null, "x_bands": null, "y_bands": null, "x_lines": null, "y_lines": null, "namespace": "", "save_file": true, "raw_data_fn": "multiqc_general_stats", "defaultsort": null, "sortRows": true, "sort_rows": true, "only_defined_headers": true, "col1_header": "Sample Name", "no_beeswarm": false, "no_violin": false, "scale": "GnBu", "min": null }, "sections": [ { "column_by_key": { "percent_duplicates": { "rid": "fastqc-percent_duplicates", "title": "Dups", "description": "% duplicate reads", "scale": "RdYlGn-rev", "hidden": false, "placement": 1000.0, "namespace": "FastQC", "colour": null, "color": null, "max": 100.0, "dmax": 100.0, "min": 0.0, "dmin": 0.0, "ceiling": null, "floor": null, "minRange": null, "minrange": null, "shared_key": null, "tt_decimals": null, "suffix": "%", "cond_formatting_colours": [ { "blue": "#337ab7" }, { "lbue": "#5bc0de" }, { "pass": "#5cb85c" }, { "warn": "#f0ad4e" }, { "fail": "#d9534f" } ], "cond_formatting_rules": {}, "bgcols": {}, "bars_zero_centrepoint": false }, "percent_gc": { "rid": "fastqc-percent_gc", "title": "GC", "description": "Average % GC content", "scale": "PuRd", "hidden": false, "placement": 1000.0, "namespace": "FastQC", "colour": null, "color": null, "max": 100.0, "dmax": 100.0, "min": 0.0, "dmin": 0.0, "ceiling": null, "floor": null, "minRange": null, "minrange": null, "shared_key": null, "tt_decimals": null, "suffix": "%", "cond_formatting_colours": [ { "blue": "#337ab7" }, { "lbue": "#5bc0de" }, { "pass": "#5cb85c" }, { "warn": "#f0ad4e" }, { "fail": "#d9534f" } ], "cond_formatting_rules": {}, "bgcols": {}, "bars_zero_centrepoint": false }, "avg_sequence_length": { "rid": "fastqc-avg_sequence_length", "title": "Avg len", "description": "Average read length", "scale": "RdYlGn", "hidden": true, "placement": 1000.0, "namespace": "FastQC", "colour": null, "color": null, "max": null, "dmax": 466.69301091188726, "min": 0.0, "dmin": 0.0, "ceiling": null, "floor": null, "minRange": null, "minrange": null, "shared_key": null, "tt_decimals": null, "suffix": " bp", "cond_formatting_colours": [ { "blue": "#337ab7" }, { "lbue": "#5bc0de" }, { "pass": "#5cb85c" }, { "warn": "#f0ad4e" }, { "fail": "#d9534f" } ], "cond_formatting_rules": {}, "bgcols": {}, "bars_zero_centrepoint": false }, "median_sequence_length": { "rid": "fastqc-median_sequence_length", "title": "Median len", "description": "Median read length", "scale": "RdYlGn", "hidden": false, "placement": 1000.0, "namespace": "FastQC", "colour": null, "color": null, "max": null, "dmax": 467, "min": 0.0, "dmin": 0.0, "ceiling": null, "floor": null, "minRange": null, "minrange": null, "shared_key": null, "tt_decimals": null, "suffix": " bp", "cond_formatting_colours": [ { "blue": "#337ab7" }, { "lbue": "#5bc0de" }, { "pass": "#5cb85c" }, { "warn": "#f0ad4e" }, { "fail": "#d9534f" } ], "cond_formatting_rules": {}, "bgcols": {}, "bars_zero_centrepoint": false }, "percent_fails": { "rid": "fastqc-percent_fails", "title": "Failed", "description": "Percentage of modules failed in FastQC report (includes those not plotted here)", "scale": "Reds", "hidden": true, "placement": 1000.0, "namespace": "FastQC", "colour": null, "color": null, "max": 100.0, "dmax": 100.0, "min": 0.0, "dmin": 0.0, "ceiling": null, "floor": null, "minRange": null, "minrange": null, "shared_key": null, "tt_decimals": null, "suffix": "%", "cond_formatting_colours": [ { "blue": "#337ab7" }, { "lbue": "#5bc0de" }, { "pass": "#5cb85c" }, { "warn": "#f0ad4e" }, { "fail": "#d9534f" } ], "cond_formatting_rules": {}, "bgcols": {}, "bars_zero_centrepoint": false }, "total_sequences": { "rid": "fastqc-total_sequences", "title": "Seqs", "description": "Total sequences (millions)", "scale": "Blues", "hidden": false, "placement": 1000.0, "namespace": "FastQC", "colour": null, "color": null, "max": null, "dmax": 0.33582, "min": 0.0, "dmin": 0.0, "ceiling": null, "floor": null, "minRange": null, "minrange": null, "shared_key": null, "tt_decimals": null, "suffix": "M", "cond_formatting_colours": [ { "blue": "#337ab7" }, { "lbue": "#5bc0de" }, { "pass": "#5cb85c" }, { "warn": "#f0ad4e" }, { "fail": "#d9534f" } ], "cond_formatting_rules": {}, "bgcols": {}, "bars_zero_centrepoint": false } }, "rows_by_sgroup": { "CVFS2": [ { "sample": "CVFS2", "raw_data": { "total_sequences": 0.200734, "percent_gc": 53.0, "avg_sequence_length": 443.6777127940459, "median_sequence_length": 442, "percent_duplicates": 94.45933424332699, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "53.0", "avg_sequence_length": "444", "median_sequence_length": "442", "percent_duplicates": "94.5", "percent_fails": "36" } } ], "JPFS1": [ { "sample": "JPFS1", "raw_data": { "total_sequences": 0.226267, "percent_gc": 51.0, "avg_sequence_length": 466.69301091188726, "median_sequence_length": 467, "percent_duplicates": 97.96479380554831, "percent_fails": 45.45454545454545 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "51.0", "avg_sequence_length": "467", "median_sequence_length": "467", "percent_duplicates": "98.0", "percent_fails": "45" } } ], "CCMS1": [ { "sample": "CCMS1", "raw_data": { "total_sequences": 0.203959, "percent_gc": 53.0, "avg_sequence_length": 443.09737496261505, "median_sequence_length": 442, "percent_duplicates": 94.4140734167161, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "53.0", "avg_sequence_length": "443", "median_sequence_length": "442", "percent_duplicates": "94.4", "percent_fails": "36" } } ], "ICFS1": [ { "sample": "ICFS1", "raw_data": { "total_sequences": 0.13446, "percent_gc": 52.0, "avg_sequence_length": 456.80890227576975, "median_sequence_length": 467, "percent_duplicates": 93.99003421091774, "percent_fails": 45.45454545454545 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "52.0", "avg_sequence_length": "457", "median_sequence_length": "467", "percent_duplicates": "94.0", "percent_fails": "45" } } ], "CCFS2": [ { "sample": "CCFS2", "raw_data": { "total_sequences": 0.19681099999999999, "percent_gc": 53.0, "avg_sequence_length": 443.7233716611368, "median_sequence_length": 442, "percent_duplicates": 94.11719873381061, "percent_fails": 45.45454545454545 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "53.0", "avg_sequence_length": "444", "median_sequence_length": "442", "percent_duplicates": "94.1", "percent_fails": "45" } } ], "IAFS2": [ { "sample": "IAFS2", "raw_data": { "total_sequences": 0.124952, "percent_gc": 54.0, "avg_sequence_length": 464.7821323388181, "median_sequence_length": 467, "percent_duplicates": 97.94080927075997, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "54.0", "avg_sequence_length": "465", "median_sequence_length": "467", "percent_duplicates": "97.9", "percent_fails": "36" } } ], "DVMS1": [ { "sample": "DVMS1", "raw_data": { "total_sequences": 0.157745, "percent_gc": 52.0, "avg_sequence_length": 450.1387999619639, "median_sequence_length": 442, "percent_duplicates": 93.29297283590606, "percent_fails": 45.45454545454545 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "52.0", "avg_sequence_length": "450", "median_sequence_length": "442", "percent_duplicates": "93.3", "percent_fails": "45" } } ], "DVMS2": [ { "sample": "DVMS2", "raw_data": { "total_sequences": 0.15362599999999998, "percent_gc": 52.0, "avg_sequence_length": 455.1479274341583, "median_sequence_length": 462, "percent_duplicates": 93.72567143582467, "percent_fails": 45.45454545454545 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "52.0", "avg_sequence_length": "455", "median_sequence_length": "462", "percent_duplicates": "93.7", "percent_fails": "45" } } ], "DCMS2": [ { "sample": "DCMS2", "raw_data": { "total_sequences": 0.086114, "percent_gc": 52.0, "avg_sequence_length": 463.30315628120866, "median_sequence_length": 467, "percent_duplicates": 93.62473000905776, "percent_fails": 45.45454545454545 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "52.0", "avg_sequence_length": "463", "median_sequence_length": "467", "percent_duplicates": "93.6", "percent_fails": "45" } } ], "JCMS1": [ { "sample": "JCMS1", "raw_data": { "total_sequences": 0.15579099999999999, "percent_gc": 51.0, "avg_sequence_length": 463.42276190537325, "median_sequence_length": 467, "percent_duplicates": 96.14740260990686, "percent_fails": 45.45454545454545 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "51.0", "avg_sequence_length": "463", "median_sequence_length": "467", "percent_duplicates": "96.1", "percent_fails": "45" } } ], "JCFS1": [ { "sample": "JCFS1", "raw_data": { "total_sequences": 0.181666, "percent_gc": 51.0, "avg_sequence_length": 466.4255336716832, "median_sequence_length": 467, "percent_duplicates": 97.59833981042132, "percent_fails": 45.45454545454545 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "51.0", "avg_sequence_length": "466", "median_sequence_length": "467", "percent_duplicates": "97.6", "percent_fails": "45" } } ], "DPMS1": [ { "sample": "DPMS1", "raw_data": { "total_sequences": 0.07929699999999999, "percent_gc": 52.0, "avg_sequence_length": 456.0338726559643, "median_sequence_length": 467, "percent_duplicates": 93.10692712208532, "percent_fails": 45.45454545454545 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "52.0", "avg_sequence_length": "456", "median_sequence_length": "467", "percent_duplicates": "93.1", "percent_fails": "45" } } ], "CAFS2": [ { "sample": "CAFS2", "raw_data": { "total_sequences": 0.148309, "percent_gc": 53.0, "avg_sequence_length": 445.95572756879216, "median_sequence_length": 442, "percent_duplicates": 95.8633663499855, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "53.0", "avg_sequence_length": "446", "median_sequence_length": "442", "percent_duplicates": "95.9", "percent_fails": "36" } } ], "DAMS1": [ { "sample": "DAMS1", "raw_data": { "total_sequences": 0.061535, "percent_gc": 51.0, "avg_sequence_length": 463.6502559518973, "median_sequence_length": 467, "percent_duplicates": 95.57812626960266, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "51.0", "avg_sequence_length": "464", "median_sequence_length": "467", "percent_duplicates": "95.6", "percent_fails": "36" } } ], "JAMS2": [ { "sample": "JAMS2", "raw_data": { "total_sequences": 0.143943, "percent_gc": 50.0, "avg_sequence_length": 466.340468101957, "median_sequence_length": 467, "percent_duplicates": 97.25863709940741, "percent_fails": 45.45454545454545 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "50.0", "avg_sequence_length": "466", "median_sequence_length": "467", "percent_duplicates": "97.3", "percent_fails": "45" } } ], "IPMS1": [ { "sample": "IPMS1", "raw_data": { "total_sequences": 0.334078, "percent_gc": 53.0, "avg_sequence_length": 439.6916618274774, "median_sequence_length": 437, "percent_duplicates": 96.89802980142362, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.3", "percent_gc": "53.0", "avg_sequence_length": "440", "median_sequence_length": "437", "percent_duplicates": "96.9", "percent_fails": "36" } } ], "DCMS1": [ { "sample": "DCMS1", "raw_data": { "total_sequences": 0.23168699999999998, "percent_gc": 52.0, "avg_sequence_length": 463.4131565430948, "median_sequence_length": 467, "percent_duplicates": 95.98035280356689, "percent_fails": 45.45454545454545 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "52.0", "avg_sequence_length": "463", "median_sequence_length": "467", "percent_duplicates": "96.0", "percent_fails": "45" } } ], "CAFS1": [ { "sample": "CAFS1", "raw_data": { "total_sequences": 0.16036899999999998, "percent_gc": 53.0, "avg_sequence_length": 445.7737561498793, "median_sequence_length": 442, "percent_duplicates": 96.10585586990004, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "53.0", "avg_sequence_length": "446", "median_sequence_length": "442", "percent_duplicates": "96.1", "percent_fails": "36" } } ], "IPFS1": [ { "sample": "IPFS1", "raw_data": { "total_sequences": 0.155183, "percent_gc": 51.0, "avg_sequence_length": 465.9449553108266, "median_sequence_length": 467, "percent_duplicates": 96.4267993272459, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "51.0", "avg_sequence_length": "466", "median_sequence_length": "467", "percent_duplicates": "96.4", "percent_fails": "36" } } ], "JVFS1": [ { "sample": "JVFS1", "raw_data": { "total_sequences": 0.105712, "percent_gc": 51.0, "avg_sequence_length": 466.0567721734524, "median_sequence_length": 467, "percent_duplicates": 96.30505524443772, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "51.0", "avg_sequence_length": "466", "median_sequence_length": "467", "percent_duplicates": "96.3", "percent_fails": "36" } } ], "IVFS2": [ { "sample": "IVFS2", "raw_data": { "total_sequences": 0.122876, "percent_gc": 51.0, "avg_sequence_length": 466.1178505159673, "median_sequence_length": 467, "percent_duplicates": 96.94407370031577, "percent_fails": 45.45454545454545 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "51.0", "avg_sequence_length": "466", "median_sequence_length": "467", "percent_duplicates": "96.9", "percent_fails": "45" } } ], "DVFS1": [ { "sample": "DVFS1", "raw_data": { "total_sequences": 0.068891, "percent_gc": 51.0, "avg_sequence_length": 458.94500733042054, "median_sequence_length": 467, "percent_duplicates": 92.64925752275333, "percent_fails": 45.45454545454545 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "51.0", "avg_sequence_length": "459", "median_sequence_length": "467", "percent_duplicates": "92.6", "percent_fails": "45" } } ], "DPFS2": [ { "sample": "DPFS2", "raw_data": { "total_sequences": 0.12378299999999999, "percent_gc": 52.0, "avg_sequence_length": 464.8087297932673, "median_sequence_length": 467, "percent_duplicates": 94.82885371981612, "percent_fails": 45.45454545454545 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "52.0", "avg_sequence_length": "465", "median_sequence_length": "467", "percent_duplicates": "94.8", "percent_fails": "45" } } ], "CVMS1": [ { "sample": "CVMS1", "raw_data": { "total_sequences": 0.178171, "percent_gc": 52.0, "avg_sequence_length": 444.28740086770574, "median_sequence_length": 442, "percent_duplicates": 94.7017191349883, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "52.0", "avg_sequence_length": "444", "median_sequence_length": "442", "percent_duplicates": "94.7", "percent_fails": "36" } } ], "JVFS2": [ { "sample": "JVFS2", "raw_data": { "total_sequences": 0.14454, "percent_gc": 53.0, "avg_sequence_length": 443.42470596374704, "median_sequence_length": 437, "percent_duplicates": 96.05783866057838, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "53.0", "avg_sequence_length": "443", "median_sequence_length": "437", "percent_duplicates": "96.1", "percent_fails": "36" } } ], "CPMS1": [ { "sample": "CPMS1", "raw_data": { "total_sequences": 0.219016, "percent_gc": 53.0, "avg_sequence_length": 443.2770025934178, "median_sequence_length": 442, "percent_duplicates": 94.4433283413084, "percent_fails": 45.45454545454545 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "53.0", "avg_sequence_length": "443", "median_sequence_length": "442", "percent_duplicates": "94.4", "percent_fails": "45" } } ], "ICMS1": [ { "sample": "ICMS1", "raw_data": { "total_sequences": 0.18825599999999998, "percent_gc": 53.0, "avg_sequence_length": 457.1018241118477, "median_sequence_length": 467, "percent_duplicates": 96.47448155702872, "percent_fails": 45.45454545454545 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "53.0", "avg_sequence_length": "457", "median_sequence_length": "467", "percent_duplicates": "96.5", "percent_fails": "45" } } ], "CVMS2": [ { "sample": "CVMS2", "raw_data": { "total_sequences": 0.22158999999999998, "percent_gc": 52.0, "avg_sequence_length": 444.08152443702335, "median_sequence_length": 442, "percent_duplicates": 94.74163996570242, "percent_fails": 45.45454545454545 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "52.0", "avg_sequence_length": "444", "median_sequence_length": "442", "percent_duplicates": "94.7", "percent_fails": "45" } } ], "ICMS2": [ { "sample": "ICMS2", "raw_data": { "total_sequences": 0.12114799999999999, "percent_gc": 53.0, "avg_sequence_length": 446.28260474791165, "median_sequence_length": 437, "percent_duplicates": 95.67966454254301, "percent_fails": 45.45454545454545 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "53.0", "avg_sequence_length": "446", "median_sequence_length": "437", "percent_duplicates": "95.7", "percent_fails": "45" } } ], "DCFS2": [ { "sample": "DCFS2", "raw_data": { "total_sequences": 0.064901, "percent_gc": 51.0, "avg_sequence_length": 464.471533566509, "median_sequence_length": 467, "percent_duplicates": 93.4346157994484, "percent_fails": 45.45454545454545 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "51.0", "avg_sequence_length": "464", "median_sequence_length": "467", "percent_duplicates": "93.4", "percent_fails": "45" } } ], "CCFS1": [ { "sample": "CCFS1", "raw_data": { "total_sequences": 0.21049299999999999, "percent_gc": 53.0, "avg_sequence_length": 443.8030528331108, "median_sequence_length": 442, "percent_duplicates": 94.58889369242682, "percent_fails": 45.45454545454545 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "53.0", "avg_sequence_length": "444", "median_sequence_length": "442", "percent_duplicates": "94.6", "percent_fails": "45" } } ], "CCMS2": [ { "sample": "CCMS2", "raw_data": { "total_sequences": 0.191306, "percent_gc": 53.0, "avg_sequence_length": 443.0256029607017, "median_sequence_length": 442, "percent_duplicates": 94.36975317031353, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "53.0", "avg_sequence_length": "443", "median_sequence_length": "442", "percent_duplicates": "94.4", "percent_fails": "36" } } ], "JVMS1": [ { "sample": "JVMS1", "raw_data": { "total_sequences": 0.33582, "percent_gc": 51.0, "avg_sequence_length": 463.6972187481389, "median_sequence_length": 467, "percent_duplicates": 97.08266333154666, "percent_fails": 45.45454545454545 }, "formatted_data": { "total_sequences": "0.3", "percent_gc": "51.0", "avg_sequence_length": "464", "median_sequence_length": "467", "percent_duplicates": "97.1", "percent_fails": "45" } } ], "CPFS2": [ { "sample": "CPFS2", "raw_data": { "total_sequences": 0.17304, "percent_gc": 53.0, "avg_sequence_length": 443.6046000924642, "median_sequence_length": 442, "percent_duplicates": 93.91643550624133, "percent_fails": 27.27272727272727 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "53.0", "avg_sequence_length": "444", "median_sequence_length": "442", "percent_duplicates": "93.9", "percent_fails": "27" } } ], "IAFS1": [ { "sample": "IAFS1", "raw_data": { "total_sequences": 0.160629, "percent_gc": 54.0, "avg_sequence_length": 452.8225911883906, "median_sequence_length": 467, "percent_duplicates": 98.1584894383953, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "54.0", "avg_sequence_length": "453", "median_sequence_length": "467", "percent_duplicates": "98.2", "percent_fails": "36" } } ], "CAMS1": [ { "sample": "CAMS1", "raw_data": { "total_sequences": 0.143677, "percent_gc": 53.0, "avg_sequence_length": 444.7415591917983, "median_sequence_length": 442, "percent_duplicates": 95.84345441511168, "percent_fails": 45.45454545454545 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "53.0", "avg_sequence_length": "445", "median_sequence_length": "442", "percent_duplicates": "95.8", "percent_fails": "45" } } ], "JPMS2": [ { "sample": "JPMS2", "raw_data": { "total_sequences": 0.129719, "percent_gc": 51.0, "avg_sequence_length": 464.088645456718, "median_sequence_length": 467, "percent_duplicates": 95.07550937025417, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "51.0", "avg_sequence_length": "464", "median_sequence_length": "467", "percent_duplicates": "95.1", "percent_fails": "36" } } ], "IAMS1": [ { "sample": "IAMS1", "raw_data": { "total_sequences": 0.14802099999999999, "percent_gc": 54.0, "avg_sequence_length": 458.31947156146765, "median_sequence_length": 467, "percent_duplicates": 97.9219164848231, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "54.0", "avg_sequence_length": "458", "median_sequence_length": "467", "percent_duplicates": "97.9", "percent_fails": "36" } } ], "DAFS1": [ { "sample": "DAFS1", "raw_data": { "total_sequences": 0.08732, "percent_gc": 54.0, "avg_sequence_length": 456.9547984425103, "median_sequence_length": 467, "percent_duplicates": 94.95648190563445, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "54.0", "avg_sequence_length": "457", "median_sequence_length": "467", "percent_duplicates": "95.0", "percent_fails": "36" } } ], "DAFS2": [ { "sample": "DAFS2", "raw_data": { "total_sequences": 0.036488, "percent_gc": 54.0, "avg_sequence_length": 454.6640265292699, "median_sequence_length": 462, "percent_duplicates": 91.96722210041658, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.0", "percent_gc": "54.0", "avg_sequence_length": "455", "median_sequence_length": "462", "percent_duplicates": "92.0", "percent_fails": "36" } } ], "IAMS2": [ { "sample": "IAMS2", "raw_data": { "total_sequences": 0.148413, "percent_gc": 54.0, "avg_sequence_length": 452.2845404378323, "median_sequence_length": 442, "percent_duplicates": 96.6512367514975, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "54.0", "avg_sequence_length": "452", "median_sequence_length": "442", "percent_duplicates": "96.7", "percent_fails": "36" } } ], "JVMS2": [ { "sample": "JVMS2", "raw_data": { "total_sequences": 0.112887, "percent_gc": 52.0, "avg_sequence_length": 461.5294719498259, "median_sequence_length": 467, "percent_duplicates": 94.88337895417541, "percent_fails": 45.45454545454545 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "52.0", "avg_sequence_length": "462", "median_sequence_length": "467", "percent_duplicates": "94.9", "percent_fails": "45" } } ], "ICFS2": [ { "sample": "ICFS2", "raw_data": { "total_sequences": 0.167066, "percent_gc": 53.0, "avg_sequence_length": 446.1869380963212, "median_sequence_length": 442, "percent_duplicates": 93.34993355919218, "percent_fails": 27.27272727272727 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "53.0", "avg_sequence_length": "446", "median_sequence_length": "442", "percent_duplicates": "93.3", "percent_fails": "27" } } ], "IPMS2": [ { "sample": "IPMS2", "raw_data": { "total_sequences": 0.236364, "percent_gc": 53.0, "avg_sequence_length": 447.0931825489499, "median_sequence_length": 442, "percent_duplicates": 95.7074681423567, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "53.0", "avg_sequence_length": "447", "median_sequence_length": "442", "percent_duplicates": "95.7", "percent_fails": "36" } } ], "DPFS1": [ { "sample": "DPFS1", "raw_data": { "total_sequences": 0.13627699999999998, "percent_gc": 52.0, "avg_sequence_length": 465.0538572172854, "median_sequence_length": 467, "percent_duplicates": 95.38660228798696, "percent_fails": 45.45454545454545 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "52.0", "avg_sequence_length": "465", "median_sequence_length": "467", "percent_duplicates": "95.4", "percent_fails": "45" } } ], "DCFS1": [ { "sample": "DCFS1", "raw_data": { "total_sequences": 0.11637199999999999, "percent_gc": 51.0, "avg_sequence_length": 464.4373045062386, "median_sequence_length": 467, "percent_duplicates": 95.22049977657856, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "51.0", "avg_sequence_length": "464", "median_sequence_length": "467", "percent_duplicates": "95.2", "percent_fails": "36" } } ], "JCMS2": [ { "sample": "JCMS2", "raw_data": { "total_sequences": 0.123179, "percent_gc": 52.0, "avg_sequence_length": 461.4879281371013, "median_sequence_length": 467, "percent_duplicates": 94.80268552269462, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "52.0", "avg_sequence_length": "461", "median_sequence_length": "467", "percent_duplicates": "94.8", "percent_fails": "36" } } ], "JPMS1": [ { "sample": "JPMS1", "raw_data": { "total_sequences": 0.204563, "percent_gc": 51.0, "avg_sequence_length": 462.4688042314593, "median_sequence_length": 467, "percent_duplicates": 95.72063374119465, "percent_fails": 45.45454545454545 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "51.0", "avg_sequence_length": "462", "median_sequence_length": "467", "percent_duplicates": "95.7", "percent_fails": "45" } } ], "JAFS1": [ { "sample": "JAFS1", "raw_data": { "total_sequences": 0.12925899999999999, "percent_gc": 53.0, "avg_sequence_length": 463.53022226692144, "median_sequence_length": 467, "percent_duplicates": 96.61919092674398, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "53.0", "avg_sequence_length": "464", "median_sequence_length": "467", "percent_duplicates": "96.6", "percent_fails": "36" } } ], "JCFS2": [ { "sample": "JCFS2", "raw_data": { "total_sequences": 0.146564, "percent_gc": 51.0, "avg_sequence_length": 466.4571654703747, "median_sequence_length": 467, "percent_duplicates": 97.28241587292923, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "51.0", "avg_sequence_length": "466", "median_sequence_length": "467", "percent_duplicates": "97.3", "percent_fails": "36" } } ], "DPMS2": [ { "sample": "DPMS2", "raw_data": { "total_sequences": 0.08311299999999999, "percent_gc": 52.0, "avg_sequence_length": 458.37495939263414, "median_sequence_length": 467, "percent_duplicates": 92.43800608809693, "percent_fails": 45.45454545454545 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "52.0", "avg_sequence_length": "458", "median_sequence_length": "467", "percent_duplicates": "92.4", "percent_fails": "45" } } ], "CAMS2": [ { "sample": "CAMS2", "raw_data": { "total_sequences": 0.163553, "percent_gc": 53.0, "avg_sequence_length": 445.3213973452031, "median_sequence_length": 442, "percent_duplicates": 96.1841115723955, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "53.0", "avg_sequence_length": "445", "median_sequence_length": "442", "percent_duplicates": "96.2", "percent_fails": "36" } } ], "DAMS2": [ { "sample": "DAMS2", "raw_data": { "total_sequences": 0.078029, "percent_gc": 50.0, "avg_sequence_length": 465.47108126465804, "median_sequence_length": 467, "percent_duplicates": 96.90243371054352, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "50.0", "avg_sequence_length": "465", "median_sequence_length": "467", "percent_duplicates": "96.9", "percent_fails": "36" } } ], "IVMS1": [ { "sample": "IVMS1", "raw_data": { "total_sequences": 0.149786, "percent_gc": 52.0, "avg_sequence_length": 448.661433645334, "median_sequence_length": 442, "percent_duplicates": 94.98017171164194, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "52.0", "avg_sequence_length": "449", "median_sequence_length": "442", "percent_duplicates": "95.0", "percent_fails": "36" } } ], "CPMS2": [ { "sample": "CPMS2", "raw_data": { "total_sequences": 0.197896, "percent_gc": 53.0, "avg_sequence_length": 443.1454703480616, "median_sequence_length": 442, "percent_duplicates": 94.4743703763593, "percent_fails": 27.27272727272727 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "53.0", "avg_sequence_length": "443", "median_sequence_length": "442", "percent_duplicates": "94.5", "percent_fails": "27" } } ], "CPFS1": [ { "sample": "CPFS1", "raw_data": { "total_sequences": 0.143942, "percent_gc": 54.0, "avg_sequence_length": 464.0949618596379, "median_sequence_length": 467, "percent_duplicates": 95.57043809312084, "percent_fails": 45.45454545454545 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "54.0", "avg_sequence_length": "464", "median_sequence_length": "467", "percent_duplicates": "95.6", "percent_fails": "45" } } ], "IVFS1": [ { "sample": "IVFS1", "raw_data": { "total_sequences": 0.221417, "percent_gc": 53.0, "avg_sequence_length": 444.1805913728395, "median_sequence_length": 437, "percent_duplicates": 97.20301512530655, "percent_fails": 45.45454545454545 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "53.0", "avg_sequence_length": "444", "median_sequence_length": "437", "percent_duplicates": "97.2", "percent_fails": "45" } } ], "CVFS1": [ { "sample": "CVFS1", "raw_data": { "total_sequences": 0.213019, "percent_gc": 53.0, "avg_sequence_length": 443.4191457100071, "median_sequence_length": 442, "percent_duplicates": 94.4122355282862, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "53.0", "avg_sequence_length": "443", "median_sequence_length": "442", "percent_duplicates": "94.4", "percent_fails": "36" } } ], "IVMS2": [ { "sample": "IVMS2", "raw_data": { "total_sequences": 0.10592299999999999, "percent_gc": 51.0, "avg_sequence_length": 462.34728057173606, "median_sequence_length": 467, "percent_duplicates": 95.85075951398657, "percent_fails": 45.45454545454545 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "51.0", "avg_sequence_length": "462", "median_sequence_length": "467", "percent_duplicates": "95.9", "percent_fails": "45" } } ], "IPFS2": [ { "sample": "IPFS2", "raw_data": { "total_sequences": 0.217575, "percent_gc": 53.0, "avg_sequence_length": 443.3502654257153, "median_sequence_length": 442, "percent_duplicates": 94.52878317821441, "percent_fails": 27.27272727272727 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "53.0", "avg_sequence_length": "443", "median_sequence_length": "442", "percent_duplicates": "94.5", "percent_fails": "27" } } ], "JAFS2": [ { "sample": "JAFS2", "raw_data": { "total_sequences": 0.082285, "percent_gc": 54.0, "avg_sequence_length": 462.32100018229323, "median_sequence_length": 467, "percent_duplicates": 96.01628486358389, "percent_fails": 36.36363636363637 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "54.0", "avg_sequence_length": "462", "median_sequence_length": "467", "percent_duplicates": "96.0", "percent_fails": "36" } } ], "JAMS1": [ { "sample": "JAMS1", "raw_data": { "total_sequences": 0.15959099999999998, "percent_gc": 50.0, "avg_sequence_length": 466.6889204278437, "median_sequence_length": 467, "percent_duplicates": 98.31632109580114, "percent_fails": 45.45454545454545 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "50.0", "avg_sequence_length": "467", "median_sequence_length": "467", "percent_duplicates": "98.3", "percent_fails": "45" } } ], "DVFS2": [ { "sample": "DVFS2", "raw_data": { "total_sequences": 0.095758, "percent_gc": 51.0, "avg_sequence_length": 461.2144781637043, "median_sequence_length": 467, "percent_duplicates": 93.66945842645, "percent_fails": 45.45454545454545 }, "formatted_data": { "total_sequences": "0.1", "percent_gc": "51.0", "avg_sequence_length": "461", "median_sequence_length": "467", "percent_duplicates": "93.7", "percent_fails": "45" } } ], "JPFS2": [ { "sample": "JPFS2", "raw_data": { "total_sequences": 0.195517, "percent_gc": 51.0, "avg_sequence_length": 466.55985924497617, "median_sequence_length": 467, "percent_duplicates": 97.44523494120716, "percent_fails": 45.45454545454545 }, "formatted_data": { "total_sequences": "0.2", "percent_gc": "51.0", "avg_sequence_length": "467", "median_sequence_length": "467", "percent_duplicates": "97.4", "percent_fails": "45" } } ] } } ], "headers_in_order": { "1000.0": [ [ 0, "percent_duplicates" ], [ 0, "percent_gc" ], [ 0, "avg_sequence_length" ], [ 0, "median_sequence_length" ], [ 0, "percent_fails" ], [ 0, "total_sequences" ] ] } } } }, "report_saved_raw_data": { "multiqc_fastqc": { "CVFS2": { "Filename": "CVFS2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 200734.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "316-477", "%GC": 53.0, "total_deduplicated_percentage": 5.54066575667301, "avg_sequence_length": 443.6777127940459, "median_sequence_length": 442, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "JPFS1": { "Filename": "JPFS1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 226267.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "316-495", "%GC": 51.0, "total_deduplicated_percentage": 2.0352061944516877, "avg_sequence_length": 466.69301091188726, "median_sequence_length": 467, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "fail", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "CCMS1": { "Filename": "CCMS1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 203959.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "316-467", "%GC": 53.0, "total_deduplicated_percentage": 5.585926583283896, "avg_sequence_length": 443.09737496261505, "median_sequence_length": 442, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "ICFS1": { "Filename": "ICFS1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 134460.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "319-484", "%GC": 52.0, "total_deduplicated_percentage": 6.009965789082255, "avg_sequence_length": 456.80890227576975, "median_sequence_length": 467, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "fail", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "CCFS2": { "Filename": "CCFS2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 196811.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "303-477", "%GC": 53.0, "total_deduplicated_percentage": 5.88280126618939, "avg_sequence_length": 443.7233716611368, "median_sequence_length": 442, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "fail", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "IAFS2": { "Filename": "IAFS2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 124952.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "322-496", "%GC": 54.0, "total_deduplicated_percentage": 2.059190729240028, "avg_sequence_length": 464.7821323388181, "median_sequence_length": 467, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "DVMS1": { "Filename": "DVMS1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 157745.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "301-483", "%GC": 52.0, "total_deduplicated_percentage": 6.70702716409395, "avg_sequence_length": 450.1387999619639, "median_sequence_length": 442, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "fail", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "DVMS2": { "Filename": "DVMS2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 153626.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "307-490", "%GC": 52.0, "total_deduplicated_percentage": 6.2743285641753355, "avg_sequence_length": 455.1479274341583, "median_sequence_length": 462, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "fail", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "DCMS2": { "Filename": "DCMS2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 86114.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "300-499", "%GC": 52.0, "total_deduplicated_percentage": 6.37526999094224, "avg_sequence_length": 463.30315628120866, "median_sequence_length": 467, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "fail", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "JCMS1": { "Filename": "JCMS1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 155791.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "300-480", "%GC": 51.0, "total_deduplicated_percentage": 3.8525973900931376, "avg_sequence_length": 463.42276190537325, "median_sequence_length": 467, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "fail", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "JCFS1": { "Filename": "JCFS1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 181666.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "310-491", "%GC": 51.0, "total_deduplicated_percentage": 2.4016601895786773, "avg_sequence_length": 466.4255336716832, "median_sequence_length": 467, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "fail", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "DPMS1": { "Filename": "DPMS1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 79297.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "310-496", "%GC": 52.0, "total_deduplicated_percentage": 6.893072877914676, "avg_sequence_length": 456.0338726559643, "median_sequence_length": 467, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "fail", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "CAFS2": { "Filename": "CAFS2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 148309.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "303-469", "%GC": 53.0, "total_deduplicated_percentage": 4.136633650014497, "avg_sequence_length": 445.95572756879216, "median_sequence_length": 442, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "DAMS1": { "Filename": "DAMS1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 61535.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "339-490", "%GC": 51.0, "total_deduplicated_percentage": 4.421873730397334, "avg_sequence_length": 463.6502559518973, "median_sequence_length": 467, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "JAMS2": { "Filename": "JAMS2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 143943.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "352-489", "%GC": 50.0, "total_deduplicated_percentage": 2.7413629005925957, "avg_sequence_length": 466.340468101957, "median_sequence_length": 467, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "fail", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "IPMS1": { "Filename": "IPMS1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 334078.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "301-473", "%GC": 53.0, "total_deduplicated_percentage": 3.1019701985763803, "avg_sequence_length": 439.6916618274774, "median_sequence_length": 437, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "DCMS1": { "Filename": "DCMS1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 231687.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "300-483", "%GC": 52.0, "total_deduplicated_percentage": 4.019647196433119, "avg_sequence_length": 463.4131565430948, "median_sequence_length": 467, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "fail", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "CAFS1": { "Filename": "CAFS1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 160369.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "301-490", "%GC": 53.0, "total_deduplicated_percentage": 3.8941441300999573, "avg_sequence_length": 445.7737561498793, "median_sequence_length": 442, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "IPFS1": { "Filename": "IPFS1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 155183.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "317-484", "%GC": 51.0, "total_deduplicated_percentage": 3.573200672754103, "avg_sequence_length": 465.9449553108266, "median_sequence_length": 467, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "JVFS1": { "Filename": "JVFS1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 105712.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "303-477", "%GC": 51.0, "total_deduplicated_percentage": 3.694944755562282, "avg_sequence_length": 466.0567721734524, "median_sequence_length": 467, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "IVFS2": { "Filename": "IVFS2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 122876.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "323-488", "%GC": 51.0, "total_deduplicated_percentage": 3.0559262996842347, "avg_sequence_length": 466.1178505159673, "median_sequence_length": 467, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "fail", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "DVFS1": { "Filename": "DVFS1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 68891.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "300-490", "%GC": 51.0, "total_deduplicated_percentage": 7.350742477246665, "avg_sequence_length": 458.94500733042054, "median_sequence_length": 467, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "fail", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "DPFS2": { "Filename": "DPFS2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 123783.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "300-496", "%GC": 52.0, "total_deduplicated_percentage": 5.17114628018387, "avg_sequence_length": 464.8087297932673, "median_sequence_length": 467, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "fail", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "CVMS1": { "Filename": "CVMS1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 178171.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "315-480", "%GC": 52.0, "total_deduplicated_percentage": 5.298280865011702, "avg_sequence_length": 444.28740086770574, "median_sequence_length": 442, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "JVFS2": { "Filename": "JVFS2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 144540.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "326-475", "%GC": 53.0, "total_deduplicated_percentage": 3.9421613394216135, "avg_sequence_length": 443.42470596374704, "median_sequence_length": 437, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "CPMS1": { "Filename": "CPMS1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 219016.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "305-486", "%GC": 53.0, "total_deduplicated_percentage": 5.556671658691602, "avg_sequence_length": 443.2770025934178, "median_sequence_length": 442, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "fail", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "ICMS1": { "Filename": "ICMS1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 188256.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "321-491", "%GC": 53.0, "total_deduplicated_percentage": 3.5255184429712734, "avg_sequence_length": 457.1018241118477, "median_sequence_length": 467, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "fail", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "CVMS2": { "Filename": "CVMS2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 221590.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "316-473", "%GC": 52.0, "total_deduplicated_percentage": 5.258360034297577, "avg_sequence_length": 444.08152443702335, "median_sequence_length": 442, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "fail", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "ICMS2": { "Filename": "ICMS2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 121148.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "362-482", "%GC": 53.0, "total_deduplicated_percentage": 4.320335457456995, "avg_sequence_length": 446.28260474791165, "median_sequence_length": 437, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "fail", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "DCFS2": { "Filename": "DCFS2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 64901.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "300-499", "%GC": 51.0, "total_deduplicated_percentage": 6.565384200551609, "avg_sequence_length": 464.471533566509, "median_sequence_length": 467, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "fail", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "CCFS1": { "Filename": "CCFS1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 210493.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "306-473", "%GC": 53.0, "total_deduplicated_percentage": 5.411106307573173, "avg_sequence_length": 443.8030528331108, "median_sequence_length": 442, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "fail", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "CCMS2": { "Filename": "CCMS2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 191306.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "310-481", "%GC": 53.0, "total_deduplicated_percentage": 5.630246829686471, "avg_sequence_length": 443.0256029607017, "median_sequence_length": 442, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "JVMS1": { "Filename": "JVMS1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 335820.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "306-494", "%GC": 51.0, "total_deduplicated_percentage": 2.917336668453338, "avg_sequence_length": 463.6972187481389, "median_sequence_length": 467, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "fail", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "CPFS2": { "Filename": "CPFS2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 173040.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "310-468", "%GC": 53.0, "total_deduplicated_percentage": 6.083564493758669, "avg_sequence_length": 443.6046000924642, "median_sequence_length": 442, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "warn", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "IAFS1": { "Filename": "IAFS1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 160629.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "350-475", "%GC": 54.0, "total_deduplicated_percentage": 1.8415105616046916, "avg_sequence_length": 452.8225911883906, "median_sequence_length": 467, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "CAMS1": { "Filename": "CAMS1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 143677.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "317-481", "%GC": 53.0, "total_deduplicated_percentage": 4.156545584888326, "avg_sequence_length": 444.7415591917983, "median_sequence_length": 442, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "fail", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "JPMS2": { "Filename": "JPMS2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 129719.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "338-480", "%GC": 51.0, "total_deduplicated_percentage": 4.9244906297458355, "avg_sequence_length": 464.088645456718, "median_sequence_length": 467, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "IAMS1": { "Filename": "IAMS1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 148021.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "321-497", "%GC": 54.0, "total_deduplicated_percentage": 2.0780835151769006, "avg_sequence_length": 458.31947156146765, "median_sequence_length": 467, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "DAFS1": { "Filename": "DAFS1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 87320.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "315-476", "%GC": 54.0, "total_deduplicated_percentage": 5.0435180943655515, "avg_sequence_length": 456.9547984425103, "median_sequence_length": 467, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "DAFS2": { "Filename": "DAFS2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 36488.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "322-474", "%GC": 54.0, "total_deduplicated_percentage": 8.032777899583426, "avg_sequence_length": 454.6640265292699, "median_sequence_length": 462, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "IAMS2": { "Filename": "IAMS2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 148413.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "344-487", "%GC": 54.0, "total_deduplicated_percentage": 3.3487632485024896, "avg_sequence_length": 452.2845404378323, "median_sequence_length": 442, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "JVMS2": { "Filename": "JVMS2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 112887.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "344-480", "%GC": 52.0, "total_deduplicated_percentage": 5.116621045824585, "avg_sequence_length": 461.5294719498259, "median_sequence_length": 467, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "fail", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "ICFS2": { "Filename": "ICFS2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 167066.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "316-478", "%GC": 53.0, "total_deduplicated_percentage": 6.650066440807824, "avg_sequence_length": 446.1869380963212, "median_sequence_length": 442, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "warn", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "IPMS2": { "Filename": "IPMS2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 236364.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "316-484", "%GC": 53.0, "total_deduplicated_percentage": 4.292531857643296, "avg_sequence_length": 447.0931825489499, "median_sequence_length": 442, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "DPFS1": { "Filename": "DPFS1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 136277.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "308-490", "%GC": 52.0, "total_deduplicated_percentage": 4.6133977120130325, "avg_sequence_length": 465.0538572172854, "median_sequence_length": 467, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "fail", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "DCFS1": { "Filename": "DCFS1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 116372.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "302-490", "%GC": 51.0, "total_deduplicated_percentage": 4.779500223421442, "avg_sequence_length": 464.4373045062386, "median_sequence_length": 467, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "JCMS2": { "Filename": "JCMS2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 123179.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "319-477", "%GC": 52.0, "total_deduplicated_percentage": 5.197314477305385, "avg_sequence_length": 461.4879281371013, "median_sequence_length": 467, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "JPMS1": { "Filename": "JPMS1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 204563.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "344-483", "%GC": 51.0, "total_deduplicated_percentage": 4.279366258805356, "avg_sequence_length": 462.4688042314593, "median_sequence_length": 467, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "fail", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "JAFS1": { "Filename": "JAFS1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 129259.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "319-489", "%GC": 53.0, "total_deduplicated_percentage": 3.3808090732560205, "avg_sequence_length": 463.53022226692144, "median_sequence_length": 467, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "JCFS2": { "Filename": "JCFS2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 146564.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "301-483", "%GC": 51.0, "total_deduplicated_percentage": 2.7175841270707677, "avg_sequence_length": 466.4571654703747, "median_sequence_length": 467, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "DPMS2": { "Filename": "DPMS2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 83113.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "307-490", "%GC": 52.0, "total_deduplicated_percentage": 7.5619939119030715, "avg_sequence_length": 458.37495939263414, "median_sequence_length": 467, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "fail", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "CAMS2": { "Filename": "CAMS2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 163553.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "317-472", "%GC": 53.0, "total_deduplicated_percentage": 3.815888427604507, "avg_sequence_length": 445.3213973452031, "median_sequence_length": 442, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "DAMS2": { "Filename": "DAMS2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 78029.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "322-483", "%GC": 50.0, "total_deduplicated_percentage": 3.097566289456484, "avg_sequence_length": 465.47108126465804, "median_sequence_length": 467, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "IVMS1": { "Filename": "IVMS1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 149786.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "300-487", "%GC": 52.0, "total_deduplicated_percentage": 5.019828288358057, "avg_sequence_length": 448.661433645334, "median_sequence_length": 442, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "CPMS2": { "Filename": "CPMS2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 197896.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "316-482", "%GC": 53.0, "total_deduplicated_percentage": 5.5256296236407, "avg_sequence_length": 443.1454703480616, "median_sequence_length": 442, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "warn", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "CPFS1": { "Filename": "CPFS1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 143942.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "300-491", "%GC": 54.0, "total_deduplicated_percentage": 4.42956190687916, "avg_sequence_length": 464.0949618596379, "median_sequence_length": 467, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "fail", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "IVFS1": { "Filename": "IVFS1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 221417.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "319-498", "%GC": 53.0, "total_deduplicated_percentage": 2.7969848746934516, "avg_sequence_length": 444.1805913728395, "median_sequence_length": 437, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "fail", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "CVFS1": { "Filename": "CVFS1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 213019.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "315-493", "%GC": 53.0, "total_deduplicated_percentage": 5.587764471713791, "avg_sequence_length": 443.4191457100071, "median_sequence_length": 442, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "IVMS2": { "Filename": "IVMS2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 105923.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "328-488", "%GC": 51.0, "total_deduplicated_percentage": 4.149240486013425, "avg_sequence_length": 462.34728057173606, "median_sequence_length": 467, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "fail", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "IPFS2": { "Filename": "IPFS2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 217575.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "301-487", "%GC": 53.0, "total_deduplicated_percentage": 5.471216821785592, "avg_sequence_length": 443.3502654257153, "median_sequence_length": 442, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "warn", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "JAFS2": { "Filename": "JAFS2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 82285.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "364-480", "%GC": 54.0, "total_deduplicated_percentage": 3.9837151364161145, "avg_sequence_length": 462.32100018229323, "median_sequence_length": 467, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "pass", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "JAMS1": { "Filename": "JAMS1.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 159591.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "321-487", "%GC": 50.0, "total_deduplicated_percentage": 1.6836789041988585, "avg_sequence_length": 466.6889204278437, "median_sequence_length": 467, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "fail", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "DVFS2": { "Filename": "DVFS2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 95758.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "300-499", "%GC": 51.0, "total_deduplicated_percentage": 6.33054157354999, "avg_sequence_length": 461.2144781637043, "median_sequence_length": 467, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "fail", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" }, "JPFS2": { "Filename": "JPFS2.fastq", "File type": "Conventional base calls", "Encoding": "Sanger / Illumina 1.9", "Total Sequences": 195517.0, "Sequences flagged as poor quality": 0.0, "Sequence length": "344-489", "%GC": 51.0, "total_deduplicated_percentage": 2.5547650587928414, "avg_sequence_length": 466.55985924497617, "median_sequence_length": 467, "basic_statistics": "pass", "per_base_sequence_quality": "pass", "per_tile_sequence_quality": "fail", "per_sequence_quality_scores": "pass", "per_base_sequence_content": "fail", "per_sequence_gc_content": "fail", "per_base_n_content": "pass", "sequence_length_distribution": "warn", "sequence_duplication_levels": "fail", "overrepresented_sequences": "fail", "adapter_content": "pass" } }, "multiqc_general_stats": { "CVFS2": { "fastqc-percent_duplicates": 94.45933424332699, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 443.6777127940459, "fastqc-median_sequence_length": 442, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.200734 }, "JPFS1": { "fastqc-percent_duplicates": 97.96479380554831, "fastqc-percent_gc": 51.0, "fastqc-avg_sequence_length": 466.69301091188726, "fastqc-median_sequence_length": 467, "fastqc-percent_fails": 45.45454545454545, "fastqc-total_sequences": 0.226267 }, "CCMS1": { "fastqc-percent_duplicates": 94.4140734167161, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 443.09737496261505, "fastqc-median_sequence_length": 442, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.203959 }, "ICFS1": { "fastqc-percent_duplicates": 93.99003421091774, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 456.80890227576975, "fastqc-median_sequence_length": 467, "fastqc-percent_fails": 45.45454545454545, "fastqc-total_sequences": 0.13446 }, "CCFS2": { "fastqc-percent_duplicates": 94.11719873381061, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 443.7233716611368, "fastqc-median_sequence_length": 442, "fastqc-percent_fails": 45.45454545454545, "fastqc-total_sequences": 0.19681099999999999 }, "IAFS2": { "fastqc-percent_duplicates": 97.94080927075997, "fastqc-percent_gc": 54.0, "fastqc-avg_sequence_length": 464.7821323388181, "fastqc-median_sequence_length": 467, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.124952 }, "DVMS1": { "fastqc-percent_duplicates": 93.29297283590606, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 450.1387999619639, "fastqc-median_sequence_length": 442, "fastqc-percent_fails": 45.45454545454545, "fastqc-total_sequences": 0.157745 }, "DVMS2": { "fastqc-percent_duplicates": 93.72567143582467, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 455.1479274341583, "fastqc-median_sequence_length": 462, "fastqc-percent_fails": 45.45454545454545, "fastqc-total_sequences": 0.15362599999999998 }, "DCMS2": { "fastqc-percent_duplicates": 93.62473000905776, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 463.30315628120866, "fastqc-median_sequence_length": 467, "fastqc-percent_fails": 45.45454545454545, "fastqc-total_sequences": 0.086114 }, "JCMS1": { "fastqc-percent_duplicates": 96.14740260990686, "fastqc-percent_gc": 51.0, "fastqc-avg_sequence_length": 463.42276190537325, "fastqc-median_sequence_length": 467, "fastqc-percent_fails": 45.45454545454545, "fastqc-total_sequences": 0.15579099999999999 }, "JCFS1": { "fastqc-percent_duplicates": 97.59833981042132, "fastqc-percent_gc": 51.0, "fastqc-avg_sequence_length": 466.4255336716832, "fastqc-median_sequence_length": 467, "fastqc-percent_fails": 45.45454545454545, "fastqc-total_sequences": 0.181666 }, "DPMS1": { "fastqc-percent_duplicates": 93.10692712208532, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 456.0338726559643, "fastqc-median_sequence_length": 467, "fastqc-percent_fails": 45.45454545454545, "fastqc-total_sequences": 0.07929699999999999 }, "CAFS2": { "fastqc-percent_duplicates": 95.8633663499855, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 445.95572756879216, "fastqc-median_sequence_length": 442, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.148309 }, "DAMS1": { "fastqc-percent_duplicates": 95.57812626960266, "fastqc-percent_gc": 51.0, "fastqc-avg_sequence_length": 463.6502559518973, "fastqc-median_sequence_length": 467, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.061535 }, "JAMS2": { "fastqc-percent_duplicates": 97.25863709940741, "fastqc-percent_gc": 50.0, "fastqc-avg_sequence_length": 466.340468101957, "fastqc-median_sequence_length": 467, "fastqc-percent_fails": 45.45454545454545, "fastqc-total_sequences": 0.143943 }, "IPMS1": { "fastqc-percent_duplicates": 96.89802980142362, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 439.6916618274774, "fastqc-median_sequence_length": 437, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.334078 }, "DCMS1": { "fastqc-percent_duplicates": 95.98035280356689, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 463.4131565430948, "fastqc-median_sequence_length": 467, "fastqc-percent_fails": 45.45454545454545, "fastqc-total_sequences": 0.23168699999999998 }, "CAFS1": { "fastqc-percent_duplicates": 96.10585586990004, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 445.7737561498793, "fastqc-median_sequence_length": 442, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.16036899999999998 }, "IPFS1": { "fastqc-percent_duplicates": 96.4267993272459, "fastqc-percent_gc": 51.0, "fastqc-avg_sequence_length": 465.9449553108266, "fastqc-median_sequence_length": 467, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.155183 }, "JVFS1": { "fastqc-percent_duplicates": 96.30505524443772, "fastqc-percent_gc": 51.0, "fastqc-avg_sequence_length": 466.0567721734524, "fastqc-median_sequence_length": 467, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.105712 }, "IVFS2": { "fastqc-percent_duplicates": 96.94407370031577, "fastqc-percent_gc": 51.0, "fastqc-avg_sequence_length": 466.1178505159673, "fastqc-median_sequence_length": 467, "fastqc-percent_fails": 45.45454545454545, "fastqc-total_sequences": 0.122876 }, "DVFS1": { "fastqc-percent_duplicates": 92.64925752275333, "fastqc-percent_gc": 51.0, "fastqc-avg_sequence_length": 458.94500733042054, "fastqc-median_sequence_length": 467, "fastqc-percent_fails": 45.45454545454545, "fastqc-total_sequences": 0.068891 }, "DPFS2": { "fastqc-percent_duplicates": 94.82885371981612, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 464.8087297932673, "fastqc-median_sequence_length": 467, "fastqc-percent_fails": 45.45454545454545, "fastqc-total_sequences": 0.12378299999999999 }, "CVMS1": { "fastqc-percent_duplicates": 94.7017191349883, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 444.28740086770574, "fastqc-median_sequence_length": 442, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.178171 }, "JVFS2": { "fastqc-percent_duplicates": 96.05783866057838, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 443.42470596374704, "fastqc-median_sequence_length": 437, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.14454 }, "CPMS1": { "fastqc-percent_duplicates": 94.4433283413084, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 443.2770025934178, "fastqc-median_sequence_length": 442, "fastqc-percent_fails": 45.45454545454545, "fastqc-total_sequences": 0.219016 }, "ICMS1": { "fastqc-percent_duplicates": 96.47448155702872, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 457.1018241118477, "fastqc-median_sequence_length": 467, "fastqc-percent_fails": 45.45454545454545, "fastqc-total_sequences": 0.18825599999999998 }, "CVMS2": { "fastqc-percent_duplicates": 94.74163996570242, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 444.08152443702335, "fastqc-median_sequence_length": 442, "fastqc-percent_fails": 45.45454545454545, "fastqc-total_sequences": 0.22158999999999998 }, "ICMS2": { "fastqc-percent_duplicates": 95.67966454254301, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 446.28260474791165, "fastqc-median_sequence_length": 437, "fastqc-percent_fails": 45.45454545454545, "fastqc-total_sequences": 0.12114799999999999 }, "DCFS2": { "fastqc-percent_duplicates": 93.4346157994484, "fastqc-percent_gc": 51.0, "fastqc-avg_sequence_length": 464.471533566509, "fastqc-median_sequence_length": 467, "fastqc-percent_fails": 45.45454545454545, "fastqc-total_sequences": 0.064901 }, "CCFS1": { "fastqc-percent_duplicates": 94.58889369242682, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 443.8030528331108, "fastqc-median_sequence_length": 442, "fastqc-percent_fails": 45.45454545454545, "fastqc-total_sequences": 0.21049299999999999 }, "CCMS2": { "fastqc-percent_duplicates": 94.36975317031353, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 443.0256029607017, "fastqc-median_sequence_length": 442, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.191306 }, "JVMS1": { "fastqc-percent_duplicates": 97.08266333154666, "fastqc-percent_gc": 51.0, "fastqc-avg_sequence_length": 463.6972187481389, "fastqc-median_sequence_length": 467, "fastqc-percent_fails": 45.45454545454545, "fastqc-total_sequences": 0.33582 }, "CPFS2": { "fastqc-percent_duplicates": 93.91643550624133, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 443.6046000924642, "fastqc-median_sequence_length": 442, "fastqc-percent_fails": 27.27272727272727, "fastqc-total_sequences": 0.17304 }, "IAFS1": { "fastqc-percent_duplicates": 98.1584894383953, "fastqc-percent_gc": 54.0, "fastqc-avg_sequence_length": 452.8225911883906, "fastqc-median_sequence_length": 467, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.160629 }, "CAMS1": { "fastqc-percent_duplicates": 95.84345441511168, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 444.7415591917983, "fastqc-median_sequence_length": 442, "fastqc-percent_fails": 45.45454545454545, "fastqc-total_sequences": 0.143677 }, "JPMS2": { "fastqc-percent_duplicates": 95.07550937025417, "fastqc-percent_gc": 51.0, "fastqc-avg_sequence_length": 464.088645456718, "fastqc-median_sequence_length": 467, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.129719 }, "IAMS1": { "fastqc-percent_duplicates": 97.9219164848231, "fastqc-percent_gc": 54.0, "fastqc-avg_sequence_length": 458.31947156146765, "fastqc-median_sequence_length": 467, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.14802099999999999 }, "DAFS1": { "fastqc-percent_duplicates": 94.95648190563445, "fastqc-percent_gc": 54.0, "fastqc-avg_sequence_length": 456.9547984425103, "fastqc-median_sequence_length": 467, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.08732 }, "DAFS2": { "fastqc-percent_duplicates": 91.96722210041658, "fastqc-percent_gc": 54.0, "fastqc-avg_sequence_length": 454.6640265292699, "fastqc-median_sequence_length": 462, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.036488 }, "IAMS2": { "fastqc-percent_duplicates": 96.6512367514975, "fastqc-percent_gc": 54.0, "fastqc-avg_sequence_length": 452.2845404378323, "fastqc-median_sequence_length": 442, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.148413 }, "JVMS2": { "fastqc-percent_duplicates": 94.88337895417541, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 461.5294719498259, "fastqc-median_sequence_length": 467, "fastqc-percent_fails": 45.45454545454545, "fastqc-total_sequences": 0.112887 }, "ICFS2": { "fastqc-percent_duplicates": 93.34993355919218, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 446.1869380963212, "fastqc-median_sequence_length": 442, "fastqc-percent_fails": 27.27272727272727, "fastqc-total_sequences": 0.167066 }, "IPMS2": { "fastqc-percent_duplicates": 95.7074681423567, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 447.0931825489499, "fastqc-median_sequence_length": 442, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.236364 }, "DPFS1": { "fastqc-percent_duplicates": 95.38660228798696, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 465.0538572172854, "fastqc-median_sequence_length": 467, "fastqc-percent_fails": 45.45454545454545, "fastqc-total_sequences": 0.13627699999999998 }, "DCFS1": { "fastqc-percent_duplicates": 95.22049977657856, "fastqc-percent_gc": 51.0, "fastqc-avg_sequence_length": 464.4373045062386, "fastqc-median_sequence_length": 467, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.11637199999999999 }, "JCMS2": { "fastqc-percent_duplicates": 94.80268552269462, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 461.4879281371013, "fastqc-median_sequence_length": 467, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.123179 }, "JPMS1": { "fastqc-percent_duplicates": 95.72063374119465, "fastqc-percent_gc": 51.0, "fastqc-avg_sequence_length": 462.4688042314593, "fastqc-median_sequence_length": 467, "fastqc-percent_fails": 45.45454545454545, "fastqc-total_sequences": 0.204563 }, "JAFS1": { "fastqc-percent_duplicates": 96.61919092674398, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 463.53022226692144, "fastqc-median_sequence_length": 467, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.12925899999999999 }, "JCFS2": { "fastqc-percent_duplicates": 97.28241587292923, "fastqc-percent_gc": 51.0, "fastqc-avg_sequence_length": 466.4571654703747, "fastqc-median_sequence_length": 467, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.146564 }, "DPMS2": { "fastqc-percent_duplicates": 92.43800608809693, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 458.37495939263414, "fastqc-median_sequence_length": 467, "fastqc-percent_fails": 45.45454545454545, "fastqc-total_sequences": 0.08311299999999999 }, "CAMS2": { "fastqc-percent_duplicates": 96.1841115723955, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 445.3213973452031, "fastqc-median_sequence_length": 442, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.163553 }, "DAMS2": { "fastqc-percent_duplicates": 96.90243371054352, "fastqc-percent_gc": 50.0, "fastqc-avg_sequence_length": 465.47108126465804, "fastqc-median_sequence_length": 467, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.078029 }, "IVMS1": { "fastqc-percent_duplicates": 94.98017171164194, "fastqc-percent_gc": 52.0, "fastqc-avg_sequence_length": 448.661433645334, "fastqc-median_sequence_length": 442, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.149786 }, "CPMS2": { "fastqc-percent_duplicates": 94.4743703763593, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 443.1454703480616, "fastqc-median_sequence_length": 442, "fastqc-percent_fails": 27.27272727272727, "fastqc-total_sequences": 0.197896 }, "CPFS1": { "fastqc-percent_duplicates": 95.57043809312084, "fastqc-percent_gc": 54.0, "fastqc-avg_sequence_length": 464.0949618596379, "fastqc-median_sequence_length": 467, "fastqc-percent_fails": 45.45454545454545, "fastqc-total_sequences": 0.143942 }, "IVFS1": { "fastqc-percent_duplicates": 97.20301512530655, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 444.1805913728395, "fastqc-median_sequence_length": 437, "fastqc-percent_fails": 45.45454545454545, "fastqc-total_sequences": 0.221417 }, "CVFS1": { "fastqc-percent_duplicates": 94.4122355282862, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 443.4191457100071, "fastqc-median_sequence_length": 442, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.213019 }, "IVMS2": { "fastqc-percent_duplicates": 95.85075951398657, "fastqc-percent_gc": 51.0, "fastqc-avg_sequence_length": 462.34728057173606, "fastqc-median_sequence_length": 467, "fastqc-percent_fails": 45.45454545454545, "fastqc-total_sequences": 0.10592299999999999 }, "IPFS2": { "fastqc-percent_duplicates": 94.52878317821441, "fastqc-percent_gc": 53.0, "fastqc-avg_sequence_length": 443.3502654257153, "fastqc-median_sequence_length": 442, "fastqc-percent_fails": 27.27272727272727, "fastqc-total_sequences": 0.217575 }, "JAFS2": { "fastqc-percent_duplicates": 96.01628486358389, "fastqc-percent_gc": 54.0, "fastqc-avg_sequence_length": 462.32100018229323, "fastqc-median_sequence_length": 467, "fastqc-percent_fails": 36.36363636363637, "fastqc-total_sequences": 0.082285 }, "JAMS1": { "fastqc-percent_duplicates": 98.31632109580114, "fastqc-percent_gc": 50.0, "fastqc-avg_sequence_length": 466.6889204278437, "fastqc-median_sequence_length": 467, "fastqc-percent_fails": 45.45454545454545, "fastqc-total_sequences": 0.15959099999999998 }, "DVFS2": { "fastqc-percent_duplicates": 93.66945842645, "fastqc-percent_gc": 51.0, "fastqc-avg_sequence_length": 461.2144781637043, "fastqc-median_sequence_length": 467, "fastqc-percent_fails": 45.45454545454545, "fastqc-total_sequences": 0.095758 }, "JPFS2": { "fastqc-percent_duplicates": 97.44523494120716, "fastqc-percent_gc": 51.0, "fastqc-avg_sequence_length": 466.55985924497617, "fastqc-median_sequence_length": 467, "fastqc-percent_fails": 45.45454545454545, "fastqc-total_sequences": 0.195517 } } }, "config_analysis_dir_abs": [ "/data/MicrobiomaFrangos/output/fastqc/pos" ], "config_analysis_dir": [ "/data/MicrobiomaFrangos/output/fastqc/pos" ], "config_creation_date": "2024-10-15, 16:41 -03", "config_git_hash": null, "config_intro_text": null, "config_report_comment": null, "config_report_header_info": null, "config_script_path": "/home/dgpinheiro/.local/lib/python3.9/site-packages/multiqc", "config_short_version": "1.25.1", "config_subtitle": null, "config_title": "Amplicons", "config_version": "1.25.1", "config_output_dir": "/srv/data/MicrobiomaFrangos/output/fastqc/pos" }